CCR2 antagonist attenuates calcium oxalate-induced kidney oxidative stress and inflammation by regulating macrophage activation

Abstract

C-C chemokine receptor type 2 (CCR2) is a monocyte chemokine associated with oxidative stress and inflammation. Kidney stones (KS) are composed of calcium oxalate (CaOx), which trigger renal oxidative stress and inflammatory. This study aims to evaluate the effects of CCR2 on KS in vivo and in vitro. Eight-week-old male C57BL/6J mice were intraperitoneally injected with glyoxylate (GOX) daily to establish a KS model, and along with CCR2 antagonist (INCB3344) treatment on days 2, 4, and 6. The results showed that CCR2 antagonist reduced renal injury markers (blood urea nitrogen and serum creatinine), alleviated renal tubular injury and CaOx crystal deposition. CCR2 antagonist also decreased CCR2 expression induced by GOX treatment and increased Nrf2 expression. GOX treatment promoted malondialdehyde (MDA) production, decreased glutathione (GSH) content, and inhibited catalase (CAT) and superoxide dismutase (SOD) activity, however, CCR2 antagonist attenuated the above effects of GOX. CCR2 antagonist had inhibitory effects on GOX-induced inflammatory cytokine expression (IL1B, IL6 and MCP1), and inhibited apoptosis by increasing Bcl-2 expression and decreasing Bax and cleaved-caspase 3 expression. In vitro experiments were performed by co-culture model of CaOx-induced damaged HK-2 cells and macrophage-like THP-1 cells. CCR2 antagonist inhibited CaOx-induced THP-1 cell M1 polarization by decreasing the TNF-α, IL6 and iNOS levels, and further alleviated CaOx-induced oxidative stress damage, inflammatory response and apoptosis of HK-2 cells. The study suggests that CCR2 antagonist may be resistant to CaOx crystals-induced oxidative stress and inflammation by inhibiting macrophage M1 polarization.

Introduction

Kidney stones (KS) are worldwide public health problem that impose a huge economic burden on patients and society [1]. KS lead to urinary tract infection and urinary obstruction, eventually causing renal function disability and renal insufficiency [2]. KS are caused by anomalous accumulation of crystalline materials (such as calcium oxalate, struvite stone and uric acid stone) in kidney, of which calcium oxalate (CaOx) is the most common and stands at 80% [3]. The CaOx crystal deposition induces oxidative stress, inflammation and cell apoptosis, ultimately leading to renal damage [4]. CaOx crystals-induced immune and inflammatory responses may lead to the cytotoxicity of CaOx crystals to renal epithelial cells [5]. Mulay also finds that CaOx crystals activate murine renal bone marrow-derived dendritic cells to secrete IL-1β and directly injure tubular cells [6]. This suggests that CaOx crystals may be involved in the immune microenvironment of KS.

Macrophages play an important role in immunity and inflammation regulation [7]. M1-like macrophages exhibit the pro-inflammatory phenotype and cause acute kidney injury [8], while M2-like macrophages reduce the inflammatory infiltration and kidney injury [9]. M1-like macrophages accelerate CaOx crystal deposition, but M2-like macrophages inhibit their formation [10]. M2-like macrophages alleviate CaOx-induced oxidative stress injury and apoptosis of HK-2 cells [11]. Interestingly, CaOx crystals stimulate the release of TNF-α, IL-1β and IL-6 from human monocytes and initiate the innate immune response [12]. CaOx crystals alter the cellular proteome of macrophages and induce U937-derived macrophages stretched pseudopodia [13]. However, whether CaOx regulates the phenotype switching of macrophages and its underlying mechanisms during KS remain unclear.

C-C chemokine receptor type 2 (CCR2) is a surface receptor discovered on most inflammatory monocytes and macrophages, participating in inflammatory response [14]. CCR2-positive (CCR2+) inflammatory monocytes are crucial early response immune cells, and excessive infiltration or accumulation vitiates the remission of inflammation and promotes disease progression [15, 16]. CCR2+ monocytes appear pro-inflammatory activity and differentiate into monocyte-derived CCR2+ macrophages with features similar to classically activated macrophages (M1-like macrophages), whereas CCR2-negative (CCR2-) macrophages have phenotypic characteristics similar to alternately activated macrophages (M2-like macrophages) [17]. CCR2+ monocytes are recruited into the glomerular capillaries and may be precursors of immature macrophages in the nephritic kidney [18]. The CCR2^−/− mice exhibit lower polarization of macrophages [19]. INCB3344, a CCR2 antagonist, suppresses the infiltration and function of bone marrow-derived macrophages in the kidney tissues of mice subjected to diabetic nephropathy [20]. Aging promotes chronic nephritis by increasing the enrichment of renal CCR2+ macrophages during aging [21]. However, the effects of CCR2 on CaOx crystal deposition-induced KS remain poorly understood.

In current work, we investigated the effects of CCR2 on KS induced by CaOx crystals in vivo and in vitro. These results indicated that CCR2 inhibition suppressed CaOx crystal deposition-induced renal oxidative stress, inflammation, and apoptosis in vivo, and attenuated monocyte-derived M1 macrophages induced by CaOx to alleviate CaOx-induced HK-2 cell damage in vitro.

Materials and Methods

Animal

All 8-week-old male C57BL/6J mice were obtained from Liaoning Changsheng (Liaoning, China). Throughout the experiment, a 12-h light/dark cycle was maintained, the temperature was 22 ± 1°C, the humidity was 45–55%, and food and water were freely available. After accommodation for 1 week, mice were randomly assigned to 4 groups: Control group, GOX group, GOX + DMSO group, and GOX + DMSO + INCB3344 group. The mice in Control group were intraperitoneally injected of normal saline. The mice in the other groups were administered 80 mg/kg GOX (Macklin; Shanghai, China) by daily intraperitoneal injection to establish KS models for 6 consecutive days. The mice in the GOX + DMSO + INCB3344 and GOX + DMSO groups received intraperitoneal injection of 5 mg/kg INCB3344 or DMSO, respectively, on the 2nd, 4th and 6th days. On the day after the final injection, mouse anesthesia was induced with 3% isoflurane, and maintained with 1.5% isoflurane to collect blood through abdominal aorta. Then, mice were euthanized with CO₂, and kidney tissues were harvested for the further analysis. All experiments involving animals were conducted in strict accordance with the ‘National Institutes of Health Guide for the Care and Use of Laboratory Animals’. All procedures were approved by the Animal Ethics Committee of Tianjin Medical University.

Renal function analysis

Blood samples were collected and centrifuged at 1,000 g for 20 min at 4°C, and the levels of serum creatinine (Cre) and blood urea nitrogen (BUN) were measured immediately using the Cre determination kit (Nanjing Jiancheng; Nanjing, China) and BUN Test Kit (Nanjing Jiancheng) according to the manufacturer’s instructions.

Hematoxylin-eosin (H&E) staining

The kidney tissues were fixed with 4% paraformaldehyde, dehydrated with ethanol, embedded in paraffin, and sliced into 5 µm sections. Subsequently, the sections were baked and dewaxed conventionally to water. H&E staining was performed following the routine staining procedure. In short, the sections were stained with the hematoxylin solution for 5 min and counterstained with eosin for 3 min. Finally, the sections were dehydrated, cleared with xylene, and sealed with neutral gum. The images were observed under a BX53 microscope (40× and 200×; Olympus; Tokyo, Japan).

Von Kossa staining

The kidney sections were stained with the Von Kossa staining (LEAGENE; Beijing, China) to detect CaOx crystal deposition. Briefly, the 5 µm sections were treated with silver solution and exposed to strong light, followed by washing with distilled water for 1 min. Thereafter, the sections were treated with sodium thiosulphate for 2 min, and counterstained with eosin for 1 min. After dehydration in the usual manners, the sections were observed under a BX53 microscope (200×).

TUNEL assay

The kidney sections were stained with TUNEL reagent (Roche; Basel, Switzerland) for the in situ detection of apoptosis. The 5 µm sections were permeabilized with 0.1% Triton X-100 at room temperature. The permeabilized sections were incubated with prepared TUNEL solution (the enzyme solution and label solution at a 1:9 ratio), and kept in the dark for 60 min at 37°C in a humidified chamber. After washing with PBS, DAPI (Aladdin; Shanghai, China) was used for counterstaining for 5 min. Subsequently, anti-fluorescence quencher (Solarbio; Beijing, China) was added to seal the sections. The images were observed under a BX53 microscope (400×).

Cell culture

The human monocytic cells (THP-1) and human proximal renal tubular epithelial cells (HK-2) were purchased from the Saibaikang Biological Technology Co., Ltd. (Shanghai, China). THP-1 and HK-2 cells were incubated in a 37°C, 5% CO₂ incubator, and cultured in RPMI-1640 medium (Solarbio) or HK-2 special medium (Saibaikang), respectively. THP-1 cells were differentiated into macrophage-like cells using RPMI-1640 medium containing phorbol 12-myristate 13-acetate, and then washed with PBS for subsequent study. Differentiated THP-1 cells were pretreated with 100 µM INCB3344 for 10 min and then treated with 2.5 mM CaOx for 24 h. THP-1 cell supernatant and precipitates were collected for follow-up ELISA assay and iNOS detection.

ELISA

After the polarisation of THP-1 cells, the cell supernatant was collected. The levels of tumor necrosis factor-α (TNF-α) and IL6 were detected according to the procedures of corresponding ELISA kit (Human TNF-α ELISA Kit and Human IL6 ELISA Kit; Lianke, China). Absorbance was recorded at 450 nm and 570 nm using an ELX-800 microplate reader (BIOTEK; Winooski, VT, USA). The levels of TNF-α and IL6 were calculated according to the standard curve.

Co-culture of THP-1 and HK-2 cells

Differentiated THP-1 cells were pretreated with 100 µM INCB3344 for 10 min as described above. Afterward, the pretreated THP-1 cells (5 × 10⁵) were seeded into the upper chamber and HK-2 cells (2.5 × 10⁵) were seeded into the lower chamber. All cells were treated with 2.5 mM CaOx and incubated at 37°C in a humidified atmosphere containing 5% CO₂ for 24 h. HK-2 cells were collected for subsequent detection.

CCK8 assay

The viability of HK-2 cells in co-cultured lower-chamber was evaluated by CCK8 assay. The 10 µl CCK8 solution (KeyGEN; Nanjing, China) was diluted in 100 µl serum-free medium according to the manufacturer’s instructions. And then, the HK-2 cells were incubated in medium containing CCK8 at 37°C for 2 h. After incubation, absorbance was recorded at 450 nm using an 800TS microplate reader (BIOTEK).

Flow cytometry

Cell apoptosis of HK-2 cells in co-cultured lower-chamber was measured using an Annexin V-FITC/PI double stain apoptosis detection kit (KeyGEN) according to the manufacturer’s protocols. In Brief, HK-2 cells in co-cultured lower-chamber were collected, and re-suspended in 500 µl binding buffer. Then, 5 µl Annexin V-FITC and 5 µl PI (propidium iodide) was added to the cell suspension, mixed gently, and incubated for 10 min in the dark at room temperature. Finally, the cell apoptosis was detected by a NovoCyte flow cytometer (Agilent; Santa Clara, CA, USA).

Oxidative stress indexes analysis

The kidney tissue samples were added with normal saline according to the weight (g) and volume (ml) ratio of 1:9, homogenized in the ice water bath and centrifuged at 2,500 rpm for 10 min, and the supernatant was collected. The cell samples were re-suspended with PBS and lysed using ultrasonic cracking, and the cell suspensions were collected. Oxidative stress indexes, including malondialdehyde (MDA; MDA assay kit), glutathione (GSH; Reduced glutathione assay kit), catalase (CAT; Catalase test kit) and superoxide dismutase (SOD; Superoxide dismutase assay kit), were detected in strict accordance with the corresponding instructions of Nanjing Jiancheng Bioengineering Institute.

Real-time PCR

The total RNA was extracted according to the TRIpure total RNA extraction reagent instructions (BioTeke; Beijing, China). The concentration of RNA sample was determined using a NANO 2000 spectrophotometer (Thermo; Pittsburgh, PA, USA). The cDNA synthesis was performed using BeyoRT II M-MLV reverse transcriptase (Beyotime Biotechnology; Shanghai, China), and RT-qPCR was performed using SYBR Green (Solarbio) and 2×Taq PCR Master Mix (Solarbio). The cycling conditions were as follows: 5 min at 95°C, 40 cycles of 10 s at 95°C, 10 s at 60°C, 15 s at 72°C, followed by incubation for 1 min 30 s at 72°C, 1 min at 40°C. The results were calculated using the 2^–ΔΔCT method. The primer sequences were shown in Table 1.

Table 1. The primer sequences were used in the study.

Name	Forward primer (5’-3’)	Reverse primer (5’-3’)
Homo iNOS	AGCGGTAACAAAGGAGATAG	CAGGTTGGACCACTGGAT
Homo Arg1	ACGGAAGAATCAGCCTGGTG	GTCCACGTCTCTCAAGCCAA
Homo TNFA	GAGTGACAAGCCTGTAGCC	AAGAGGACCTGGGAGTAGAT
Homo IL6	GTCCAGTTGCCTTCTCCC	GCCTCTTTGCTGCTTTCA
Homo CCR2	TGGTCCTGCCGCTGCTCAT	TGTCACCTGCGTGGCTTGG
mus CCR2	TGTCATTTATGCCTTTGTTG	CGATCTGCTGTCTCCCTAT
mus IL1B	TTCCCATTAGACAACTGC	GATTCTTTCCTTTGAGGC
mus IL6	TAACAGATAAGCTGGAGTC	TAGGTTTGCCGAGTAGA
mus MCP1	TGGGTCCAGACATACATTA	TCAGATTTACGGGTCAACT

Western blot

The total protein was extracted with radioimmunoprecipitation (RIPA) buffer (Solarbio) supplemented with PMSF protease inhibitor (Solarbio; 10 µl PMSF for every 1 ml RIPA). The protein concentration was measured following the BCA protein concentration assay kit instructions (Solarbio). The protein was separated on SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Solarbio) and transferred on polyvinylidene fluoride (PVDF) membranes (Millipore; Billerica, MA, USA) at 80 V for 1.5 h. The PVDF membranes were blocked in Tris-buffered saline (TBS) containing 5% skim milk (Sangon Biotech; Shanghai, China) for 1 h, and immunoblotted with primary antibodies against CCR2 (1:500; Abclonal; Shanghai, China), Nrf2 (1:1,000; Affinity; Changzhou, China), Bcl-2 (1:500; Abclonal), Bax (1: 400; Abclonal) and cleaved-caspase 3 (1:1,000; CST; Shanghai, China), respectively. After incubation with primary antibodies, the membranes were incubated with corresponding HRP-linked secondary antibodies (Goat anti-rabbit IgG-HRP, 1:3,000; Goat anti-mouse IgG-HRP, 1:10,000; Solarbio). GAPDH antibody (1:10,000; Proteintech; Wuhan, China) was used as an internal reference. The immunoreactive bands were observed using an ECL plus ultra-sensitive luminescent liquid (Solarbio). Band densities were measured using a gel image processing system (Gel-Pro Analyzer 4.0; Media Cybernetics; Bethesda, MD, USA). And the target protein levels were normalized to the corresponding GAPDH levels.

Statistical analysis

The GraphPad Prism software was used for statistical analysis. Values were expressed as mean ± SD. One-way analysis of variance (ANOVA) was executed for multiple-group comparisons. Tukey’s multiple comparisons test was used for the post hoc analysis. The value of P<0.05 was indicated as statistical significance.

Results

CCR2 antagonist relieved kidney damage and CaOx crystal deposition

To explore the underlying function of CCR2 on renal crystal deposition, we established a KS mouse model induced by GOX, and INCB3344 was used to assess the contribution of CCR2 to KS, as shown in Fig. 1A. As expected, the levels of BUN and Cre were lower in the KS mice received INCB3344 than that received DMSO (Figs. 1B and C). INCB3344 treatment alleviated GOX administration-induced renal injury (tubular degeneration, swelling, and vacuole formation) and inflammatory cell infiltration (Fig. 1D). Von Kossa staining demonstrated that GOX administration resulted in CaOx crystal deposition compared to mice in Control group, and INCB3344 treatment decreased GOX-induced CaOx crystal deposition (Fig. 1E). As shown in Fig. 1F, CCR2 expression was elevated in KS mouse models, however, INCB3344 treatment decreased CCR2 expression. In addition, INCB3344 treatment further increased the expression of Nrf2 (Fig. 1G).

Fig. 1.

C-C chemokine receptor type 2 (CCR2) antagonist relieved kidney damage and calcium oxalate (CaOx) crystal deposition. C57BL/6J mice were intraperitoneally injected with 80 mg/kg/day glyoxylate (GOX) for 6 days, and along with 5 mg/kg INCB3344 treatment on days 2, 4, 6. (A) Diagram of the experimental design. (B, C) The serum levels of blood urea nitrogen (BUN) and serum creatinine (Cre) were measured using commercial kits. (D) Renal histopathological changes were evaluated by H&E staining. Original magnification 40× and 200×; Scale bars: 500 µm and 100 µm in the panels. (E) The GOX-induced kidney stone was evaluated by Von Kossa staining. Original magnification 200×; Scale bars: 100 µm in the panels. (F) The expression of CCR2 in kidney tissues was detected by real-time PCR and western blot. The histogram showed the quantitative gray scale values of the blot. (G) The expression of nuclear factor erythroid 2-related factor (Nrf2) in kidney tissues was detected by western blot. The histogram showed the quantitative gray scale values of the blot. ***P<0.001, **P<0.01, *P<0.05; Data represented the mean ± SD of 6 independent experiments.

CCR2 antagonist attenuated CaOx crystal deposition-induced kidney oxidative stress and inflammation

Compared to mice in Control group, the level of MDA was increased, and GSH level, CAT activity and SOD activity were decreased in the kidney tissues of mice subjected to CaOx crystal deposition, as shown in Figs. 2A–D. And the changes were reversed in the kidney tissues of mice received INCB3344 treatment. Meanwhile, INCB3344 treatment alleviated the CaOx crystal deposition-induced the elevated levels of IL1B, IL6 and MCP1 (monocyte chemoattractant protein 1) in KS mice (Figs. 2E–G).

Fig. 2.

C-C chemokine receptor type 2 (CCR2) antagonist attenuated glyoxylate (GOX)-induced oxidative stress and inflammation in kidney. (A, B) The levels of malondialdehyde (MDA) and glutathione (GSH) in kidney tissues were measured using commercial kits. (C, D) The enzyme activity of catalase (CAT) and superoxide dismutase (SOD) in kidney tissues was measured using a commercial kit. (E–G) The expression of interleukin 1β (IL1B), interleukin 6 (IL6) and monocyte chemotactic protein 1 (MCP1) in kidney tissues was detected by real-time PCR. ***P<0.001, **P<0.01, *P<0.05; Data represented the mean ± SD of 6 independent experiments.

CCR2 antagonist repressed CaOx crystal deposition-induced cell apoptosis in vivo

As shown in Fig. 3A, the number of TUNEL-positive apoptotic cells was increased in the kidney tissues of mice subjected to CaOx crystal deposition compared with Control group, and INCB3344 treatment decreased the number of apoptotic cells. When mice subjected to CaOx crystal deposition, the expression level of protective Bcl-2 was reduced in kidney tissues, while the expression levels of apoptosis-promoting Bax and cleaved-caspase 3 were increased (Figs. 3B and C). However, INCB3344 treatment reversed these trends.

Fig. 3.

C-C chemokine receptor type 2 (CCR2) antagonist repressed glyoxylate (GOX)-induced cell apoptosis in kidney tissues. (A) Cell apoptosis in kidney tissues was assessed by the TUNEL assay. Original magnification 400×; Scale bars: 50 µm in the panels. (B, C) The expression of Bcl-2, Bax and cleaved caspase-3 in kidney tissues was determined by western blot. The histogram showed the quantitative gray scale values of the blot. ***P<0.001, **P<0.01; Data represented the mean ± SD of 6 independent experiments.

CCR2 antagonist inhibited CaOx-induced THP-1 cell M1 polarization

In vitro experiments showed that CaOx treatment increased the expression of CCR2 (Fig. 4A). As shown in Figs. 4B and C, pretreatment with INCB3344 effectively alleviated the increase of TNF-α and IL6 levels caused by CaOx treatment. At the same time, CaOx treatment resulted in a significant increase in iNOS expression and a downward trend of Arg1 expression, while INCB3344 pretreatment reversed above trend (Figs. 4D and E). These results indicated that CCR2 antagonist might be resistant to CaOx-induced M1 polarization.

Fig. 4.

C-C chemokine receptor type 2 (CCR2) antagonist inhibited calcium oxalate (CaOx)-induced M1 polarization. THP-1 cells were pretreated with INCB3344 (100 µM) for 10 min, and then treated with CaOx (2.5 mM) for 24 h. (A) The expression of CCR2 in THP-1 cells was detected by real-time PCR and western blot. The histogram showed the quantitative gray scale values of the blot. (B, C) The levels of tumor necrosis factor-α (TNF-α) and IL6 in THP-1 cells were measured using ELISA kits. (D, E) The expression of inducible nitric oxide synthase (iNOS) and arginase 1 (Arg1) in THP-1 cells was detected by real-time PCR. ***P<0.001, **P<0.01, *P<0.05; Data represented the mean ± SD of 3 independent experiments.

CCR2 antagonist attenuated CaOx-induced oxidative stress and inflammation in HK-2 cells

The aforementioned results showed that INCB3344 inhibited CaOx-induced M1 polarization, thus, the co-cultivation model of macrophage-like THP-1 cells and injured HK-2 cells induced by CaOx was established to simulate the interaction between macrophages and renal tubular epithelial cells during the process of CaOx crystal deposition. Compared to Control group, CaOx-stimulated THP-1 cells led to the increased MDA level, and the decreased GSH level, CAT activity and SOD activity in HK-2 cells (Figs. 5A–D). Interestingly, these changes were reversed by INCB3344 pretreatment. INCB3344 pretreated-THP-1cells also alleviated the elevated levels of TNFA and IL6 in HK-2 cells injured by CaOx (Figs. 5E and F).

Fig. 5.

C-C chemokine receptor type 2 (CCR2) antagonist attenuated calcium oxalate (CaOx)-induced oxidative stress and inflammation in HK-2 cells. The THP-1 cells pretreated with or without INCB3344 were then treated with CaOx, subsequently, co-cultured with HK-2 cells treated with CaOx. (A, B) The levels of malondialdehyde (MDA) and GSH in HK-2 cells were measured using commercial kits. (C, D) The enzyme activity of catalase (CAT) and superoxide dismutase (SOD) in HK-2 cells was measured using a commercial kit. (E, F) The expression of TNFA and IL6 in HK-2 cells was detected by real-time PCR. ***P<0.001, **P<0.01, *P<0.05; Data represented the mean ± SD of 3 independent experiments.

CCR2 antagonist attenuated CaOx-induced HK-2 cell apoptosis

As shown in Fig. 6A, CaOx treated-THP-1 cells inhibited, whereas INCB3344 pretreated-THP-1 cells promoted the viability of HK-2 cells subjected to CaOx. The apoptosis rate of HK-2 cells was examined by flow cytometry. After treatment of HK-2 cells with CaOx, the apoptotic rate increased, but INCB3344 pretreated-THP-1 cells abrogated the CaOx-induced HK-2 cell apoptosis (Figs. 6B and C). The expression level of Bcl-2 was reduced by CaOx treated-THP-1 cells, while the expression levels of Bax and cleaved-caspase 3 in HK-2 cells were increased (Fig. 6D). However, INCB3344 pretreated-THP-1 cells reversed these trends. These results showed that INCB3344 pretreated-THP-1 cells appeared to reduce the apoptosis of HK-2 cells induced by CaOx.

Fig. 6.

C-C chemokine receptor type 2 (CCR2) antagonist attenuated calcium oxalate (CaOx)-induced HK-2 cell apoptosis. (A) Cell viability of HK-2 cells was detected by CCK8 assay. (B, C) Apoptosis rate of HK-2 cells was examined by flow cytometry. (D) The expression of Bcl-2, Bax and cleaved caspase-3 in HK-2 cells was determined by western blot. The histogram showed the quantitative gray scale values of the blot. ***P<0.001, **P<0.001, *P<0.05; Data represented the mean ± SD of 3 independent experiments.

Discussion

KS are characterized by high morbidity and recurrence rates, which seriously affect the lives of patients [22]. The current researches on KS are mainly aimed at the pathogenesis of stone formation [23], clinical diagnosis technology [24] and clinical treatment [3]. Due to the complexity of KS, there is still unclear on the mechanism of CaOx crystals-induced kidney injury. In this study, we focused on the effects of CaOx crystals on macrophage polarization, so as to reveal the mechanism of CaOx crystals-induced kidney injury.

The roles of macrophages in CaOx crystal deposition during KS are investigated in ex vivo human samples [25] in vivo [26] and in vitro [27], suggesting that M1-like macrophages facilitate CaOx crystal deposition, while M2-like macrophages exhibit inhibitory effect. However, whether CaOx crystals affect phenotypic transformation of macrophages during KS is unclear. In this study, the GOX-induced KS mouse models were constructed. Results showed the expression of CCR2 was elevated in the kidney tissues of mice with CaOx crystal deposition, and CCR2 antagonist reversed this trend. Sun reported that CCR2 expression was increased in kidney tissues of patients with nephrolithiasis [28], and Tamura found the elevated expression of CCR2 in kidney tissues of mice with KS induced by the depositions of 2, 8-dihydroxyadenine [29]. Clinically, the levels of BUN and Cre are the most frequently used as indicators of kidney function [30]. Ito found that INCB3344 decreased the Cre levels in mice with diabetic nephropathy [20]. In this research, CCR2 antagonist improved renal function and the general condition by decreasing the levels of BUN and Cre during the process of CaOx crystal deposition, and alleviated the GOX administration-induced renal injury and CaOx crystal deposition. Nrf2 has been shown to protect against kidney disease through alleviating ROS [31], and activated Nrf2 inhibits the CaOx crystal deposition [32]. Of note, CCR2 antagonist increased the expression of Nrf2 in kidney tissues of mice with CaOx crystal deposition.

Numerous studies have demonstrated that oxidative stress and inflammation play a crucial role in the progression of KS [33]. MDA content reflects the membrane lipid peroxidation level and is a measurement of the degree of oxidative stress damage [34]. GSH, CAT and SOD are three major antioxidant markers that reflect the antioxidant capacity [35]. CCR2 antagonist relieved kidney oxidative stress by reducing the MDA level and increasing the GSH level, CAT activity and SOD activity. Meanwhile, CCR2 antagonist reduced the expression of inflammation markers (IL1B, IL6 and MCP1). MCP1 is a well-known pro-inflammatory chemokine that recruits monocytes to injured tissue, and prolonged expression of MCP1 induced an extensive inflammatory response [36]. More specifically, CaOx crystals might aggravate the inflammatory response by CCR2+ (CCR2 is a receptor of MCP1) monocytes. CCR2 silencing ameliorates obesity-induced kidney injury through inhibiting oxidative stress [37]. CCR2 mediated inflammatory response in kidney tissues of mice with a bilateral kidney ischemia/reperfusion injury [38]. Therefore, CCR2 inhibition might inhibit CaOx crystal deposition-induced renal oxidative stress and inflammatory response. Apoptosis, a form of programmed cell death, is activated during CaOx crystal deposition [39]. Our results demonstrated that apoptosis induction in mice with KS was repressed by CCR2 antagonist.

Macrophages are present in normal kidneys and increased in diseased kidneys, where they serve as pivotal participants in kidney damage [40]. M1-like macrophages have been reported to exacerbate inflammation-related oxidative stress to promote crystal deposition [10], yet the effects of crystal deposition on M1-like macrophages remains unclear. This study found that CaOx increased the expression of CCR2 in macrophage-like THP-1 cells, thus, we speculated that CaOx and CCR2 might be related to macrophage phenotype. Further, CCR2 antagonist inhibited CaOx-induced the increase of TNF-α and IL6 levels and iNOS expression and the decrease of Arg1 expression, which suggesting that CCR2-mediated inflammatory macrophage phenotype perhaps play a key role in CaOx-induced kidney inflammation. CaOx stimulated the release of TNF-α, IL1β and IL6 from THP-1 cells, and promote the polarization of primary human monocytes into M1-like macrophages [12]. CaOx induced U937-derived macrophages stretched pseudopodia [13]. The THP-1 cells subjected to CaOx showed M1-like macrophages characterized by elevated of pro-inflammatory cytokines (TNF-α and IL6) levels and M1 marker (iNOS) expression [33]. A previous research showed that CaOx induced macrophage M1 polarization to aggravate kidney injury and crystal deposition [41]. Consistent with this, our results also showed that CaOx induced THP-1 cells-derived macrophage M1 polarization. Interestingly, CaOx failed to induce iNOS expression and THP-1 cells exhibited an M2-like phenotype when CCR2 was inhibited by INCB3344, suggesting that CCR2 antagonist probably inhibited CaOx-induced macrophage M1 polarization. Together, CCR2 antagonist might alleviate inflammation by suppressing CaOx-induced M1-like macrophages. Similarly, Du found that CCR2 inhibition might reduce the expression of iNOS, and then alleviate macrophage activation in diabetic nephropathy [42]. He revealed that CCR2 inhibitor suppressed microglial M1 polarization in vitro [43]. Our experiment demonstrated that CCR2 mediated the pro-inflammatory M1 macrophage polarization induced by CaOx crystal deposition.

In addition to inflammation, CaOx crystals are known to induce oxidative stress injury of HK-2 cells [44]. And to better simulate in vivo interaction between macrophages and renal tubular cells, in vitro co-culture model of injured HK-2 cells induced by CaOx and macrophage-like THP-1 cells was constructed. In vitro cell experiments yielded the results similar to those of the in vivo models. The macrophage-like THP-1 cells pretreated by CCR2 antagonist attenuated CaOx-induced oxidative stress, inflammation and apoptosis in HK-2 cells. Previous studies found that M2-like macrophages showed the protective effects on CaOx-induced HK-2 cell injured [45], and M2-like macrophages promoted the proliferation of renal tubular epithelial cells in mouse models of renal ischemia/reperfusion [46]. To sum up, CaOx crystal deposition might induce the pro-inflammatory phenotype of macrophages through CCR2, thereby aggravating local inflammation and oxidative stress, and causing kidney tissue damage.

In summary, the present study shows that the CCR2 antagonist attenuates kidney oxidative stress, inflammation, and cell apoptosis in vivo and in vitro, and relieves HK-2 cell damage by inhibiting CaOx-induced THP-1 cell M1 polarization, which indicates that CCR2 may be used as a potential target for CaOx-induced macrophage polarization to promote renal damage.

Conflict of Interest

All authors declared no conflict of interest.