Skip to main content
BMC Plant Biology logoLink to BMC Plant Biology
. 2024 May 14;24:395. doi: 10.1186/s12870-024-05100-w

Development of PCR-based markers for identification of wheat HMW glutenin Glu-1Bx and Glu-1By alleles

Myoung Hui Lee 1, Kyeong-Min Kim 1, Chon-Sik Kang 1, Mira Yoon 1, Ki-Chang Jang 1, Changhyun Choi 1,
PMCID: PMC11092038  PMID: 38745139

Abstract

Background

In common wheat (Triticum aestivum L.), allelic variations in the high-molecular-weight glutenin subunits Glu-B1 locus have important effects on grain end-use quality. The Glu-B1 locus consists of two tightly linked genes encoding x- and y-type subunits that exhibit highly variable frequencies. However, studies on the discriminating markers of the alleles that have been reported are limited. Here, we developed 11 agarose gel-based PCR markers for detecting Glu-1Bx and Glu-1By alleles.

Results

By integrating the newly developed markers with previously published PCR markers, nine Glu-1Bx locus alleles (Glu-1Bx6, Glu-1Bx7, Glu-1Bx7*, Glu-1Bx7 OE, Glu-1Bx13, Glu-1Bx14 (−) , Glu-1Bx14 (+)/Bx20, and Glu-1Bx17) and seven Glu-1By locus alleles (Glu-1By8, Glu-1By8*, Glu-1By9, Glu-1By15/By20, Glu-1By16, and Glu-1By18) were distinguished in 25 wheat cultivars. Glu-1Bx6, Glu-1Bx13, Glu-1Bx14 (+)/Bx20, Glu-1By16, and Glu-1By18 were distinguished using the newly developed PCR markers. Additionally, the Glu-1Bx13 and Glu-1Bx14 (+)/Bx20 were distinguished by insertions and deletions in their promoter regions. The Glu-1Bx6, Glu-1Bx7, Glu-1By9, Glu-1Bx14 (−), and Glu-1By15/By20 alleles were distinguished by using insertions and deletions in the gene-coding region. Glu-1By13, Glu-1By16, and Glu-1By18 were dominantly identified in the gene-coding region. We also developed a marker to distinguish between the two Glu-1Bx14 alleles. However, the Glu-1Bx14 (+) + Glu-1By15 and Glu-1Bx20 + Glu-1By20 allele combinations could not be distinguished using PCR markers. The high-molecular-weight glutenin subunits of wheat varieties were analyzed by ultra-performance liquid chromatography and sodium dodecyl sulfate–polyacrylamide gel electrophoresis, and the findings were compared with the results of PCR analysis.

Conclusions

Seven Glu-1Bx and four Glu-1By allele detection markers were developed to detect nine Glu-1Bx and seven Glu-1By locus alleles, respectively. Integrating previously reported markers and 11 newly developed PCR markers improves allelic identification of the Glu-B1 locus and facilitates more effective analysis of Glu-B1 alleles molecular variations, which may improve the end-use quality of wheat.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-024-05100-w.

Keywords: Hexaploid wheat, High-molecular-weight glutenin subunit, Glu-1Bx, Glu-1By, PCR-based marker

Background

Wheat quality is mainly based on wheat gluten protein, which has a wide range of effects on dough properties, and protein content and composition are key quality-determining parameters [1]. Gluten is a typical water-insoluble protein polymer composed of disulfide bonds and noncovalent hydrogen bonds between polymeric glutenin and monomeric gliadins [2]. Glutenin influences the strength and elasticity of wheat dough [3], whereas gliadins are responsible for its extensibility and viscosity [4]. Glutenin proteins include two major subunits, high-molecular-weight glutenin subunits (HMW-GSs) and low-molecular-weight glutenin subunits (LMW-GSs), which are the major proteins affecting the end-use quality of wheat [3, 5]. The genes encoding the HMW-GS, namely, Glu-A1, Glu-B1, and Glu-D1, are located on the long arms of chromosomes 1A, 1B, and 1D, respectively [4, 6]. Each Glu-1 locus consists of two tightly linked genes, designated as the x-type and y-type subunits that are highly conserved, contain repeated domains, and exhibit multiple alleles [79]. HMW-GSs account for only about 5%–10% of grain protein, but allelic variations in HMW-GSs have been reported to account for up to 50–70% of the variation in bread-making quality [1015]. Three, 11, and six alleles at the Glu-A1, Glu-B1, and Glu-D1 loci, respectively, were systematically identified in 1983 by isolating HMW-GSs using sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) [16]. Extensive polymorphisms were detected at all three Glu-1 loci. The degree of polymorphism has continued to increase with analyses of different landraces, wild species, and wheat relatives [5, 17]. The Grain Genes 2.0 database identified 22 alleles for Glu-A1, 52 for Glu-B1, and 36 for Glu-D1 [18].

Various mass spectrometry techniques and SDS-PAGE analyses have been developed and used to identify HMW-GSs [1922]. Some HMW-GSs with similar mobilities are indistinguishable on SDS-PAGE [23, 24], but alleles such as Glu-1Bx7 and Glu-1Bx7*, Glu-1By8 and Glu-1By8*, and Glu-1Dx2 and Glu-1Ax2* show differences in surface hydrophobicity on ultra-performance liquid chromatography (UPLC) [25]. However, despite small differences in electrophoretic mobility between the Glu-1Bx7 and Glu-1Bx7* subunits, these subunits cannot be differentiated on the basis of the elution time in reversed-phase high-performance liquid chromatography (RP-HPLC) [26].

Molecular markers such as allele-specific polymerase chain reaction (AS-PCR) based on single-nucleotide polymorphisms (SNPs) and insertions and deletions (indels) have been used for fast and reliable screening of HMW-GSs in wheat breeding. Several AS-PCR markers have been developed for different HMW-GS genes, including Glu-A1, Glu-B1, and Glu-D1 [23, 2739]. Several indels and duplications have also been reported in the promoter regions of Glu-B1 alleles. The 43 bp indel, 185 bp indel, and 54 bp duplication of the promoter can distinguish Glu-1Bx6, Glu-1Bx7, Glu-1Bx13, Glu-1Bx14, and Glu-1Bx20 from other Glu-1Bx genes. Glu-1Bx7 OE and some types of Glu-1Bx6 and Glu-1Bx14 with a 43 bp insertion in the promoter region [40] can be selected using a marker reported by Ragupathy et al. [33]. The difference between Glu-1Bx7 and Glu-1Bx7 OE is a 43 bp insertion in the promoter region and gene duplication [23, 33]. Glu-1Bx7* shows an 18 bp deletion in the coding region of the gene. Agarose gel-based DNA markers have been used to accurately discriminate the Glu-B1 locus subunits Glu-1Bx7 and Glu-1Bx7*, Glu-1Bx7 and Glu-1Bx17, Glu-1By9 and Glu-1By8, Glu-1Bx6 and non-Glu-1Bx6, and Glu1Bx23 and Glu-1Bx23* by size polymorphisms of 18, 108, 45, 15, and 18 bp, respectively [24, 31, 32, 35, 37, 38]. In addition, AS-PCR markers have been used to discriminate between Glu-1By8 and Glu-1By18 using SNPs [24], and two Glu-1By18-specific SNP-based markers were developed by Liang et al. [34].

Identification of HMW glutenin in wheat remains a high priority in wheat-breeding programs to determine which genotypes should be used in breeding programs because of the large variations in allelic composition among varieties. Although new genotypes continue to be reported, PCR markers cannot distinguish among all genotypes. In addition, the discriminant information of previously reported markers was limited to only a few alleles. SDS-PAGE and HPLC/UPLC analyses are not only time-consuming, but in some cases size-indistinguishable, necessitating the development of PCR markers that can distinguish the genotype of a breed. In this study, we developed PCR markers to distinguish nine Glu-1Bx alleles and seven Glu-1By alleles located at the Glu-B1 locus by using several specific SNPs and indels in 25 wheat varieties. These markers could be useful for marker-assisted selection of Glu-B1 alleles in wheat quality improvement programs.

Methods

Plant materials

A total of 25 wheats were provided by the Korean Agricultural Culture Collection (KACC) (htpp://genebank. rda. go. kr). Formal identification of wheat varieties used in this study were performed by KACC. Three IT numbers (registration numbers for plants at the NARO Institute of Agrobiological Sciences National) were assigned to the Avalone cultivar. Information of HMW-GS allele compositions and IT numbers is listed in Table 1. The respective countries of origin and published and corrected Glu-B1 alleles are also indicated (Table 1).

Table 1.

List of wheat varieties used in this study. The respective countries of origin and published and corrected Glu-B1 alleles are indicated

No cultivar Origin IT noa Glu-B1
(reported)
Glu-B1
(corrected)
InDel
(Promoter)
1 Avalon UK IT176822 6 + 8 6 + 8*
2 Avalon UK IT115944 6 + 8 6 + 8*
3 Avalon UK IT014649 6 + 8 6 + 8*
4 Keumkang Korea IT213100 7 + 8 7 + 8
5 Hanback Korea IT311644 7 + 8 7 + 8
6 Alchan Korea IT175574 7 + 8 7 + 8
7 Gobun Korea IT214681 7 + 9 7* + 9
8 Eunpa Korea IT175521 7 + 9 7* + 9
9 Anbaek Korea IT213245 7 + 9 7* + 9
10 Cheyenne USA IT011154 7* + 9 7* + 9
11 Klein Cacique Argentina IT234987 7* + 8 7* + 8
12 Chisolm USA IT230956 7OE + 8* 7OE + 8*  + 43 bp
13 MT8191 USA IT230937 7OE + 8* 7OE + 8*  + 43 bp
14 KS85WGRC01 USA IT230965 7OE + 8* 7OE + 8*  + 43 bp
15 Anbaek Korea IT246750 13 + 16 13 + 16 -54 bp
16 Baekjoong Korea IT227093 13 + 16 13 + 16 -54 bp
17 Joeun Korea IT213101 13 + 16 13 + 16 -54 bp
18 Troll Germany IT206475 14 + 15 14(−) + 15
19 Hanno Germany IT206477 14 + 15 14(−) + 15
20 Imbros Germany IT206478 14 + 15 14(−) + 15
21 Joongmo2008 Korea IT269492 17 + 18 17 + 18
22 Suwon92 Korea IT246989 17 + 18 17 + 18
23 Suwon105 Korea IT246973 17 + 18 17 + 18
24 Suwon15 Korea IT246979 20 + 20 20 + 20  + 185 bp
25 Suwon28 Korea IT246969 20 + 20 20 + 20  + 185 bp
26 Suwon42 Korea IT246970 20 + 20 20 + 20  + 185 bp
27 RANEE UNK IT176783 14(+) + 15 14(+) + 15  + 185 bp

aIT no: registration number for plants at the NARO Institute of Agrobiological Sciences National

Genomic DNA extraction

A total of 27 hexaploid wheat (Triticum aestivum L.) plants were grown in a Petri dish with moisture paper. Genomic DNA was extracted from the leaf tissue using the Higene™ Genomic DNA Prep kit (solution type; BioFACT, Korea). The quality of the genomic DNA was assessed using a NanoDrop 1000 spectrophotometer (Thermo Scientific, MA, USA), and the integrity of the DNA was checked using 1% agarose gel electrophoresis.

Sequence alignment and phylogenetic tree analysis

Sequences of Glu-1Bx6 (KX454509.1), Glu-1Bx7 (BK006773.1), Glu-1Bx7* (X13927.3), Glu-1Bx13 (EF540764.1), Glu-1Bx14 (AY367771.1 and KF733216.1), Glu-1Bx17* (KF547469.1), Glu-1Bx17 (KC254854.1), Glu-1Bx20 (AJ437000.2), Glu-1Bx23 (AY553933.1), and Glu-1Bx23* (KF995273.1) from Glu-1Bx and sequences of Glu-1By8 (JN255519.1), Glu-1By9 (X61026.1), Glu- 1By15 (EU137874.1), Glu-1By15* (KJ579440.1), Glu-1By16 (EF540765.1), Glu-1By18 (KF430649.1), and Glu-1By20 (KU886033.1) from Glu-1By were collected from National Center for Biotechnology information (NCBI). The gene sequence of Glu-1By8* was not available in the public databases. In this study, Glu-1Bx14 alleles with accession numbers KF733216.1 and AY367771.1 were named Glu-1Bx14 (−) and Glu-1Bx14 (+), respectively. Multiple sequence alignments of the full-length nucleotide sequences of the Glu-1Bx and Glu-1By alleles were performed using Clustal Omega (www.ebi.ac.uk/Tools/msa/Clustalo). Phylogenetic tree was generated using Molecular Evolutionary Genetics Analysis version 11 (MEGA11) [41]. Bootstrap values were calculated on the basis of 1,000 replications.

PCR conditions

PCR was performed under the following conditions: 5 min at 95 °C, 30 cycles of 30 s at 94 °C, 30 s at 55–68 °C, and 30 s at 72℃ on a thermal cycler (Applied Biosystem, MA, USA) with 20 μL reaction volumes for each sample containing 50 ng of template DNA, 10 pmol of each primer with 1 × master mix solution (i-MAX II DNA polymerase, Intronbio, Korea) or 0.1 μL (5 units/μL) of Takara Ex Taq DNA polymerase, 1.6 μL of dNTP mixture (2.5 mM each), and 1 × Ex Taq Buffer (Mg2+ free) (Takara, Japan). PCR products were electrophoresed on 1%–3% agarose gels, and visualized using a Davinch-K Gel imaging system (Davinch-K, Korea). The primers and PCR conditions are listed in Table 2.

Table 2.

Primers used in this study for detection of Glu-1Bx alleles

PS Gene Detection region Marker name Type of Primer Sequence (5’-3’) AT Agarose gel (%) Reference
i-MAX II Ex Taq
PS1 Glu-1Bx7/17 CDS MHBx717-F SNP CACTGAGATGGCTAAGCGCC 66℃ 66℃ 1% this study
MHBx717-R GATCTTGTTGCCCTTGTCC
PS2 Glu-1Bx7 OE Promoter MAR-F Indel (+ 43 bp) CCTCAGCATGCAAACATGCAGC 66℃ 68℃ 1% [23]
MAR-R CTGAAACCTTTGGCCAGTCATGTC
PS3 Glu-1Bx7 OE Junction TaBAC1215C06-F517 Duplication ACGTGTCCAAGCTTTGGTTC 60℃ 68℃ 1% [33]
TaBAC1215C06-R964 GATTGGTGGGTGGATACAGG
PS4 Glu-1Bx7 OE Junction TaBAC1215C06-F24671 Duplication CCACTTCCAAGGTGGGACTA 60℃ 68℃ 1% [33]
TaBAC1215C06-R2551 TGCCAACACAAAAGAAGCTG
PS5 Glu-1Bx20 Promoter MHBx-185-F Indel (+ 185 bp) GATAAGGCCAACGAGAGAAGAA 60/66℃ 59℃ 1% this study
MHBx-185-R GATCTTAGTAAATCCGCGTCAAATAG
PS6 Glu-1Bx20 CDS cauBx752-F Indel (+ 185 bp) AGGGGCAGGGAAGAAACACT 66℃ 66℃ 1% [31]
cauBx752-R CCAGGCAACACAAATCCATG
PS7 Glu-1Bx7* CDS Bx7F Indel (-18 bp) CAACTTCTTCACAGCAGT 60℃ 66℃ 3% [35] (modified)
Bx7R TGCGCCTTTGCCACCTTTAG
PS8 Glu-1Bx17 CDS cauBx642-F Indel (-108 bp) GGGCAATCGGGGTACTTCC 60℃ 59℃ 1% [31]
cauBx642-R CCCTTGTCTTGGCTGTTGTC
PS9 Glu-1Bx6 CDS BX7-F InDel (+ 15 bp) CACTGAGATGGCTAAGCGCC 60℃ 66℃ 3% [32]
BX7-R GCCTTGGACGGCACCACAGG
PS10 Glu-1Bx6 CDS MHBx6-F SNP CACTGAGATGGCTAAGCGCC 67℃ 68℃ 1% this study
MHBx6-R GATCTTGTTGCCCTTGTTC
PS11 Glu-1Bx13 Promoter MHpro13-F Indel (-54 bp) GGGCTTTAGGAGAGATGGTTTAT 60℃ 59℃ 1% this study
MHpro13-R GCCTATGAAGAAAGCGTGAGA
PS12 Glu-1Bx13 CDS MHBx13-F SNP GGCACGAGGCAATACGAGCG 66℃ 66℃ 1% this study
MHBx13-R TGATCTTGTTGCTCTTGTCT
PS13 Glu-1Bx20 CDS MHBx20-F SNP GTGTACTACCCAACTTCTCT 66℃ 68℃ 1% this study
MHBx20-R CCTGGCTGTTGCTCATGTCT
PS14 Glu-1Bx14 (−) CDS MHBx14(-)-F Indel (-18 bp) TACTACCCAACCTCTCCACA 64℃ 66℃ 3% this study
MHBx14(-)-R CTGTTGCTCTTGTGCTGATTG

PS Primer set, CDS Coding sequence, AT Annealing temperature, new Newly developed marker

Glutenin protein analysis using SDS-PAGE

Glutenin was extracted from single wheat grains using a previously reported HMW-GS extraction protocol [42, 43]. Protein (approximately 10 μg) extracted from grains of different varieties was separated using 10% SDS-PAGE and visualized using Coomassie Brilliant Blue R + 250 staining solution (Bio-Rad, CA, USA).

Glutenin analysis using ultra-performance liquid chromatography

Glutenin analysis was performed by crushing single grains of wheat, and the glutenin extraction method was performed as described previously [42, 43]. The extracted glutenin was analyzed using a UPLC system (Alliance e2695, Waters Corp., MA, USA) with an ACQUITY UPLC Peptide BEH C18 column (300A, 1.7 μm, 2.1 mm × 50 mm) and a photodiode array detector. The mobile phases were H2O containing 0.1% trifluoroacetic acid (A) and acetonitrile containing 0.1% trifluoroacetic acid (B). The injection volume of the dissolved samples was 3 μL and the flow rate was 0.55 μL/min. The solvent gradient was changed from 21 to 47% (B) from 0 to 30 min, and the column and sample temperatures were set to 55 °C and 10 °C, respectively.

Results

Sequence alignment and phylogenetic analysis of Glu-1Bx subunits

The nucleotide sequences of 11 Glu-1Bx subunits (Glu-1Bx6, Glu-1Bx7*, Glu-1Bx7, Glu-1Bx13, Glu-1Bx14*, two Glu-1Bx14, Glu-1Bx17, Glu-1Bx20, Glu-1Bx23*, and Glu-1Bx23) were aligned using Clustal Omega (Fig. S1). Among these, the base sequences of Glu-1Bx14 (AY367771.1) and Glu-1Bx20 showed a high degree of identity (99%). The base sequences of Glu-1Bx14* and Glu-1Bx23* also showed high identity (99%). In contrast, the base sequences of the two accessions of Glu-1Bx14 showed a relatively low identity of 96% (Fig. S1). The complete coding sequences of the 11 HMW-GS genes were used to construct a neighbor-joining tree to investigate the phylogenetic relationships among the HMW-GS Glu-1Bx genes (Fig. 1). The genes encoding Glu-1Bx14 (+) and Glu-1Bx20, Glu-1Bx14* and Glu-1Bx23*, and Glu-1Bx7* and Glu-1Bx17 were closely related (Fig. 1), indicating similar structural features and close phylogenetic evolutionary relationships.

Fig. 1.

Fig. 1

Phylogenetic tree of 11 HMW-GS Glu-1Bx alleles constructed using complete coding DNA sequences. HMW-GS Glu-1Bx alleles included Glu-1Bx6 (KX454509.1), Glu-1Bx7 (BK006773.1), Glu-1Bx7* (X13927.3), Glu-1Bx13 (EF540764.1), Glu-1Bx14 (−) (KF7333216.1), Glu-1Bx14.(+) (AY367771.1), Glu-1Bx14* (KJ579439.1), Glu-1Bx17 (KC254854.1), Glu-1Bx20 (AJ437000.2), Glu-1Bx23 (AY553933.1), and Glu-1Bx23* (KF995273.1)

Detection of Glu-1Bx subunits

Eight Glu-1Bx subunits were primarily investigated using PCR-based markers in the 24 cultivars (Table 1). Previously reported molecular markers identifying the Glu-1Bx7 allele were > 2,000 bp (2,373/2,500 bp) in size [36, 44]. Therefore, in this study, we designed a PCR primer set (PS1) to detect Glu-1Bx7 homologs (Glu-1Bx7, Glu-1Bx7*, and Glu-1Bx7 OE). However, Glu-1Bx17 (Joongmo2008, Suwon105, and Suwon92) and Glu-1Bx14 (−) (Troll, Hanno, and Imbros) were also detected in PS1 (Fig. 2a). Next, to examine Glu-1Bx7 OE, we detected a 43 bp insertion in the promoter region by using the marker reported by Butow et al. [23] (PS2, Fig. 2b). In a previous report, a 43 bp insertion in the promoter was observed in some types of Glu-1Bx6 and Glu-1Bx14. Additionally, some types of Glu-1Bx14 and Glu-1Bx20 contain a 185 bp insertion in the promoter region [40, 45]. Therefore, the PCR products were expected to be of four sizes: 520 bp (non-43 bp insertion), 563 bp (43 bp insertion), 705 bp (185 bp insertion), and 748 bp (43 bp and 185 bp insertions). However, a 43 bp insertion was detected in the promoter region of Glu-1Bx7 OE (Chisolm, MT8191, and KS85WGRC01), but not in Glu-1Bx6 (Avalon) or Glu-1Bx14 (−) (Troll, Hanno, and Imbros). In addition, in Glu-1Bx20 (Suwon15, Suwon28, and Suwon42), only 185 bp was detected without the 43 bp insertion (Fig. 2b). Next, two Glu-1Bx7 gene duplication markers (left- and right-junction markers) were tested to confirm the cultivars with the 43 bp insertion contained Glu-1Bx7 OE [33]. Gene duplication was detected in three cultivars (Chisolm, MT8191, and KS85WGRC01), suggesting that they contained Glu-1Bx7 OE (Fig. 2c, d). Therefore, we developed a PCR-based marker that detects a 185 bp insertion without a 43 bp insertion in the promoter (Fig. 2e, Fig. S2). Similar to the marker reported by Xu et al. [31] (PS6, Fig. 2f), this marker showed good detection ability for the 185 bp insertion in Glu-1Bx20 (Suwon15, Suwon28, and Suwon42).

Fig. 2.

Fig. 2

PCR analysis of Glu-1Bx alleles in wheat varieties. The numbers above the figure are the same as the variety numbers in Table 1. The primer set numbers in the figure are the same as in Table 2. DM, DNA size marker; PS, primer set. Arrows indicate indels

One of the Glu-1Bx7 variants, Glu-1Bx7*, is characterized by an 18 bp deletion in the repeat domain corresponding to an additional hexapeptide motif [46], and a Glu-1Bx7* detection marker using this 18 bp deletion has been reported by Espi et al. [35]. The reverse primer for Glu-1Bx7* reported by Espi et al. [35] was modified in this study. However, Glu-1Bx17 also lacks an 18 bp repeat domain corresponding to an extra hexapeptide motif and was detected by PS7 (Fig. 2g). In addition to the 18 bp deletion, Glu-1Bx17 is characterized by a 108 bp deletion in the coding sequence; therefore, a marker capable of distinguishing Glu-1Bx17 with a 108 bp deletion from other Glu-1Bx genes has been reported [28, 31] (PS8, Fig. 2h). With this marker, Glu-1Bx6 was detected to be 45 bp larger than other Glu-1Bx genes except for Glu-1Bx17. Additionally, we found that Gobun, Eunpa, and Anbaek contained Glu-1Bx7* instead of Glu-1Bx7 [47, 48] (Fig. 2g).

Detection of the Glu-1Bx6 subunit

Glu-1Bx6 was detected as a larger PCR fragment than the other Glu-1Bx alleles in PS8. Additionally, Glu-1Bx6 was distinguished from other Glu-1Bx, except for Glu-1Bx20, by a 15 bp insertion in the coding regions [32] (PS9, Fig. 2i). However, Glu-1Bx20 also contained a 15 bp insertion in the coding region (Fig. 2i). Therefore, a dominant marker for Glu-1Bx6 was developed to detect a size of 457 bp using SNP (PS10). As shown in Fig. 2j, the PCR products from three Avalon cultivars were detected using this marker.

Detection of Glu-1Bx13 alleles

The tandem 54 bp duplication at position –400 of the promoter region contains a “cereal box”, which has been implicated in seed-specific expression [49]. However, the promoter region of Glu-1Bx13 does not contain a 54 bp replication [40]. To discriminate of Glu-1Bx13 from other Glu-1Bx alleles in the promoter, we developed a co-dominant primer set to detect Glu-1Bx13 and non-Glu-1Bx13 with sizes of 365 and 419 bp, respectively (PS11, Fig. 2k). Three cultivars (Jeokjoong, Baekjoong, and Joeun) showed a 54 bp deletion in comparison with the other cultivars. In addition, we developed a PCR primer set to detect the Glu-1Bx13 coding region. This primer set dominantly detected Glu-1Bx13 with a size of 254 bp (PS12, Fig. 2l).

Detection of the Glu-1Bx20 subunit

Glu-1Bx20 contains a 185 bp insertion in the promoter region and was detected by PS2, PS5, and PS6. However, some types of Glu-1Bx14 have been reported to contain 185 bp insertion in the promoter region [40, 45]. Therefore, we developed a set of primers (PS13) for the detection of the Glu-1Bx20 coding region with a size of 501 bp using an SNP (Fig. 2m). This primer set specifically detected Glu-1Bx20 in three cultivars (Suwon15, Suwon28, and Suwon42).

Detection of Glu-1Bx14 subunits

Two German bread wheat cultivars, Hanno and Imbros, carry Glu-1Bx14 (−) along with the Glu-1By15 subunits [21]. The Glu-1Bx14 (+) sequence was highly similar with to that of Glu-1Bx20 [31, 39]. However, the three variants (Troll, Hanno, and Imbros) not only did not contain insertions of 43 bp and 185 bp in the promoter region but were also specifically detected by PS1 in the detection of Glu-1Bx7 homologs (Fig. 2). Since two accession numbers were registered in NCBI, we compared the sequences corresponding to the accession numbers AY367771 and KF733216 (Fig. S3). These two accession numbers showed 94% similarity in the nucleotide sequence, and the KF733216 sequence showed an 18 bp deletion in the coding sequence in comparison with other Glu-1Bx alleles. Next, we developed a PCR marker for detection of Glu-1Bx14 (−) using the 18 bp indel (PS14, Fig. 2n). This marker differentiated Glu-1Bx14 (−) from Glu-1Bx7 homologs and Glu-1Bx17. Three cultivars (Troll, Hanno, and Imbros) showed a 18 bp deletion. We also tested RANEE (Glu-1Bx14 + Glu-1By15), a cultivar containing Glu-1Bx14. A 185 bp insertion was detected in the promoter region of RANEE, similar to Suwon15 (PS2), but an 18 bp deletion was not detected in the coding region (PS7, PS14), indicating Glu-1Bx14 (+) (Fig. 3a). However, both Glu-1Bx20 and Glu-1Bx14 (+) were detected using the Glu-1Bx20 detection marker PS13. Glu-1Bx14 (+) and Glu-1Bx20 contain several SNPs in the coding sequence but have 99% nucleotide sequence identity; therefore, in this study, several AS-PCR markers were tested, but Glu-1Bx14 (+) and Glu-1Bx20 could not be distinguished.

Fig. 3.

Fig. 3

Analysis of two Glu-1Bx14 alleles. (A), PCR amplification of six cultivars. DM, DNA size marker. Allows indicate indels. (B), HMW-GS from four cultivars identified by SDS-PAGE. PM, protein size marker; KK, Keumkang; Ha, Hanno; RA, RANEE. Arrows indicate Glu-1Bx and Glu-1By. (C), HMW-GS from three cultivars identified by UPLC. AU, arbitrary units; RT, retention time

In SDS-PAGE, the size of Glu-Bx14(−) was different from that of Glu-1Bx14(+) (Fig. 3b), and the extraction time of Glu-Bx14(−) was faster than of Glu-Bx14(+) (Fig. 3c).

Sequence alignment and phylogenetic analysis of Glu-1By subunits

The nucleotide sequences of seven Glu-1By subunits (Glu-1By8, Glu-1By9, Glu-1By15, Glu-1By15*, Glu-1By16, Glu-1By18, and Glu-1By20) were aligned (Fig. S4). Of these, Glu-1By8 and Glu-1By18, and Glu-1By15 and Glu-1By20 were highly conserved with 99% sequence identity. To investigate the phylogenetic relationships among the HMW-GS Glu-1By genes, the complete coding sequences of the seven HMW-GS genes were used to construct a neighbor-joining tree (Fig. 4). The genes encoding Glu-1By15 and Glu-1By20 were more closely related. Additionally, the genes encoding Glu-1By8 and Glu-1By18 were also more closely related, indicating similar structural features and close phylogenetic evolutionary relationships (Fig. 4).

Fig. 4.

Fig. 4

Phylogenetic tree of seven HMW-GS Glu-1By alleles constructed using complete coding DNA sequences. HMW-GS alleles included Glu-1By8 (JN255519.1), Glu-1By18 (KF430649.1), Glu-1By9 (X61026.1), Glu-1By15 (EU137874.1), Glu-1By15* (KJ579440.1), Glu-1By16 (EF540765.1), and Glu-1By20 (KU886033.1)

Detection of Glu-1By8 and Glu-1By18 subunits

Lei et al. [28] reported two markers (PS15 and PS16) that could differentiate Glu-1By8 from Glu-1Bx8* and Glu-1Bx18 alleles, which are generally difficult to distinguish using SDS-PAGE. A pair of AS-PCR primers (PS15) discriminated Glu-1By8, which produced a 527 bp fragment, while non-Glu-1By8 alleles showed negative results for PS15 (Fig. 5a). Previously, a pair of AS-PCR primers (PS16) was used to discriminate between Glu-1By18 and Glu-1By8 genes. In this study, no PCR product was detected from Glu-1By8 using this primer set; however, a PCR product of 527 bp was amplified from the other Glu-1By alleles, but the amplified Glu-1By15 and Glu-1By20 PCR products were weak (Fig. 5b). These markers could distinguish Glu-1By8 from other Glu-1By alleles, but could not distinguish Glu-1By8* and Glu-1By18 from other Glu-1By alleles (Fig. 5a, b). Therefore, in this study, we developed a set of specific primers to detect a 543 bp PCR product to distinguish Glu-1By18 from other Glu-1By alleles (PS17, Fig. 5c). With PS17, a single band of 543 bp was specifically detected in three cultivars (Joongmo2008, Suwon92, and Suwon105) containing Glu-1By18.

Table 3.

Primers used in this study for detection of Glu-1By alleles

PS Gene Detection region Marker name Type of primer sequence (5’-3’) AT Agarose gel (%) Reference
i-MAX II Ex Taq
PS15 Glu-1By8 CDS ZSBy8F5 SNP (By8 dominant) TTAGCGCTAAGTGCCGTCT 69℃ 68℃ 1% [24]
ZSBy8R5 TTGTCCTATTTGCTGCCCTT
PS16 Multi-gene CDS By18-SNP-F SNP (By8 negative) TTAGCGCTAAGTGCCGTCC 66℃ 66℃ 1% [24]
By18-SNP-R TTGTCCTATTTGCTGCCCTT
PS17 Glu-1By18 CDS MHBy18-F SNP CAACTTCTCCACAACAGTCG 68℃ 69℃ 1% this study
MHBy18-R GTCCTAGTTGGTGTCCTTGTT
PS18 Gu-1By9/15/20 CDS By01-F Indel (-45 bp) GGGGCCATATTATCCAGGCC 66℃ 68℃ 1% [37]
By02-R TTTGTCCTAGCTGTCCTATTTGT
PS19 Gu-1By9/15/20 CDS ZSBy9aF1 Indel (-45 bp) TTCTCTGCATCAGTCAGGA 60℃ 66℃ 1% [24]
ZSBy9aR3 AGAGAAGCTGTGTAATGCC
PS20 Gu-1By9/15/20 CDS MHBy9-F2 Indel GGGCAGCAAATAGGACAAGA ND 66℃ 1% this study
MHBy9-R TTTGTCCTAGCTGTCCTATTTGT
PS21 Gu-1By9/15/20 CDS MHBy1520-F Indel TCTCCACAGCAGCTAGGACG 66℃ 66℃ 1% this study
MHBy1520-R GCTGTTGAGAAGCTGGGTAC
PS22 Glu-1By16 CDS ZSBy9F2 Indel GCAGTACCCAGCTTCTCAA 68℃ 66℃ 1% [24]
ZSBy9R2 CCTTGTCTTGTTTGTTGCC
PS23 Glu-1By16 CDS MHBy16-F SNP GGGCAGCAAATAGGACAAGA 68℃ 68℃ 1% this study
MHBy16-R TTGTCCTACCTGCTGCAGG

PS Primer set, CDS Coding sequence, ND Not determined, AT Annealing temperature, new newly developed marker

Fig. 5.

Fig. 5

PCR analysis of Glu-1By alleles in wheat varieties. The numbers above the figure are the same as the variety numbers in Table 1. The primer set numbers in the figure are the same as in the Table 3. DM, DNA size marker; PS, primer set. Arrows indicate indels

Detection of Glu-1By9 and Glu-1By15/20 subunits

Two specific primer sets (PS18 and PS19) for Glu-1By9 allele detection have been reported to assay a 45 bp deletion [28, 37]. In this study, PS18 identified a PCR product that was 45 bp smaller in Glu-1By9 than in non-Glu-1By9, and two weak bands were detected for the Glu-1By15 and Glu-1By20 alleles (Fig. 5d). PS19 also identified a PCR product 45 bp smaller in Glu-1By9 than in non-Glu-1By9. One and two larger bands were detected for Glu-1By15 and Glu-1By20 alleles, respectively (Fig. 5e). These two primer sets detected a size of approximately 900 bp, and prolonged electrophoresis was required to distinguish the indels. In addition, the nucleotide sequences of Glu-1By15 and Glu-1By20 were highly similar and could not be distinguished. Therefore, in this study, we designed two additional primer sets to distinguish between Glu-1By15 and Glu-1By20, which produced a smaller PCR product with a 45 bp deletion (PS20–PS21, Fig. 5f-g). These markers also showed a 45 bp indel in Glu-1By9, but one large-sized band (PS20–PS21) were detected for Glu-1Bx15 and Glu-1Bx20, respectively. Therefore, these primer sets (PS18–21) could distinguish Glu-1By15 and Glu-1By20 from other alleles; however, Glu-1By15 and Glu-1By20 were detected in the same pattern and could not be distinguished from each other.

Detection of the Glu-1By16 subunit

Lei et al. [24] previously reported a PCR marker (PS22) for the detection of the Glu-1By16 allele. However, this marker showed multiple bands (three bands for Glu-1Bx16, zero or one band for Glu-1Bx15 and Glu-1Bx20, and two bands for the other Glu-1By alleles) (Fig. 5h). Therefore, we developed a Glu-1By16-specific PCR-based marker with a product size of 558 bp (PS23, Fig. 5i). This primer set specifically detected the Glu-1By16 allele in three cultivars: Jeokjoong, Baekjoong, and Joeun.

Analysis of HMW-GS protein using UPLC

HMW-GS glutenin subunits in wheat grains were confirmed by UPLC analysis (Fig. 6). The retention times of Glu-1Bx7, Glu-1Bx7*, and Glu-1Bx17 were 11.448 ± 0.027, 11.618 ± 0.067, and 11.670 ± 0.074 min, respectively, making it difficult to distinguish them. The retention times of Glu-1By8, Glu-1By8*, and Glu-1By18 were 10. 649 ± 0.022, 9.714 ± 0.048, and 9.676 ± 0.044 min, respectively. Glu-1By8* and Glu-1By18 were extracted earlier than Glu-1Dx, while Glu-1By8 was extracted later than Glu-1Dx. Thus, distinguishing Glu-1Bx8 from Glu-1Bx8* and Glu-1Bx18 may be possible using UPLC; however, it is difficult to distinguish Glu-1By8* and Glu-1By18 from each other. In addition, the extraction times of Glu-1Bx14(−), Glu-1Bx14(+), and Glu-1Bx20 were 11.549 ± 0.023, 12.319 ± 0.105, and 12.173 ± 0.029 min, respectively. The extraction time of Glu-1Bx14(−) was shorter than that of Glu-1Bx14(+) and Glu-1By20, but the extraction times of Glu-1Bx14(+) and Glu-1By20 were very similar, making it difficult to distinguish them. Likewise, the extraction times of Glu-1By15 and Glu-1By20 were very similar (9.687 ± 0.027 min and 9.645 ± 0.019 min, respectively). Therefore, the distinction between the allelic combinations of Glu-1Bx14(+) + Glu-1By15 and Glu-1Bx20 + Glu-1By20 is difficult, even using UPLC analysis.

Fig. 6.

Fig. 6

Identification of HMW-GS Glu-1Bx and Glu-1By in 24 wheat cultivars by ultra- performance liquid chromatography. Glu-1Bx and Glu-1By alleles are shown in blue. AU, arbitrary units; RT, retention time

Analysis of HMW-GS proteins using SDS-PAGE

HMW-GS glutenin subunits were compared using SDS-PAGE to confirm the presence of PCR markers in the wheat grains (Fig. 7). Glu-1Bx7 and Glu-1Bx7* differed by five amino acids and showed calculated molecular weights of 85.31 kDa and 84.71 kDa (www.bioinformatics.org), respectively, and the two proteins could not be distinguished by SDS-PAGE. Similarly, the molecular weights of Glu-1Bx14(−), Glu-1Bx14(+), and Glu-1Bx20 were calculated to be 84.53 kDa, 86.23 kDa, and 86.11 kDa, respectively, which were distinct from those of Glu-1Bx14(−) and Glu-1Bx20. However, Glu-1Bx14(+) and Glu-1Bx20 could not be distinguished by SDS-PAGE. Additionally, the molecular weights of Glu-1By8 and Glu-1By18 were calculated to be 77.38 kDa and 77.44 kDa, respectively. Glu-1By8 and Glu-1By8* proteins were highly identical in size and could not be distinguished by SDS-PAGE. The molecular weights of Glu-1By15 and Glu-1By20 were calculated to be 77.40 kDa and 77.43 kDa, respectively, and were also not distinguishable from each other.

Fig. 7.

Fig. 7

Identification of HMW-GS Glu-1Bx and Glu-1By by SDS-PAGE in 25 wheat cultivars. The numbers above the figure are the same as the variety numbers in Table 1. x + y, Glu-1Bx + Glu-1By; HMW-GS, high-molecular-weight glutenin subunits; LMW-GS, low-molecular-weight glutenin subunits; PM, protein size marker. Arrows indicate Glu-1Bx and Glu-1By alleles

Discussion

Allele variations in HMW-GSs are highly related to wheat baking quality, and among the three Glu-1 loci, Glu-B1 shows the greatest allele variations in both tetraploid and hexaploid wheat [50]. Therefore, various mass spectrometry techniques, SDS-PAGE analyses, and molecular markers have been developed to identify HMW-GSs. However, new genotypes continue to be reported, and there are few genotypes that can be distinguished using the developed markers. In addition, many previously reported PCR-based markers often performed simple relative comparison analyses without comparing various alleles. Moreover, the primer sequences and accession numbers were incorrect in some reports [35, 39]. In addition, in some cases, in genotypes of alleles that could not be distinguished by SDS-PAGE and LC analyses were re-evaluated [43, 47].

In this study, 11 novel Glu-B1 allele identification markers were developed, and together with previously reported markers, they could be used to distinguish nine Glu-1Bx alleles (Glu-1Bx6, Glu-1Bx7, Glu-1Bx7*, Glu-1Bx7 OE, Glu-1Bx13, Glu-1Bx14 (−), Glu-1Bx17, and Glu-1Bx14 (+)/20) and seven Glu-1By alleles (Glu-1By8, Glu-1By8*, Glu-1By9, Glu-1Bx16, Glu-1By18, and Glu-1By15/20). These findings confirmed that the Glu-1By allele of Avalone was Glu-1By8*, not Glu-1By8, and the Glu-1Bx allele of the three cultivars, Gobun, Eunpa, and Anbaek, was confirmed to be Glu-1Bx7*, not Glu-1By7. Geng et al. (2014) reported three Chinese and 11 European cultivars among 505 Chinese and 160 European cultivars with a 43 bp insertion. Cultivars containing 43 bp insertion were rare and had a high proportion of the Glu-1Bx7 gene. Among them, Glu-1Bx6 containing 43 bp insertion was identified in European cultivars ‘GK Bence’ and ‘Komorowska-pol’, and Glu-1Bx14 containing 43 bp insertion was found in European cultivars ‘Funo’ and ‘Amarelo de barba branca’ [40]. The present study showed that the Glu-1Bx6 allele from Avalon and the Glu-1Bx14 allele from Troll, Hanno, and Imbros are cultivars that do not contain 43 bp insertion in the promoter. Therefore, two types of promoters possibly exist in the Glu-1Bx6 and Glu-1Bx14 alleles. Cases with and without 43 bp insertions were identified; however, Glu-1Bx6 and Glu-1Bx14 with a 43 bp insertion are rare. Additionally, two Glu-1Bx14 allele accession numbers have been registered with NCBI and were distinguishable by 18 bp indels. Three cultivars—Hanno, Imbros, and Troll, showed a 18 bp deletion in Glu-1Bx14 in comparison with the other Glu-1Bx alleles, but RNAEE did not, allowing the distinction of these cultivars using the markers we developed.

In this study, two DNA polymerases were used for amplification. Unlike the conditions described in the previous studies, the annealing temperature for the optimal conditions differed depending on the DNA polymerase. Therefore, when analyzing markers, the annealing temperature must be set according to the DNA polymerase and equipment.

Glu-1Bx14(+) and Glu-1By20, and Glu-1By15 and Glu-1By20 could not be distinguished using UPLC analysis. Additionally, it was not easy to distinguish the sizes of the two proteins in SDS-PAGE analysis. These findings highlight the need to develop PCR-based markers that can easily distinguish between these two allele combinations. However, we were could not distinguish Glu-1Bx14 (+) from Glu-1Bx20, nor could it distinguish Glu-1By15 from Glu-1By20 with the PCR-based marker. In addition, since many alleles were not tested in this study and more alleles may occur, the primers developed here may not be fully applicable. However, the most commonly used allele combinations can be distinguished by PCR-based markers developed in this study. Additionally, these results suggesting that the Glu-A1 and Glu-D1 alleles also need to be reassessed through PCR-based markers.

Conclusions

HMW-GS allele composition is a crucial factor in determining end-use quality, and allele identification is an essential task in wheat breeding programs. Seven Glu-1Bx and four Glu-1By allele detection markers were developed to detect nine Glu-1Bx and seven Glu-1By locus alleles, respectively. The discrimination of Glu-B1 locus alleles can be improved and the most commonly used allele combinations can be identified by integrating previously reported markers and 11 newly developed PCR markers. However, these PCR markers cannot distinguish the Glu-1Bx14 (+) + Glu-1By15 and Glu-1Bx20 + Glu-1By20 combination; therefore, further research is needed. The developed markers can facilitate more effective analysis of molecular variations in the Glu-B1 allele, thereby improving the end-use quality of common wheat.

Supplementary Information

Supplementary file 1. (9.5MB, docx)

Abbreviations

HMW-GS

High-molecular-weight glutenin subunit

Indels

Insertions and deletions

LMW-GS

Low-molecular-weight glutenin subunit

SNP

Single-nucleotide polymorphism

PCR

Polymerase chain reaction

SDS-PAGE

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis

UPLC

Ultra-performance liquid chromatography

PS

Primer set

Authors’ contributions

M.H.L, K.M.K, and C.C conceived the project and designed the experiments. M.H.L and K.M.K performed the experiments and analyzed the data and interpreted the results. M.H.L wrote the manuscript with major contributions from K.M.K, C.S.K, M.Y, K.C.J, and C.C. All the authors have read and approved the manuscript.

Funding

This study was supported by the RDA Fellowship Program of the National Institute of Crop Science in 2023 and by the Research Program for Agricultural Science & Technology Development of the Rural Development Administration, Republic of Korea (Grant no. PJ016771052024).

Availability of data and materials

Data is provided within the manuscript and supplementary file. All raw data are provided in the supplementary file (Fig. S5–S8).

Declarations

Ethics approval and consent to participate

All experimental studies on plants were complied with relevant institutional, national, and international guidelines and legislation.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Brankovic G, Dodig D, Pajic V, Kandic V, Knezevic D, Duric N, Zivanovic T. Genetic parameters of Triticum aestivum and Triticum durum for technological quality properties in Serbia. Zemdirbyste-Agriculture. 2018;105(1):39–48. doi: 10.13080/z-a.2018.105.006. [DOI] [Google Scholar]
  • 2.Gilbert SM, Wellner N, Belton PS, Greenfield JA, Siligardi G, Shewry PR, Tatham AS. Expression and characterisation of a highly repetitive peptide derived from a wheat seed storage protein. Biochim Biophys Acta. 2000;1479:135–146. doi: 10.1016/S0167-4838(00)00059-5. [DOI] [PubMed] [Google Scholar]
  • 3.Shewry PR, Halford NG, Tatham AS. High molecular weight subunits of wheat Glutenin. J Cereal Sci. 1992;15:105–120. doi: 10.1016/S0733-5210(09)80062-3. [DOI] [Google Scholar]
  • 4.Payne PI, Law CN, Mudd EE. Control by homoeologous group 1 chromosomes of the high-molecular-weight subunits of glutenin, a major protein of wheat endosperm. Theor Appl Genet. 1988;58:113–120. doi: 10.1007/BF00263101. [DOI] [PubMed] [Google Scholar]
  • 5.Gianibelli MC, Gupta RB, Lafiandra D, Margiotta B, MacRitchie F. Polymorphism of high Mr glutenin subunits in Triticum tauschii: characterisation by chromatography and electrophoretic methods. J Cereal Sci. 2001;33(1):39–52. doi: 10.1006/jcrs.2000.0328. [DOI] [Google Scholar]
  • 6.Gupta RB, Bekes F, Wrigley CK. Prediction of physical dough properties from glutenin subunit composition in bread wheats: correlation studies. Cereal Chem. 1991;68(4):328–333. [Google Scholar]
  • 7.Tatham AS, Shewry PR, Miflin BJ. Wheat gluten elasticity: a similar molecular basis to elastin? FEBS Lett. 1984;177(2):205–208. doi: 10.1016/0014-5793(84)81284-3. [DOI] [Google Scholar]
  • 8.Tatham A, Marsh M, Wieser H, Shewry P. Conformational studies of peptides corresponding to the coeliac-activating regions of wheat α-gliadin. Biochem J. 1990;270(2):313–318. doi: 10.1042/bj2700313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wieser H. Chemistry of gluten proteins. Food Microbiol. 2007;24(2):115–119. doi: 10.1016/j.fm.2006.07.004. [DOI] [PubMed] [Google Scholar]
  • 10.Branlard G, Dardevet M. Diversity of grain protein and bread wheat quality. II. Correlation between high molecular weight subunits of glutenin and flour quality characteristics. J Cereal Sci. 1985;3:345–354. doi: 10.1016/S0733-5210(85)80007-2. [DOI] [Google Scholar]
  • 11.He ZH, Liu L, Xia XC, Liu JJ, Pena RJ. Composition of HMW and LMW glutenin subunits and their effects on dough properties, pan bread, and noodle quality of Chinese bread wheats. Cereal Chem. 2005;82:345–350. doi: 10.1094/CC-82-0345. [DOI] [Google Scholar]
  • 12.Ng PKW, Bushuk W. Statistical relationships between high molecular weight subunits of glutenin and breadmaking quality of Canadian-grown wheats. Cereal Chem. 1988;65:408–412. [Google Scholar]
  • 13.Payne PI, Holt LM, Krattiger AF, Carrillo JM. Relationships between seed quality characteristics and HMW glutenin subunit composition determined using wheats grown in Spain. J Cereal Sci. 1988;7:229–235. doi: 10.1016/S0733-5210(88)80004-3. [DOI] [Google Scholar]
  • 14.Shewry PR, Halford NG, Tatham AS, Popineau Y, Lafiandra D, Belton PS. The high molecular weight subunits of wheat glutenin and their role in determining wheat processing properties. Adv Food Nutr Res. 2003;45(3):219–302. doi: 10.1016/S1043-4526(03)45006-7. [DOI] [PubMed] [Google Scholar]
  • 15.Wang S, Yu Z, Cao M, Shen X, Li N, Li X, Ma W, Weißgerber H, Zeller F, Hsam S, Yan Y. Molecular mechanisms of HMW glutenin subunits from 1sl genome of Aegilops longissima positively affecting wheat breadmaking quality. PLoS ONE. 2013;8(4):e58947. doi: 10.1371/journal.pone.0058947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Payne PI, Lawrence GJ. Catalogue of alleles for the complex gene loci, Glu-A1, , and Glu-D1 which code for high-molecular-weight subunits of glutenin in hexaploid wheat. Cereal Res Commun. 1983;11:29–35. [Google Scholar]
  • 17.Wan Y, Liu K, Wang D, Shewry PR. High-molecular-weight glutenin subunits in the Cylindropyrum and Vertebrata section of the Aegilops genus and identification of subunits related to those encoded by the Dx alleles of common wheat. Theor Appl Genet. 2000;101:879–884. doi: 10.1007/s001220051556. [DOI] [Google Scholar]
  • 18.Roy N, Islam S, Ma J, Lu M, Torok K, Tomoskozi S, Bekes F, Lafiandra D, Appels R, Ma W. Expressed Ay HMW glutenin subunit in Australian wheat cultivars indicates a positive effect on wheat quality. J Cereal Sci. 2018;79:494–500. doi: 10.1016/j.jcs.2017.12.009. [DOI] [Google Scholar]
  • 19.Bietz JA, Shepherd KW, Wall JS. Single-kernel analysis of glutenin: use in wheat genetics and breeding. Cereal Chem. 1975;52:513–532. [Google Scholar]
  • 20.Yan Y, Hsam SLK, Yu J, Jiang Y, Zeller FJ. Allelic variation of the HMW glutenin subunits in Aegilops tauschii accessions detected by sodium dodecyl sulphate (SDS-PAGE), acid polyacrylamide gel (A-PAGE) and capillary electrophoresis. Euphytica. 2003;130:377–385. doi: 10.1023/A:1023062316439. [DOI] [Google Scholar]
  • 21.Gao L, Ma W, Chen J, Wang K, Li J, Wang S, Yan Y. Characterization and comparative analysis of wheat high molecular weight glutenin subunits by SDS-PAGE, RP-HPLC, HPCE, and MALDI-TOF-MS. J Agric Food Chem. 2010;58(5):2777–2786. doi: 10.1021/jf903363z. [DOI] [PubMed] [Google Scholar]
  • 22.Yu Z, Han C, Yan X, Li X, Jiang G, Yan Y. Rapid characterization of wheat low molecular weight glutenin subunits by ultraperformance liquid chromatography (UPLC) J Agric Food chem. 2013;61(17):4026–4034. doi: 10.1021/jf400472s. [DOI] [PubMed] [Google Scholar]
  • 23.Butow BJ, Ma W, Gale KR, Cornish GB, Rampling L, Larroque O, Morell MK, Bekes F. Molecular discrimination of Bx7 alleles demonstrates that a highly expressed high-molecular-weight glutenin allele has a major impact on wheat flour dough strength. Theor Appl Genet. 2003;107:1524–1532. doi: 10.1007/s00122-003-1396-8. [DOI] [PubMed] [Google Scholar]
  • 24.Lei ZS, Gale KR, He ZH, Gianibelli C, Larroque O, Xia XC, Butow BJ, Ma W. Y-type gene specific markers for enhanced discrimination of high molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J Cereal Sci. 2006;43:94–101. doi: 10.1016/j.jcs.2005.08.003. [DOI] [Google Scholar]
  • 25.Dong K, Hao C, Wang A, Cai M, Yan Y. Characterization of HMW glutenin subunits in bread and tetraploid wheats by reversed-phase high-performance liquid chromatography. Cereal Res Commun. 2009;37(1):65–73. doi: 10.1556/CRC.37.2009.1.8. [DOI] [Google Scholar]
  • 26.Marchylo BA, Lukow OM, Kruger EJ. Quantitative variation in high molecular weight glutenin subunit 7 in some Canadian wheats. J Cereal Sci. 1992;15:29–31. doi: 10.1016/S0733-5210(09)80054-4. [DOI] [Google Scholar]
  • 27.Smith RL, Schweder ME, Barnett RD. Identification of glutenin alleles in wheat and triticale using PCR-generated DNA markers. Crop Sci. 1994;34(5):1373–1378. doi: 10.2135/cropsci1994.0011183X003400050042x. [DOI] [Google Scholar]
  • 28.Ma W, Zhang W, Gale KR. Multiplex-PCR typing of high molecular weight glutenin alleles in wheat. Euphytica. 2003;134:51–60. doi: 10.1023/A:1026191918704. [DOI] [Google Scholar]
  • 29.Liu S, Chao S, Anderson JA. New DNA markers for high molecular weight glutenin subunits in wheat. Theor Appl Genet. 2008;118(1):177–183. doi: 10.1007/s00122-008-0886-0. [DOI] [PubMed] [Google Scholar]
  • 30.Ahmad M. Molecular marker-assisted selection of HMW glutenin alleles related to wheat bread quality by PCR-generated DNA markers. Theor Appl Genet. 2000;101:892–896. doi: 10.1007/s001220051558. [DOI] [Google Scholar]
  • 31.Xu Q, Xu J, Liu CL, Chang C, Wang CP, You MS, Li BY, Liu GT. PCR based markers for identification of HMWGS at Glu-B1x loci in common wheat. J Cereal Sci. 2008;47:394–398. doi: 10.1016/j.jcs.2007.05.002. [DOI] [Google Scholar]
  • 32.Schwarz G, Felsenstein FG, Wenzel G. Development and validation of a PCR-based marker assay for negative selection of the HMW glutenin allele GluB1-1d (Bx-6) in wheat. Theor Appl Genet. 2004;109:1064–1069. doi: 10.1007/s00122-004-1718-5. [DOI] [PubMed] [Google Scholar]
  • 33.Ragupathy R, Naeem HA, Reimer E, Lukow OM, Sapirstein HD, Cloutier S. Evolutionary origin of the segmental duplication encompassing the wheat Glu-B1 locus encoding the overexpressed Bx7 (Bx7OE) high molecular weight glutenin subunit. Theor Appl Genet. 2008;116:283–296. doi: 10.1007/s00122-007-0666-2. [DOI] [PubMed] [Google Scholar]
  • 34.Liang X, Zhen S, Han C, Wang C, Li X, Ma W, Yan Y. Molecular characterization and marker development for hexaploid wheat-specific HMW glutenin subunit 1By18 gene. Mol Breed. 2015;35:1–16. doi: 10.1007/s11032-015-0406-2. [DOI] [Google Scholar]
  • 35.Espi A, Giraldo P, Rodriguez-Quijano M, Carrillo JM. A PCR-based method for discriminating between high molecular weight glutenin subunits Bx7 and Bx7* in Triticum aestivum L. Plant Breeding. 2012;131(5):571–573. doi: 10.1111/j.1439-0523.2012.01961.x. [DOI] [Google Scholar]
  • 36.Rai R, Singh S, Das BK, Bhagwat SG. Application of allele-specific (AS-PCR) marker for identification of high-molecular-weight glutenin subunits (HMW-GS) at the GluB-1 locus in bread wheat (Triticum aestivum L.) Adv Crop Sci Tech. 2018;6(4):387. [Google Scholar]
  • 37.Frank K, Miro K, Nagy T, Marincs F. Development of a PCR-based DNA marker for Glu-1By alleles in the old Hungarian Bánkúti wheat. Mol Breed. 2017;37:1–5. doi: 10.1007/s11032-017-0719-4. [DOI] [Google Scholar]
  • 38.Wei L, Bai SG, Hou XJ, Li JM, Zhang B, Chen WJ, Liu DC, Liu BL, Zhang HG. A new HMW-GS 1Bx23* containing an amino acid segment similar to collagen. Cereal Res Commun. 2014;42:658–667. doi: 10.1556/CRC.2014.0012. [DOI] [Google Scholar]
  • 39.Li W, Wan Y, Liu Z, Liu K, Liu X, Li B, Li Z, Zhang X, Wang D. Molecular characterization of HMW glutenin subunit allele 1Bx14: further insights into the evolution of Glu-B1-1 alleles in wheat and related species. Theor Appl Genet. 2004;109:1093–1104. doi: 10.1007/s00122-004-1726-5. [DOI] [PubMed] [Google Scholar]
  • 40.Geng Y, Pang B, Hao C, Tang S, Zhang X, Li T. Expression of wheat high molecular weight glutenin subunit 1Bx is affected by large insertions and deletions located in the upstream flanking sequences. PLoS ONE. 2014;9(8):e105363. doi: 10.1371/journal.pone.0105363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38(7):3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Zhang Q, Dong YM, An XL, Wang A, Zhang YZ, Li XH, Gao LY, Xia XC, He ZH, Yan YM. Characterization of HMW glutenin subunits in common wheat and related species by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) J Cereal Sci. 2008;47:252–261. doi: 10.1016/j.jcs.2007.04.013. [DOI] [Google Scholar]
  • 43.Lee MH, Choi C, Kim KH, Son JH, Lee GE, Choi JY, Kang CS, Sohn J, Ko JM, Kim KM. Generation of wheat near-isogenic lines overexpressing 1Bx7 glutenin with increased protein contents and SDS-sedimentation values. Plants. 2023;12(6):1244. doi: 10.3390/plants12061244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.D’Ovidio R, Porceddu E, Lafiandra D. PCR analysis of genes encoding allelic variants of high-molecular-weight glutenin subunits at the Glu-D1 locus. Theor Appl Genet. 1994;88:175–180. doi: 10.1007/BF00225894. [DOI] [PubMed] [Google Scholar]
  • 45.Yang ZJ, Li GR, Liu C, Feng J, Zhou JP, Ren ZL. Molecular characterization of a HMW glutenin subunit allele providing evidence for silencing of x-type gene on Glu-B1. Acta Genet Sin. 2006;33:929–936. doi: 10.1016/S0379-4172(06)60127-3. [DOI] [PubMed] [Google Scholar]
  • 46.Radovanovic N, Cloutier S. Gene-assisted selection for high molecular weight glutenin subunits in wheat doubled haploid breeding programs. Mol Breed. 2003;12:51–59. doi: 10.1023/A:1025484523771. [DOI] [Google Scholar]
  • 47.Jang YR, Beom HR, Altenbach SB, Lee MK, Lim SH, Lee JY. Improved method for reliable HMW-GS identification by RP-HPLC and SDS-PAGE in common wheat cultivars. Molecules. 2017;22(7):1055. doi: 10.3390/molecules22071055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Park CS, Kang CS, Jeung JU, Woo SH. Influence of allelic variations in glutenin on the quality of pan bread and white salted noodles made from Korean wheat cultivars. Euphytica. 2011;180:235–250. doi: 10.1007/s10681-011-0385-2. [DOI] [Google Scholar]
  • 49.Anderson OD, Greene FC. The characterization and comparative analysis of high-molecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theor Appl Genet. 1989;77:689–700. doi: 10.1007/BF00261246. [DOI] [PubMed] [Google Scholar]
  • 50.Gianibelli MC, Larroque OR, MacRitchie F, Wrigley CW. Biochemical, genetic, and molecular characterization of wheat endosperm proteins. Cereal Chem. 2001;78(6):635–646. doi: 10.1094/CCHEM.2001.78.6.635. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file 1. (9.5MB, docx)

Data Availability Statement

Data is provided within the manuscript and supplementary file. All raw data are provided in the supplementary file (Fig. S5–S8).


Articles from BMC Plant Biology are provided here courtesy of BMC

RESOURCES