ABTRACT
Hatchability could be quite different among individuals of indigenous chicken breed which might be affected by the egg quality. In this study, hatchability was individually recorded among 800 forty-wk-old Huainan partridge chickens. The chickens were then divided into high and low hatchability groups (HH and LH group) with 50 birds in each group. Egg quality was further determined in the 2 groups. Eight birds from each group were selected for slaughtering and tissue, responsible for egg formation, collection for structure observation by staining and candidate gene expression by transcriptome analysis. The hatchability in HH was 100% and 61.18% in LH. The eggshell thickness and shell strength were significantly lower, while the albumen height and Haugh unit were significantly higher in HH group than those in LH group (P < 0.05). The magnum weight and index, and the expression of polypeptide N-acetylgalactosaminyltransferase 9 (GALNT9), which responsible for thick albumen synthesis, in HH group were also significantly higher than that of LH group (P < 0.05). Compared with the LH group, there were 702 differentially expressed genes (DEGs) in HH group, of which 402 were up-regulated and 300 were down-regulated. Candidate genes of calbindin 1 (CALB1) and solute carrier family 26 member 9 (SLC26A9), which regulate calcium signaling pathway so as to affect Ca2+ transportation, exhibited significant high and low expression, respectively, in HH group compared to those in LH group (P < 0.05). Therefore, indigenous chicken with high expression of GALNT9 in magnum to form thick albumen to provide more protein for embryo, while high CALB1 and low expression of SLC26A9 to decrease Ca2+ transportation so as to form a thinner eggshell and provide better gas exchange during embryo development.
Key words: hatchability, egg quality, transcriptome, Huainan partridge chicken, Ca2+ transportation
INTRODUCTION
Hatching rate is an important index in evaluation of poultry breeding traits. There are many factors affecting hatchability, including breed, egg quality, age of hens, and so on (Mbajiorgu, 2011; Sahan et al., 2014; Wu et al., 2022; Cheng et al., 2023). Nutrients in the egg are the direct source of nutrition for embryo development. As the main part of egg, egg white provides protein, water, trace elements, vitamins, etc, for embryonic development and avoids bacterial contamination (Guyot et al., 2016). The high albumen height is positively correlated with Haugh unit (HU) according to the formula. High albumen height usually indicates high dry matter or viscosity in the albumen and thus could provide more nutrients for embryo development (Dang et al., 2023). Tona et al. (2004) found that fertilized egg produced by hens at 35 wk exhibited higher HU and hatchability, and the chicklings also showed higher growth rate. In addition to the incubation of necessary nutrients, egg shape, shell thickness and eggshell strength could also determine the hatchability of chicken embryos (Sirri et al., 2018; Wu et al., 2022).
The eggshell is mainly composed by inorganic substances, which encapsulated in the periphery of the egg content to form a physical space closed and permeable cavity, creating a relatively stable microenvironment. It ensures that the inside of the egg content was not susceptible to the external physical and microbial environment. During incubation, calcium and magnesium decreased in eggshell, which is associated with the request of the growing embryo for the requirement of certain elements (Szeleszczuk et al., 2016). Decreased minerals from eggshell provide more gas exchange during embryonic development. Adequate oxygen supplementation is quite necessary to maintain normal embryonic development of oxygenation. Intermittent hypoxia challenge during late incubation (E16-E18) could be helpful for chickens rapidly adapt to the shortage of oxygen after birth (Haron et al., 2022). However, long time hypoxia could lead to developmental abnormalities or embryonic death (Haron et al., 2021). Studies also found that hypoxia during early fetal period could cause growth retardation and programming of adult-onset diseases such as hypertension (Bourque et al., 2012). Fresh fertilized egg is usually stored for 2 to 5 d to increase the air chamber so as to increase oxygen generation to improve hatchability. Therefore, an adequate oxygen and exhaust exchange through eggshell is crucial for the normal development of embryo. Magnum and uterus which are responsible for albumen and eggshell synthesis, could be the most important organ for egg quality and hatchability (Zhang et al., 2020).
The effect of egg quality on hatchability in Huainan chicken is still unclear. In this study, the differences of hatchability and egg quality among indigenous Chinese Huainan partridge chicken were analyzed. Genes and signal pathways that regulated egg quality were screened by transcriptomic analysis so as to provide targets for improving hatchability of indigenous chicken breeds.
MATERIALS AND METHODS
Birds, Management and Experimental Design
All animal experimental procedures in this study were approved by the Animal welfare committee of AnhuiAgricultural University with the assurance number SYDW-P20210823021.
A total of 800 forty-wk-old female Huainan partridge chickens (provided by Huainan partridge chicken conservation farm, Huainan, China) were selected. All the birds were kept in 3-layer cages with one bird per cage. Birds were all free access to feed (Table 1) and water and under a controlled photoperiod of 16 h light: 8 h dark cycles. Egg production was recorded individually and was set for incubation every 5 d. Hatchability and fertility of each bird was calculated according to 6 batches incubation. Birds with same egg production and fertility were divided into high hatchability (HH) and low hatchability (LH) groups with 50 birds in each group. Eggs were collected for 3 consecutive d from the 2 groups for quality determination within 24 h after collection. Eight birds from each group were randomly selected for slaughtering and sampling. Experimental birds were anesthetized with pentobarbital sodium and then slaughtered by carotid bloodletting. Magnum and uterus were weighed, and 2 cm were fixed in fixation for histomorphological analysis, and 5 g were collected and stored at -80℃ for RNA extraction, transcriptome and quantitative analysis.
Table 1.
Composition, formulation and nutrient values of 40-wk-old diet for Huainan partridge chicken.
| Ingredient | Ingredient levels(%) | nutrient | Nutrient levels |
|---|---|---|---|
| Corn | 63 | ME(MJ/kg) | 11.24 |
| Soybean meal | 20 | CP(%) | 15.14 |
| Wheat | 10.5 | Lysine(%) | 0.76 |
| Dicalcium phosphate | 1.5 | Methionine(%) | 0.26 |
| Premix | 5 | Ca(%) | 1.63 |
| P(%) | 0.69 |
Egg Quality Determination
The evaluation of egg quality parameters including egg weight, egg shape index (ESI), eggshell strength (ESS), eggshell thickness (EST), albumen height and HU (Chen et al., 2021). Protein, dry matter and fat in egg yolk and albumen were determined according to Chen et al. (2023). The white and egg yolk were dried at 85℃ for 5 h and weighed as dry matter content. The content of crude fat and protein in egg yolk was determined by Soxhlet extraction with reference to the method of intramuscular fat content determination (Chen et al., 2017).
Analysis of the Index and Morphology of Reproductive Organ
Ovary without developing follicles, magnum and uterus of oviduct were separated and weighed to calculate the index according to Xing et al. (2019). Magnum and uterus were embedded and stained by hematoxylin-eosin staining (HE) method according to Gu et al., 2020. The morphology of mucosal fold height and width, villi length, and width of adjacent 2 mucosal fold was observed using an optical microscope (IX73, Olympus, Tokyo, Japan) at 100× and 400× magnification.
RNA Extraction, cDNA Synthesis and Quantitative RT-PCR
Total RNA was extracted from magnum and uterus of eight birds according to the instructions of the extraction kit (10606ES60, Shanghai Yisheng Biotechnology, Shanghai, China). The integrity was measured using NanoDrop 2000 (Thermo Fisher, Waltham, MA). The cDNA was synthesized according to the Transcript cDNA Synthesis Kit (11123ES60, Shanghai Yisheng Biotechnology, Shanghai, China).
Quantitative RT-PCR (qRT-PCR) was performed using Hieff qPCR SYBR Green Master Mix kit (11202ES08, Shanghai Yisheng Biotechnology, Shanghai, China) on an ABI-7500 (Thermo Fisher Company, Waltham, MA). The primers used for qRT-PCR were designed by Premier 5.0 (https://www.premierbiosoft.com/primerpremier.html, CA) according to the sequences listed in GenBank (Table 2) and were synthesized by General Biosystems (Beijing, China). Gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was set as control.
Table 2.
Primers for quantitative RT-PCR.
| Gene name | Accession number | Primer sequences (5′-3′) | Product length (bp) | Annealing temperature (℃) |
|---|---|---|---|---|
| CYP2AB1 | NC_052540.1 | CAGTGTGGATGGGACAGACT | 189 | 58 |
| TCATCCCAAAGCGTCTCTGT | ||||
| KCNN3 | NC_052556.1 | TCCTACAAGCCATCCACCAG | 190 | 58 |
| TTCAGCTGTTCCAGTTTGGC | ||||
| NDRG4 | NC_052542.1 | GTAGTGTGTCACGTGGATGC | 152 | 60 |
| CCAACACCGATCCCAATCAC | ||||
| MSRB3 | NC_052532.1 | TGCATTCAACCTGCTGCATT | 158 | 60 |
| TGACATGGTACTGCAAGGGT | ||||
| SEMA3C | NC_052532.1 | GCAGCACCAAGCAAATTCAC | 113 | 60 |
| GCACACCAGTCTTGCTTTCA | ||||
| ETNPPL | NC_052535.1 | AGCTGTGGAGGCCAAGTAAT | 176 | 60 |
| GTGACGATGTCAGGCACAAA | ||||
| TCERG1L | NC_052537.1 | GTTCAGCCTCCAGAGTGGAT | 146 | 60 |
| GCTGCGTTCTCTGCCATTAT | ||||
| ARFGEF3 | NC_052534.1 | CACTGGCAGGCTTCCTTTAC | 124 | 60 |
| CTCCTGTCCTGGGTGGATTT | ||||
| TSPAN19 | NC_052532.1 | TTGCATTTCTTCAGGCGAGA | 108 | 60 |
| ACAGTTCCAAGGAATCCCACA | ||||
| PT1A | NC_052536.1 | TAGGACCAAGGCTTCAGTGG | 179 | 60 |
| AGCTCTAGCTGCCTGTATGG | ||||
| PLEKHH1 | NC_052536.1 | GACAGAAGGTGGAGTGGTGA | 158 | 60 |
| GGCTCTCCCAGGAAGGAAAT | ||||
| SLC35B4 | NC_052532.1 | TCAGGCAGTTTCCAGGATGT | 140 | 60 |
| GGCCACCATGATGAGGTAGT | ||||
| FBXO15 | NC_052533.1 | GTTGGCCATGCTTAGACGTT | 99 | 60 |
| GACGAGGACCATTCTTGCTG | ||||
| UGT1A1 | NC_052538.1 | AAATGCTTCCGGAGAACACG | 167 | 60 |
| TCACGTTCTTTGGCAGGTTG | ||||
| FAM149A | NC_052535.1 | CACACAGAGAGTGCATCAGC | 114 | 60 |
| GATCGCTTAACCCAGTCTGC | ||||
| ALDH1A3 | NC_052541.1 | CCCATTGCTGATGCTGGTTT | 155 | 60 |
| GCACAATGTTCACCACACCT | ||||
| PHLDA1 | NC_052532.1 | GCAGCTCTGGAAGAAGAAGC | 181 | 58 |
| GTCCACCGTCTTCATGTTGG | ||||
| CDCP1 | NC_052533.1 | GAAGGCGAGTACCAAAGCTG | 147 | 60 |
| CTGCAGAAGGTGCCAATGTT | ||||
| GAPDH | NC_006088.5 | GGACACTTCAAGGGCACTGT | 160 | 60 |
| TCTCCATGGTGGTGAAGACA |
Western Blotting
Protein from uterus of 3 birds was extracted using an efficient RIPA tissue/cell rapid lysis kit (SL1020-20mL, Kulaibo Technology, Beijing, China). Protein concentration was determined using BCA method. Gel electrophoresis and western blotting were performed according to Wei et al. (2023). The first antibodies were calbindin 1 (CALB1) antibody (YT5209) and solute carrier family 26 member 9 (SLA26A9, YN3643), both were purchased from ImmunoWay Biotechnology (Plano, TX) and were diluted to 1:1,000 before incubation. The second antibody was goat anti rabbit IgG labeled with HRP (1:30,000, Biomiky, Shanghai, China).
Transcriptome Sequencing
Three samples were taken from the high hatching rate group and the low hatching rate group respectively. Total RNA was extracted from the 2 groups (HH and LH) of chicken uterus using a MicroElute Total RNA Kit (Omega, Norcross, GA). RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA). Library preparation, sequencing, and data processing were performed by Novogene Company (Beijing, china). The library was sequenced on an Illumina Novaseq platform (San Diego, CA) using 150 bp paired end read method. Raw data were filtered to ensure the quality and reliability of data analysis. Meanwhile, Q20, Q30, and GC content were calculated for evaluating sequencing quality.
The index of the reference genome was constructed and aligned using HISAT2 v2.0.5. The reference genome was selected red jungle chicken (https://ftp.ensembl.org/pub/release-104/fasta/gallus_gallus/dna/). The genes with log2 |FoldChange| >1 and P value < 0.05 were screening for differentially expressed gene (DEGs). Gene Ontology (GO) and Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of DEGs were implemented by the local version of the Gene Set Enrichment Analysis (GSEA) analysis tool (https://www.broadinstitute.org/gsea/index.jsp). These analysis was done by Novogene (Beijing, China), using the online analysis tool (https://magic.novogene.com/). The protein interaction network (PPI) was analyzed using the online tool STRING (https://string-db.org/)
Statistical Analysis
SPSS 20.0 software (Chicago, IL) was performed with t-test on hatchability rate, egg quality, uterine villus length and width. Results was represented as Mean ± SD. P < 0.05 considered a significant difference. The relative expression of genes detected by qRT-PCR was calculated using 2–ΔΔCT method. The pearson correlation coefficient of log2 (foldchange of qRT-PCR) and log2 (foldchange of RNA-Seq) was calculated and plotted using GraphPad Prism version 8.0 (GraphPad, San Diego, CA).
RESULTS
Comparison of Egg Quality Between High and Low Hatchability Groups in Huainan Partridge Chicken
Fifty chickens were selected with high and low hatching rate, respectively, as HH group (100%) and LH group (61.2%). A total of 150 eggs from each of the HH and LH groups were used for egg quality analysis. The egg weight, albumen height and Haugh unit were significantly higher in HH group as compared to those of the LH group (P < 0.05, Table 3). The EST and ESS were significantly lower in HH group than those in LH group (P < 0.05, Table 3). There were no significant differences in ESI, dry matter, crude protein and crude fat content in egg white and yolk (P > 0.05, Table 3).
Table 3.
Comparison of egg quality between high and low hatchability groups.
| Item | LH | HH | P |
|---|---|---|---|
| Egg weight (g) | 50.76 ± 0.566 | 52.19 ± 0.359 | 0.028 |
| Egg shell strength (N) | 32.04 ± 0.816 | 27.60 ± 1.017 | 0.001 |
| Egg shape index (%) | 1.33 ± 0.007 | 1.32 ± 0.010 | 0.760 |
| Albumen height (mm) | 4.01 ± 0.088 | 4.55 ± 0.177 | 0.030 |
| Eggshell thickness (mm) | 0.35 ± 0.003 | 0.33 ± 0.006 | 0.020 |
| Haugh unit | 68.65 ± 0.811 | 73.00 ± 1.480 | 0.034 |
| Dry matter content of egg white (%) | 11.84 ± 0.336 | 11.51 ± 0.199 | 0.387 |
| Dry matter content of egg yolk (%) | 48.00 ± 0.498 | 47.67 ± 1.356 | 0.821 |
| Crude fat of the egg yolk (%) | 33.71 ± 2.092 | 34.54 ± 1.177 | 0.755 |
| Crude protein content of egg white (%) | 45.54 ± 1.333 | 43.12 ± 0.849 | 0.137 |
| Crude protein content of egg yolk (%) | 21.96 ± 0.601 | 23.28 ± 0.391 | 0.076 |
Reproductive Organ Index and Histological Comparison of Magnum and Uterus in Huainan Partridge Chicken With High and Low Hatchability
In poultry, the magnum is the main part of egg protein secretion, and uterus is the main part of eggshell formation (Zhang et al., 2020). The magnum index was significantly higher in HH group as compared to those of LH group (P < 0.05, Table 4). There were no significant differences in ovarian index and uterus index between the 2 groups (P > 0.05, Table 4). However, the primary villus of magnum showed no significant difference between the 2 groups according to the histological analysis (Figure 1). For the histology of uterus, the intervillous space was significantly lower and the epithelial height was significantly higher in HH group as compared to those of the LH group (P < 0.05, Figure 1). The different intervillous space and epithelial height in HH and LH suggest their different eggshell formation ability. Furthermore, we analyzed the expression of genes related to egg white synthesis in magnum between the 2 groups. The expression of polypeptide N-Acetylgalactosaminyltransferase 9 (GALNT9) in LH group was significantly lower than that in HH group (P < 0.05, Figure 2). There were no significant differences in the expression levels of prolactin Receptor (PRLP), fucosyltransferase 4 (FUT4), integrin Subunit Alpha 2 (ITGA2) and stearoyl-CoA Desaturase (SCD3) between HH and LH (P > 0.05, Figure 2).
Table 4.
Comparison of the index of magnum and uterus between high and low hatchability groups.
| Item | LH | HH | P |
|---|---|---|---|
| Body weight(g) | 1781.11 ± 59.405 | 1788.75 ± 115.487 | 0.954 |
| Ovarian weight (g) | 44.51 ± 1.98 | 49.23 ± 0.71 | 0.049 |
| Magnum weight(g) | 17.19 ± 1.176 | 22.34 ± 0.658 | 0.008 |
| Uterus weight(g) | 16.14 ± 1.127 | 16.82 ± 0.917 | 0.648 |
| Ovary index (%) | 0.025 ± 0.001 | 0.028 ± 0.001 | 0.176 |
| Magnum index (%) | 0.010 ± 0.001 | 0.012 ± 0.001 | 0.047 |
| Uterus index (%) | 0.009 ± 0.001 | 0.009 ± 0.001 | 0.679 |
Figure 1.
Histological morphology of magnum and uterus in Huainan partridge chicken with low (LH) and high (HH) hatchability, (A) The Stained slices of hematoxylin eosin (HE) of magnum and uterus. The short black line is the intervillous spacing, and between the 2 black arrows is the epithelial cell height. (B) The primary villus of HH and LH in uterus. (C) The intervillous space of HH and LH in uterus. (D) The epithelial cell height of HH and LH in uterus. * means P < 0.05.
Figure 2.
Analysis of the mRNA expression of PRLP (A), GALNT9 (B), FUT4 (C), ITGA2 (D), and SCD3 (E) in magnum between the low (LH) and high (HH) hatchability, * means P < 0.05.
Transcriptome Analysis of Uterus in Huainan Partridge Chicken Between Low and High Hatchability
The DEGs in uterus between the 2 groups were analyzed by transcriptome sequencing. The number of raw reads, clean reads, Q20(%), Q30(%), and GC content (%) of each sample was listed in Table S1. The general Q30 percentage of clean data was 93.21%, and the GC content of the sequenced samples ranged from 51.09% to 51.73%. A total of 702 genes were differentially expressed in uterus of chicken with high hatchability as compared to that of low hatchability group, of which 402 genes were upregulated and 300 genes were downregulated (Figure 3A, Table S2). The samples of group HH (H12, H2, H3) and LH (L1, L2, L3) were divided into 2 clusters, indicating that the samples were reasonable (Figure 3B).
Figure 3.
Gene expression analysis of transcriptome of high (HH) and low (LH) hatchability group. (A) the volcano map of gene expression analysis, LH as the control, red means up, green means down. (B) the cluster analysis of differential expression genes. Rows indicate genes showing significant differences in expression between the 2 groups; columns represent individual samples from the 2 groups. L1, L2, L3 are samples from LH, and H1, H2, H3 are samples from HH.
To validate RNA-seq results, 18 DEGs were selected for qRT-PCR analysis, including 9 downregulated genes solute carrier family 35 member B4 (SLC35B4), carnitine palmitoyltransferase 1A (CPT1A), UDP glucuronosyltransferase family 1 member A1 (UGT1A1), pleckstrin homology like domain family A member 1 (PHLDA1), tetraspanin 19 (TSPAN19), family with sequence similarity 149 member A (FAM149A), pleckstrin homology, MyTH4 And FERM domain containing H1 (PLEKHH1), F-Box protein 15 (FBXO15), CUB domain containing protein 1 (CDCP1), 9 up-regulated genes transcription elongation regulator 1 like (TCERG1L), cytochrome P450 family 2 subfamily AB member 1 (CYP2AB1), semaphorin 3C (SEMA3C), NDRG family member 4 (NDRG4), potassium calcium-activated channel subfamily N member 3 (KCNN3), aldehyde dehydrogenase 1 family member A3 (ALDH1A3), methionine sulfoxide reductase B3 (MSRB3), solute carrier family 13 member 5 (SLC13A5). A relatively strong correlation was observed between the mRNA expression levels of qRT-PCR and RNA-Seq, with a pearson correlation coefficient of 0.8368 (Figure 4).
Figure 4.
Correlation of mRNA expression levels of 18 randomly differentially expressed genes between high and low hatchability groups based on RNA-seq and qRT-PCR analysis.The X and Y axes show the log2 (foldchange) of RNA-Seq and qRT-PCR. The equation of linear line and R2 values were shown in the upper right corner of the image.
The GO was used to describe the biological functions involved in regulating eggshell formation by DEGs. The DEGs were significantly enriched only in the molecular function (Figure 5A, Table S3), including the ion transmembrane transporter activity (GO:0015075), ion channel activity (GO:0005216) and calcium ion binding (GO:0005509). The KEGG enrichment analysis (Figure 5B, Table S4) revealed that DEGs were significantly enriched in ECM-receptor interaction (gga04512), Cardiac muscle contraction (gga04260), and Adrenergic signaling in cardiomyocytes (gga04261).
Figure 5.
The GO and KEGG analysis of DEGs between high (HH) and low (LH) hatchability group (A) The top 10 molecular function (MF) terms of GO analysis, sort by p value (B) Dot plot of the top 10 KEGG pathway enrichment analysis, the horizontal axis represents the gene ratio, while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and the size of the dot indicates the number of genes corresponding to each pathway.
In view of the fact that the uterus is the main site of eggshell formation, and highly enrichment GO terms of DGEs were ion transmembrane transportation and calcium ion binding. Therefore, PPI analysis was performed on the DEGs in these 2 GO items. Genes calcium voltage-gated channel auxiliary subunit beta 4 (CACNB4), calcium voltage-gated channel subunit alpha1 D (CACNA1D), SLC26A9 and solute carrier family 4 member 4 (SLC4A4), were the core of ion transmembrane transportation (Figure 6A). Genes CALB1 and cadherin 17 (CDH17) were the core of calcium ion binding (Figure 6B). Considering the important role of proteins CALB1 and SLC26A9 in Ca2+ and HCO3− ion transport, protein amount determined by western blot assay were analyzed in the uterus of high and low hatching chickens. The SLA26A9 was higher in the LH group than in the HH group, while CALB1 was higher in the HH group than in the LH group (Figure 7)
Figure 6.
The protein protein interaction (PPI) network analysis. (A) The PPI of genes enriched in ion transmembrane transporter activity (GO:0015075), (B) The PPI of genes enriched in calcium ion binding (GO:0005509). Solute carrier family 4 member 4 (SLC4A4), potassium voltage-gated channel subfamily A member 4 (KCNA4), potassium voltage-gated channel subfamily A member 5 (KCNA5), calcium voltage-gated channel auxiliary subunit beta 4 (CACNB4), ryanodine receptor 2 (RYR2), potassium voltage-gated channel subfamily Q member 1 (KCNQ1), solute carrier family 30 member 8 (SLC30A8), solute carrier family 26 member 9 (SLC26A9), acid sensing ion channel subunit family member 4 (ASIC4), calcium voltage-gated channel subunit alpha1 D (CACNA1D), potassium calcium-activated channel subfamily N member 3 (KCNN3), gamma-aminobutyric acid type A receptor subunit alpha4 (GABRA4), glutamate ionotropic receptor AMPA type subunit (GRIA3), cholinergic receptor nicotinic beta 3 subunit (CHRNB3), glutamate ionotropic receptor kainate type subunit 4 (GRIK4), cadherin 18 (CDH18), lysophosphatidylcholine acyltransferase 1 (LPCAT1), Cadherin 17 (CDH17), FAT atypical cadherin 2 (FAT2), cadherin related family member 1 (CDHR1), calsyntenin 2 (CLSTN2), calbindin 1 (CALB1), annexin A1 (ANXA1), matrix Gla protein (MGP), fibrillin 1 (FBN1), latent transforming growth factor beta binding protein 2 (LTBP2), plastin 1 (PLS1), myosin light chain 2 (MYL2), Calcineurin B-homologous protein 1 (CHP1).
Figure 7.
Proteins expression analysis of SLA26A9 and CALB1. (A) Western blot of CALB1 and SLC26A9, (B) Relative gray value analysis of SLA26A9 and CALB1. * means P < 0.05.
DISCUSSION
A higher hatchability was observed in HH group suggest that adequate high egg weight, albumen height and low EST could helpful for hatching. Ergun et al. (2017) found that in a certain EST, hatchability was negatively associated with shell thickness in quail. Ling et al. (2022) found that feeding green tea powder in laying hens resulted in a thinner eggshell and higher hatchability, which further suggest reduced EST could helpful for hatchability. The different egg weight had no significant effect on the internal nutrients of egg yolk and egg white in HH and LH group. The research of Bain et al. (2019) show that there were no significant differences in yolk fat and protein content in egg white and yolk in eggs of different weights produced by hens at the same age.
The transcriptome of high thick albumen and low thick albumenin reveals ST3GAL4, FUT4, ITGA2, SDC3, PRLR, CDH4 and GALNT9 are related to the secretion of egg albumen in Rhode Island white chickens (Wan et al., 2017). GALNT9 encodes a family of peptide N-acetylgalactosamitransferases involved in the biosynthesis of O polysaccharides, and mucin-type O glycosylation is one of the most common protein post-translational modifications in animals (Nakayama et al., 2014). Glycoprotein glycosylation has been widely reported in intestinal epithelial cells and renal tubular epithelial cells (Kanado et al., 2019; Carroll et al., 2022). In fallopian tube epithelial cells, proteins can be glycosylated and stored in the egg white of eggs as glycoproteins, which affect the production of concentrated proteins in eggs by regulating glucose metabolism (Wan et al., 2017). The higher GALNT9 expression resulted in higher albumen height and Haugh unit in eggs which further resulted in a higher hatching rate.
A large number of CaCO3 synthetic precursors were transported to uterine fluid through uterine gland epithelial cells to promote eggshell formation (Li et al., 2023). The transcriptome analysis showed that high and low hatchability group differences of uterus in ion transport capacity. Egg is formed in the hen's fallopian tubes for about 24 h, where it takes about 18 h for the eggshell to mineralize in the hen's body. Studies have shown that there is rhythmic expression of clock genes in the uterus part of chicken fallopian tube. The rhythmic expression of downstream eggshell formation related genes, such as eggshell formation-related ions, ion channel proteins, ion-binding proteins, and eggshell-specific matrix proteins, was regulated to ensure the sequential synthesis of eggshells and the continuity of egg production of laying hens (Zhang et al., 2022). The CaCO3 precursors are composed of Ca2+ and HCO3−, neither of which are stored in the uterus (Stapane et al., 2020). During eggshell formation, Ca2+ and HCO3− are transported through the transmembrane of uterine gland cells to synthesize the CaCO3 required for eggshells (Brockmeier and Schultheiss, 2011). Therefore, eggshell mineralization presupposes the provision of large amounts of Ca2+ and HCO32− by crosscellular transport in a limited extracellular environment, which requires the presence of ion channels, ion pumps, and ion exchangers. Serum Ca2+ enters the cell via a chemical gradient, and then intracellular Ca2+ is transported from the basement membrane of the uterine gland to the apical membrane and into the uterine fluid under the action of CALB1. (Jonchère et al., 2012). However, CALB1 expression was increased in HH group, which was inconsistent with its low EST. The expression of CALB1 varies greatly in one egg-laying cycle, and its expression is 9 times higher during eggshell formation than during non-eggshell formation (Jeong et al., 2012). This may lead to the abnormal expression of CALB1.
The CO2 in the blood is the main substance in the formation of bicarbonate, and it is catalyzed to HCO3− after simple diffusion through the plasma membrane into the glandular cells of the uterus (Li et al., 2023). Due to the outflow of ions, additional ion transfer is required to maintain cell homeostasis. There are transporters of Na+ (e.g., subunit coded by Sodium Channel Epithelial 1 Subunit Gamma, SCNN1G), K+ (e.g., Potassium Inwardly Rectifying Channel Subfamily J Member 15, KCNJ15), and Cl− (e.g., Chloride Voltage-Gated Channel 2, CLCN2) ions to maintain physiological ionic concentrations in the plasma membranes of uterine glandular cells (Jonchère et al., 2012; Brionne et al., 2014). Among the DEGs, Potassium Voltage-Gated Channel Subfamily A Member 4 (KCNA4, down), Potassium Voltage-Gated Channel Subfamily A Member 5 (KCNA5, down), Potassium Voltage-Gated Channel Subfamily E Regulatory Subunit 5 (KCNE5, down), KCNN3 (up), Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1, down) belong to Potassium Voltage-Gated Channel Subfamily. Genes KCNA4, KCNA5, and KCNQ1 encode the K(v)1.4, K(v)1.5 and K(v)7.1 channels (Nakajo and Kubo, 2015; Gyeoung-Jin et al., 2023; Hilderink et al., 2020). KCNA5 are found plays a regulatory role in proliferation and apoptosis in oligodendrocytes, hippocampus microglia, macrophages, human mammary epithelial cells, ovarian granulosa cell (Qu et al., 2018; Zhou et al., 2021). The KCNE5 are single transmembrane-segment voltage-gated potassium K(v) channel ancillary subunits, regulates many types of K(v) channels (Abbott, 2016). The KCNN3 encodes a Ca2+-activated (Kca2.3) potassium channel (liu et al., 2018). The down-regulate of Genes KCNA4, KCNA5, KCNE5, and KCNQ1 in HH may lead to the inability of timely return of Na+, K+ and Cl− ions to maintain cell homeostasis after the outflow of Ca2+ and HCO3− ions in uterine glandular cells, thus affecting the outflow of Ca2+ and HCO3−, affecting the formation of eggshell and reducing the EST.
In addition to the formation of HCO3− from CO2 in the blood, a portion of HCO3− is transferred to uterine glandular cells via Na/HCO3− (SLC4A4), playing a secondary role in HCO3− transport (Xu et al., 2003). The HCO3− in the uterine glands is transported to the uterine fluid through the HCO3−/Cl− ion channel encoded by SLC26A9 (Han et al., 2023). The decrease in eggshell strength induced by heat stress is due to the downregulation of ITPR3, SLC4A4, and SLC4A9 genes, which reduced Cl−, HCO3−, and Na+ transport (Bahadoran et al., 2018). Zhang et al., (2020) also found that the expression levels of HCO3− transporters SLC4A1, SLC4A2 and SLC4A9 were significantly upregulated in the high eggshell strength group compared with the low eggshell strength group, and the supply of HCO3− affected the quality of eggshells rather than the supply of Ca2+.The DEGs belonged to the Solute Carrier Family include SLC4A4 (down), Solute Carrier Family 12 Member 2 (SLC12A2, down), SLC26A9 (down), Solute Carrier Family 30 Member 8 (SLC30A8, down), and SLC13A5 (up). The SLC4A4 is Sodium Bicarbonate Cotransporter, which is responsible for the transmembrane transport of Na+/HCO3−, plays important roles in intracellular pH regulation as well as transepithelial HCO₃⁻ movement (liu et al., 2012). SLC12A2 is responsible for the transmembrane transport of (Na+ and K+) /Cl− (Arroyo et al., 2013). SLC26A9 is the exchanger of Cl−/ HCO3− (Geertsma and Oliver, 2023). SLC30A8 is responsible for transporting Zn2+ into organelles and secretory vesicles/granules (Schweigel-Röntgen, 2014). The Proteins encoded by the SLC13A5 genes is the Na+/dicarboxylate (C2) cotransporters (Markovich, 2012). The lower expression of SLC4A4, SLC26A9, and SLC12A2 in the HH may likewise lead to a decrease in the transport capacity of HCO3− resulting in a lower EST.
CONCLUSIONS
The high albumen height and low EST were conducive to the hatching of Huainan partridge chicken, which was attributed to the upregulation of GALNT9 in the expansion part that could promote the synthesis of glycoprotein in egg white. The candidate genes CALB1, KCNJ16, SLC26A9, SLC4A4 were related to eggshell synthesis to affect hatching, and the differentially expressed genes for hatchability were mainly enriched in transmembrane transport, ion transport and ion channel activity.
Acknowledgments
ACKNOWLEDGMENTS
This work was financially supported by Natural Science Foundation of Anhui Province (2308085MC101) and the Key Research and Development Program of Anhui Province (202104f06020037).
DISCLOSURES
The authors declare no conflicts of interest.
Footnotes
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2024.103784.
Appendix. Supplementary materials
Table S1. Transcriptome sequencing quality data
Table S2. Differentially expressed genes in HH and HL groups
Table S3. The GO enrichment analysis of differentially expressed genes
Table S4. The KEGG enrichment analysis of differentially expressed genes
REFERENCES
- Arroyo J.P., Kahle K.T., Gamba G. The SLC12 family of electroneutral cation-coupled chloride cotransporters. Mol. Aspects. Med. 2013;34:288–298. doi: 10.1016/j.mam.2012.05.002. [DOI] [PubMed] [Google Scholar]
- Abbott G.W. KCNE4 and KCNE5: K(+) channel regulation and cardiac arrhythmogenesis. Gene. 2016;593:249–260. doi: 10.1016/j.gene.2016.07.069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brockmeier K., Schultheiss G. Regulation of anion transport across the uterine epithelium of Gallus domesticus. Poult. Sci. 2011;90:618–623. doi: 10.3382/ps.2010-00862. [DOI] [PubMed] [Google Scholar]
- Bourque S.L., Dolinsky V.W., Dyck J.R., Davidge S.T. Maternal resveratrol treatment during pregnancy improves adverse fetal outcomes in a rat model of severe hypoxia. Placenta. 2012;33:449–452. doi: 10.1016/j.placenta.2012.01.012. [DOI] [PubMed] [Google Scholar]
- Brionne A., Nys Y., Hennequet-Antier C., Gautron J. Hen uterine gene expression profiling during eggshell formation reveals putative proteins involved in the supply of minerals or in the shell mineralization process. BMC. Genom. 2014;15:220. doi: 10.1186/1471-2164-15-220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bahadoran S., Dehghani S.A., Hassanpour H. Effect of heat stress on the gene expression of ion transporters/channels in the uterus of laying hens during eggshell formation. Stress. 2018;21:51–58. doi: 10.1080/10253890.2017.1394291. [DOI] [PubMed] [Google Scholar]
- Bain M.M., Zheng J., Zigler M., Whenham N., Quinlan-Pluck F., Jones A.C., Roberts M., Icken W., Olori V.E., Dunn I.C. Cuticle deposition improves the biosecurity of eggs through the laying cycle and can be measured on hatching eggs without compromising embryonic development. Poult. Sci. 2019;98:1775–1784. doi: 10.3382/ps/pey528. [DOI] [PubMed] [Google Scholar]
- Chen X.Y., Niu J.J., Geng Z.Y. Gene expression and plasma lipid content in relation to intramuscular fat in Chinese indigenous Wuhua chicken. J. Appl. Poult. Res. 2017;26:391–400. [Google Scholar]
- Chen X.Y., Li T., He K., Geng Z., Wan X. Dietary green tea powder supplementation enriched egg nutrients and physicochemical property in an indigenous chicken breed. Poult. Sci. 2021;100:388–395. doi: 10.1016/j.psj.2020.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carroll D.J., Burns M.W.N., Mottram L., Propheter D.C., Boucher A., Lessen G.M., Kumar A., Malaker S.A., Xing C., Hooper L.V., Yrlid U., Kohler J. Interleukin-22 regulates B3GNT7 expression to induce fucosylation of glycoproteins in intestinal epithelial cells. J. Biol. Chem. 2022;298 doi: 10.1016/j.jbc.2021.101463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cheng X., Ma Y., Li X., Liu Y., Zhang R., Zhang Y., Fan C., Qu L., Ning Z. Structural characteristics of speckled chicken eggshells and their effect on reproductive performance. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen X., Yu T., Dou Y., Ji Q., Guo L., Geng Z. High dietary energy decreased reproductive performance through increasing lipid deposition in Yangzhou geese at late laying stage. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102915. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dang D.X., Li C.J., Cui Y., Zhou H., Lou Y., Li D. Egg quality, hatchability, gosling quality, and amino acid profile in albumen and newly-hatched goslings serum as affected by egg storage. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ergun O.F., Yamak U.S. The effect of eggshell thickness on hatchability of quail eggs. Vet. World. 2017;10:1114–1117. doi: 10.14202/vetworld.2017.1114-1117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guyot N., Réhault-Godbert S., Slugocki C., Harichaux G., Labas V., Helloin E., Nys Y. Characterization of egg white antibacterial properties during the first half of incubation: a comparative study between embryonated and unfertilized eggs. Poult. Sci. 2016;95:2956–2970. doi: 10.3382/ps/pew271. [DOI] [PubMed] [Google Scholar]
- Gu W., Wen K., Yan C., Li S., Gong D. Maintaining intestinal structural integrity is a potential protective mechanism against inflammation in goose fatty liver. Poult. Sci. 2020;99:5297–5307. doi: 10.1016/j.psj.2020.08.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gyeoung-Jin K., Xie A., Eunji K., Samuel C.D. Dudley, miR-448 regulates potassium voltage-gated channel subfamily A member 4 (KCNA4) in ischemia and heart failure. Heart. Rhythm. 2023;20:730–736. doi: 10.1016/j.hrthm.2023.01.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Geertsma E.R., Oliver D. SLC26 anion transporters. Handb. Exp. Pharmacol. 2023;283:319–360. doi: 10.1007/164_2023_698. [DOI] [PubMed] [Google Scholar]
- Hilderink S., Devalla H.D., Bosch L., Wilders R., Verkerk A.O. Ultrarapid delayed Rectifier K+ channelopathies in human induced pluripotent stem cell-derived cardiomyocytes. Front. Cell. Dev. Biol. 2020;28:536. doi: 10.3389/fcell.2020.00536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Haron A., Ruzal M., Shinder D., Druyan S. Hypoxia during incubation and its effects on broiler's embryonic development. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2020.12.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Haron A., Shinder D., Lokshtanov D., Ruzal M., Druyan S. Effects of hypoxic conditions during the plateau period on pre- and posthatch broiler performance. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han G.P., Kim J.H., Kim J.M., Kil D.Y. Transcriptomic analysis of the liver in aged laying hens with different eggshell strength. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jonchère V., Brionne A., Gautron J., Nys Y. Identification of uterine ion transporters for mineralisation precursors of the avian eggshell. BMC Physiol. 2012;12:10. doi: 10.1186/1472-6793-12-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jeong W., Lim W., Kim J., Ahn S.E., Lee H.C., Jeong J.W., Han J.Y., Song G., Bazer F.W. Cell-specific and temporal aspects of gene expression in the chicken oviduct at different stages of the laying cycle. Biol Reprod. 2012;86:172. doi: 10.1095/biolreprod.111.098186. [DOI] [PubMed] [Google Scholar]
- Kanado Y., Tsurudome Y., Omata Y., Yasukochi S., Kusunose N., Akamine T., Matsunaga N., Koyanagi S., Ohdo S. Estradiol regulation of P-glycoprotein expression in mouse kidney and human tubular epithelial cells, implication for renal clearance of drugs. Biochem. Biophys. Res. Commun. 2019;519:613–619. doi: 10.1016/j.bbrc.2019.09.021. [DOI] [PubMed] [Google Scholar]
- Liu Y., Lu Q.W., Chen L.M. Physiology and pathophysiology of Na⁺/HCO₃⁻ cotransporter NBCe1. Sheng Li Xue Bao. 2012;64:729–740. [PubMed] [Google Scholar]
- Liu X., Wei L., Zhao B., Cai X., Dong C., Yin F. Low expression of KCNN3 may affect drug resistance in ovarian cancer. Mol. Med. Rep. 2018;18:1377–1386. doi: 10.3892/mmr.2018.9107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ling C., Chen X., Lin W., Geng Z. Green tea powder inclusion promoted hatchability through increased yolk antioxidant activity. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li L.L., Xu P.T., Liu Z.P., Liu C.A., Dong X.Y., Zhang Z.F., Guo S.S., Ding B. Effects of salpingitis simulation on the morphology and expression of inflammatory-related genes of oviduct in laying hens. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mbajiorgu C.A. Effect of hatching egg size on hatchability and chick hatch-weight of indigenous Venda chickens. Indian J. Anim. Res. 2011;45:300–304. [Google Scholar]
- Markovich D. Sodium-sulfate/carboxylate cotransporters (SLC13) Curr. Top. Membr. 2012;70:239–256. doi: 10.1016/B978-0-12-394316-3.00007-7. [DOI] [PubMed] [Google Scholar]
- Nakayama Y., Nakamura N., Kawai T., Kaneda E., Takahashi Y., Miyake A., Itoh N., Kurosaka A. Identification and expression analysis of zebrafish polypeptide α-N-acetylgalactosaminyltransferase Y-subfamily genes during embryonic development. Gene. Expr. Patterns. 2014;16:1–7. doi: 10.1016/j.gep.2014.07.001. [DOI] [PubMed] [Google Scholar]
- Nakajo K., Kubo Y. KCNQ1 channel modulation by KCNE proteins via the voltage-sensing domain. J. Physiol. 2015;593:2617–2625. doi: 10.1113/jphysiol.2014.287672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qu C., Sun J., Liu Y., Wang X., Wang L., Han C., Chen Q., Guan T., Li H., Zhang Y., Wang Y., Liu J., Zou W., Liu J. Caveolin-1 facilitated KCNA5 expression, promoting breast cancer viability. Oncol. Lett. 2018;16:4829–4838. doi: 10.3892/ol.2018.9261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sahan U., Ipek A., Sozcu A. Yolk sac fatty acid composition, yolk absorption, embryo development, and chick quality during incubation in eggs from young and old broiler breeders. Poult. Sci. 2014;93:2069–2077. doi: 10.3382/ps.2013-03850. [DOI] [PubMed] [Google Scholar]
- Schweigel-Röntgen M. The families of zinc (SLC30 and SLC39) and copper (SLC31) transporters. Curr. Top. Membr. 2014;73:321–355. doi: 10.1016/B978-0-12-800223-0.00009-8. [DOI] [PubMed] [Google Scholar]
- Szeleszczuk Ł., Kuras M., Pisklak D.M., Wawer I. Analysis of the changes in elemental composition of the chicken eggshell during the incubation period. J. Anim. Plant Sci. 2016;26:583–587. [Google Scholar]
- Sirri F., Zampiga M., Berardinelli A., Meluzzi A. Variability and interaction of some egg physical and eggshell quality attributes during the entire laying hen cycle. Poult. Sci. 2018;97:1818–1823. doi: 10.3382/ps/pex456. [DOI] [PubMed] [Google Scholar]
- Stapane L., Le R.N., Ezagal J., Rodriguez-Navarro A.B., Labas V., Combes-Soia L., Hincke M.T., Gautron J. Avian eggshell formation reveals a new paradigm for vertebrate mineralization via vesicular amorphous calcium carbonate. J. Biol. Chem. 2020;295:15853–15869. doi: 10.1074/jbc.RA120.014542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tona K., Onagbesan O., Ketelaere B.D., Decuypere E., Bruggeman V. Effects of age of broiler breeders and egg storage on egg quality, hatchability, chick quality, chick weight, and chick posthatch growth to forty-two days. J. Appl. Poult. Res. 2004;13:10–18. [Google Scholar]
- Wan Y., Jin S., Ma C., Wang Z., Fang Q., Jiang R. RNA-Seq reveals seven promising candidate genes affecting the proportion of thick egg albumen in layer-type chickens. Sci. Rep. 2017;7:18083. doi: 10.1038/s41598-017-18389-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu H., Li H., Hou Y., Huang L., Hu J., Lu Y., Liu X. Differences in egg yolk precursor formation of Guangxi Ma chickens with dissimilar laying rate at the same or various ages. Theriogenology. 2022;184:13–25. doi: 10.1016/j.theriogenology.2022.02.020. [DOI] [PubMed] [Google Scholar]
- Wei C., Chen X., Peng J., Yu S., Chang P., Jin K., Geng Z. BMP4/SMAD8 signaling pathway regulated granular cell proliferation to promote follicle development in Wanxi white goose. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu J., Barone S., Petrovic S., Wang Z., Seidler U., Riederer B., Ramaswamy K., Dudeja P.K., Shull G.E., Soleimani M. Identification of an apical Cl−/HCO3− exchanger in gastric surface mucous and duodenal villus cells. Am. J. Physiol. Gastrointest. Liver. Physiol. 2003;285:1225–1234. doi: 10.1152/ajpgi.00236.2003. [DOI] [PubMed] [Google Scholar]
- Xing R., Yang H., Wang X., Yu H., Li P. effects of calcium source and calcium level on growth performance, immune organ indexes, serum components, intestinal microbiota, and intestinal morphology of broiler chickens. J. Appl. Poult. Res. 2019;29:106–120. [Google Scholar]
- Zhang F., Yin Z.T., Zhang J.F., Zhu F., Hincke M., Yang N., Hou Z.C. Integrating transcriptome, proteome and QTL data to discover functionally important genes for duck eggshell and albumen formation. Genomics. 2020;112:3687–3695. doi: 10.1016/j.ygeno.2020.04.015. [DOI] [PubMed] [Google Scholar]
- Zhou S., Xia L., Chen Y., Guo W., Hu J. miR-3188 Regulates proliferation and apoptosis of granulosa cells by targeting KCNA5 in the polycystic ovary syndrome. Acta. Biochim. Pol. 2021;68:83–89. doi: 10.18388/abp.2020_5441. 3. [DOI] [PubMed] [Google Scholar]
- Zhang Z., Du X., Lai S., Shu G., Zhu Q., Tian Y., Li D., Wang Y., Yang J., Zhang Y., Zhao X. A transcriptome analysis for 24-hour continuous sampled uterus reveals circadian regulation of the key pathways involved in eggshell formation of chicken. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101531. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. Transcriptome sequencing quality data
Table S2. Differentially expressed genes in HH and HL groups
Table S3. The GO enrichment analysis of differentially expressed genes
Table S4. The KEGG enrichment analysis of differentially expressed genes







