OASL suppresses infectious bursal disease virus replication by targeting VP2 for degrading through the autophagy pathway

ABSTRACT

Infectious bursal disease (IBD) is an acute and fatal immunosuppressive disease caused by infectious bursal disease virus (IBDV). As an obligate intracellular parasite, IBDV infection is strictly regulated by host factors. Knowledge on the antiviral activity and possible mechanism of host factors might provide the theoretical basis for the prevention and control of IBD. In this study, RNA-sequencing results indicated that many host factors were induced by IBDV infection, among which the expression levels of OASL (2´,5´-oligadenylate synthetase-like protein) was significantly upregulated. OASL overexpression significantly inhibited IBDV replication, whereas OASL knockdown promoted IBDV replication. Interestingly, the antiviral ability of OASL was independent of its canonical enzymatic activity, i.e., OASL targeted viral protein VP2 for degradation, depending on the autophagy receptor p62/SQSTM1 in the autophagy pathway. Additionally, the 316 lysine (K) of VP2 was the key site for autophagy degradation, and its replacement with arginine disrupted VP2 degradation induced by OASL and enhanced IBDV replication. Importantly, our results for the first time indicate a unique and potent defense mechanism of OASL against double-stranded RNA virus by interaction with viral proteins, which leads to their degradation.

IMPORTANCE

OASL (2´,5´-oligadenylate synthetase-like protein) exhibits broad-spectrum antiviral effects against single-stranded RNA viruses in mammals, potentially serving as a promising target for novel antiviral strategies. However, its role in inhibiting the replication of double-stranded RNA viruses (dsRNA viruses), such as infectious bursal disease virus (IBDV), in avian species remains unclear. Our findings indicated a unique and potent defense mechanism of OASL against dsRNA viruses. It has been previously shown in mammals that OASL inhibits virus replication through increasing interferon production. The groundbreaking aspect of our study is the finding that OASL has the ability to interact with IBDV viral protein VP2 and target it for degradation and thus exerts its antiviral effect. Our results reveal the interaction between avian natural antiviral immune response and IBDV infection. Our study not only enhances our understanding of bird defenses against viral infections but can also inform strategies for poultry disease management.

INTRODUCTION

Infectious bursal disease (IBD) is fatal, highly contagious, and results in significant economic losses in the poultry industry (1). The pathogen, infectious bursal disease virus (IBDV) is widespread globally and seriously destroys the body’s immune system, causing immunosuppression (2, 3). IBDV is a double-stranded RNA virus with a genome consisting of two segments designated A and B (4). These segments encode a total of five proteins, among which VP1, VP2, and VP3 are structural proteins and VP4 and VP5 are non-structural proteins (5). The main structural protein, VP2, is the sole component forming the outer layer of the single-layer viral capsid and accounts for 51% of the total viral proteins in the intact IBDV particle (5). Furthermore, VP2 can interact with host factors CD74 (6) and CD44 (7) and other potential receptor components to facilitate IBDV infection. Hence, VP2 may perform essential functions in promoting IBDV replication through interacting with host factors during the infection process.

Viral infection is a constant interaction between virus and host, and is strictly regulated by host factors. Viruses can hijack host factors to facilitate their continuous replication, and inversely, the host induces high expression of host factors to limit viral infection (8). Many host factors, such as tripartite motif containing 25 (TRIM25) (9), chemokine CCL19 (10), and eukaryotic translation initiation factors 4AII (11), are upregulated during IBDV infection, some of which have been demonstrated to restrict IBDV replication. Particularly, our previous study has demonstrated that high expression of TRIM25 inhibited IBDV replication by targeting the 854 lysine (K) of VP3 for degradation via the proteasomal way (9). Similarly, 2´,5´-oligadenylate synthetase-like protein (OASL) was also significantly upregulated during IBDV infection. How OASL derived from chicken-inhibited IBDV remains unclear. Exploration of the antiviral activity and molecular mechanisms of host factors will help understand novel infection mechanisms of IBDV and further develop prevention and control strategies.

OASL is a member of the 2´,5´-oligadenylate synthetase (OAS) family, which shared a highly conserved N-terminal domain and a different C-terminal part (12, 13). The differences of structure of the OAS family might consequently determine their function. For example, in humans, the OAS family consists of four members, of which OAS1, OAS2, and OAS3 have enzymatic activity, while OASL does not (14). OASL is common in different species and closely related to the infection process of virus (15–19), i.e., OASL can be upregulated upon virus infection and further plays antiviral ability on virus replication. The members of the OAS family may exert antiviral activity via the canonical OAS/RNase L-dependent antiviral pathway depending on its enzymatic activity or non-canonical OAS/RNase L-independent antiviral pathway (15). OASL in human and swine without enzymatic activity can enhance the production of type I interferon (IFN) by interacting with retinoic acid inducible-gene I (RIG-I)/melanoma differentiation-associated gene 5 (MDA5) and subsequently inhibiting RNA virus replication (20), such as that of vesicular stomatitis virus (21), respiratory syncytial virus (21), encephalomyocarditis virus (21), and classical swine fever virus (22). Therefore, OASL has been proven to have broad spectrum of antiviral effects in mammals, and it may be a potential target for antiviral strategies. In chickens, the OAS family only contains OASL with enzymatic activity (18). In chickens, OASL has also found to inhibit single-stranded RNA virus replication, such as that of West Nile virus and Newcastle disease virus (23, 24). However, whether OASL exerts an inhibitory effect on IBDV replication and acts as a potential target of antiviral strategies in chicken remains unclear.

In our study, we investigated whether OASL derived from chicken inhibits IBDV replication and the possible mechanism. We found that IBDV infection significantly induced OASL, which could suppress IBDV replication. We further demonstrate that OASL interacted with VP2 and induced its degradation dependent on the autophagy receptor p62/SQSTM1. These results show a distinct relationship between virus and host restriction factors and reveal a novel mechanism of OASL inhibition of IBDV replication.

RESULTS

OASL is significantly induced by IBDV infection in vitro and in vivo

To analyze the transcript profiles of the host genes involved in IBDV infection, immortal chicken embryo fibroblast (DF-1) cells were infected with IBDV [multiplicity of infection (MOI) = 0.01] for 12, 24, and 36 h. As shown in Fig. 1A, many host factors were upregulated, among which, OASL expression was markedly induced upon IBDV infection. It has been previously shown that OASL has antiviral effects in mammals and may be a novel and potential target of antiviral strategies (20–22). Therefore, in this study, we investigated whether OASL derived from chicken could inhibit the replication of IBDV and its possible mechanisms. To verify the influence of IBDV infection on OASL, DF-1 cells were infected with IBDV at an MOI of 0.01 in vitro, and 3-week-old chickens were challenged with 10³ 50% tissue culture infectious doses (TCID₅₀) of IBDV in vivo. Quantitative reverse transcription real-time PCR (RT-qPCR) results indicated that the IBDV genome copies was 9.03 × 10⁴ copies/10⁶ cells in DF-1 cells at 48 h post-infection (hpi) (Fig. 1B) and 6.94 × 10⁴ copies/10⁶ cells in the bursa at 72 hpi (Fig. 1E), indicating that IBDV infection was successful. The mRNA level of OASL of DF-1 cells increased 1.95 × 10³-fold (Fig. 1C) and 5.96-fold in the bursa of chickens (Fig. 1F). Western blotting results showed that the expression level of OASL increased with IBDV infection in vitro (Fig. 1D), with an approximately 23.05-fold increase at 24 hpi compared to non-infected DF-1 cells. Therefore, these results suggest that the host factor OASL was significantly induced by IBDV infection in vitro and in vivo.

Fig 1.

OASL is significantly induced by IBDV infection in vitro and in vivo. (A) Analysis results of RNA-sequencing on DF-1 cells infected with IBDV (MOI = 0.01) at 12, 24, and 36 hpi. (B–D) Expression level of OASL was upregulated by IBDV infection in DF-1 cells. DF-1 cells were either infected or mock-infected with IBDV (MOI = 0.01) and collected at 12, 24, 36, and 48 hpi, respectively. (B) IBDV genome copies in vitro detected by RT-qPCR. (C) Relative expression level of OASL was detected using RT-qPCR. (D) Expression level of OASL detected by western blotting and the relative intensities of OASL normalized with β-actin. (E and F) IBDV infection upregulated OASL in vivo. Three-week-old chickens were either mock-infected or infected with 10³ TCID₅₀ IBDV and the bursae were harvested at 12, 24, 36, 48, 60, 72, and 84 h, respectively. (E) IBDV genome copies in vivo were detected via RT-qPCR. (F) Relative expression level of OASL represented by RT-qPCR. The results of western blotting are representative of one of three independent experiments. The data of RT-qPCR are shown as means ± standard deviations for triplicates from the representative experiment. *, P < 0.05; **, P < 0.01, ***, P < 0.001.

OASL inhibits IBDV replication

To elucidate the regulatory effect of OASL on IBDV infection, DF-1 cells were transfected with the pFLAG-OASL expression plasmid or control vector, and then infected with IBDV at an MOI of 0.01. RT-qPCR results revealed that the mRNA level of the IBDV genome decreased 2.87- and 1.45-fold at 24 and 48 hpi, respectively, in the OASL-overexpressing group (Fig. 2A). Western blotting results indicated that OASL overexpression decreased the expression level of VP2 1.41- and 3.53-fold compared to the control group at 24 and 48 hpi, respectively (Fig. 2B and C). Consistently, the viral titers of IBDV in supernatants of the OASL overexpression group were also reduced 9.77- and 17.91-fold at 24 and 48 hpi, respectively (Fig. 2D). Taken together, these results indicate that chicken OASL inhibits IBDV replication.

Fig 2.

OASL inhibits IBDV replication. (A–D) Inhibition effect of overexpression of pFLAG-OASL on IBDV replication. DF-1 cells were transfected with 2 µg of pFLAG-OASL or PCAGGS and then infected with IBDV (MOI = 0.01) after 24 h post-transfection. The cell and supernatant samples were collected at 24 and 48 hpi. (A) Changes in the IBDV genome were detected by RT-qPCR. (B and C) Changes in the levels of OASL and VP2 were determined using western blotting. (D) Released viral loads of the supernatants in different group were detected using a TCID₅₀ assay. (E–G) Knockdown effect of small interfering RNAs targeting OASL was determined using RT-qPCR (E) and western blotting (F–G). (H–K) Knockdown of OASL promoted IBDV replication. DF-1 cells were transfected with 2 µg of siOASL-3 or siSc for 24 h and subsequently infected with IBDV at an MOI of 0.01. Then, the samples were collected at 24 and 48 hpi. (H) The mRNA level of IBDV genome was quantified by RT-qPCR. (I and J) Expression level of VP2 was detected using western blotting. (K) Released viral loads in the supernatant were detected using a TCID₅₀ assay. Results of western blotting are representative of one of three independent experiments. The data of RT-qPCR are shown as means ± standard deviations for triplicates from the representative experiment. *, P < 0.05; **, P < 0.01, ***, P < 0.001.

To further confirm that OASL could inhibit IBDV replication, we first evaluated the efficiency of the knockdown of three small interfering RNAs (siRNAs) targeting OASL. RT-qPCR and western blotting results indicated that the expression level of OASL was reduced by siOASL-3 (Fig. 2E through G). DF-1 cells were transfected with siOASL-3 for 24 h and then infected with IBDV at an MOI of 0.01. Western blotting results indicated that the expression levels of VP2 markedly increased in the the siOASL-3 transfected group (Fig. 2H and I). The RT-qPCR results indicated that mRNA levels of the IBDV genome increased 2.24-fold at 24 hpi in the siOASL-3 transfected group compared to the scrambled siRNA (siSc)-transfected control group (Fig. 2J). Furthermore, TCID₅₀ assay results showed an 8.67-fold increase in viral titer at 24 hpi compared to the control group (Fig. 2K). These results support the conclusion that OASL can significantly inhibit IBDV replication.

OASL derived from chicken inhibits IBDV replication independent of its enzymatic activity

OASL has a conserved structural arrangement of an NTase domain (residues 1–120), an OAS-like domain (residues 121–341), and a ubiquitin-like (UBL) domain (residues 342–476) (Fig. 3A) (20, 25). The UBL domain is responsible for the enzymatic activity of OASL derived from chicken (18). To further assess whether OASL inhibition of IBDV replication is dependent on its UBL domain, we constructed an OASL enzymatic activity domain deletion mutant plasmid (pFLAG-OASL-DelUBL) and transfected it into DF-1 cells, which were infected with IBDV (MOI = 0.01). Western blotting results showed that OASL-DelUBL overexpression decreased the expression level of VP2 1.58-fold compared to the control group at 24 hpi (Fig. 3B and C). The RT-qPCR results showed that the IBDV genomic mRNA level was reduced 2.07-fold in the OASL-DelUBL overexpression group at 24 hpi (Fig. 3D). In addition, the viral titers of the supernatants decreased 8.00-fold in the OASL-DelUBL overexpression group (Fig. 3E). Therefore, OASL derived from chicken with the deletion of the UBL domain could still inhibit IBDV replication. These results indicate that OASL inhibits IBDV replication independently of its enzymatic activity.

Fig 3.

OASL derived from chicken inhibits IBDV replication independently of its enzymatic activity. (A–E) Overexpression of pFLAG-OASL-DelUBL (an OASL enzymatic activity domain deletion mutant) inhibited IBDV replication. DF-1 cells were transfected with 2 µg of pFLAG-OASL, pFLAG-OASL-DelUBL, or PCAGGS and then infected with IBDV (0.01 MOI) at 24 h post-transfection. Further samples were collected at 24 hpi. (A) Schematic representation of OASL structural domain. (B) Expression level of OASL and VP2 was detected using western blotting, (C) and the relative intensities of VP2 were normalized to β-actin. (D) mRNA level of the IBDV genome was detected using RT-qPCR. (E) Viral loads of the supernatant were detected using a TCID₅₀ assay. RT-qPCR data are shown as means ± standard deviations for triplicates from the representative experiment. *, P < 0.05; **, P < 0.01, ***, P < 0.001.

OASL interacts with viral proteins VP2 and VP4

To determine whether avian OASL inhibits IBDV replication by interacting with viral proteins, DF-1 cells were co-transfected with pFLAG-OASL plasmids with five different IBDV viral protein plasmids. The co-immunoprecipitation (Co-IP) results indicated that OASL strongly interacted with VP2 and VP4 (Fig. 4A). Similarly, as shown in Fig. 4B through D, the reverse Co-IP results verified that OASL interacted with VP2 and VP4. Confocal microscopy confirmed that OASL co-localized with VP2 and VP4 in the cytoplasm (Fig. 4E and F). These results show that OASL interacts with the VP2 and VP4 proteins of IBDV.

Fig 4.

OASL interacts with viral proteins VP2 and VP4. (A–C) Relationship between OASL and VP2. DF-1 cells were transfected with pFLAG-OASL and viral proteins (pHA-VP1, pHA-VP2, pHA-VP3, pHA-VP4, and pHA-VP5, respectively) and determined by Co-IP. (A) Relationship between OASL and viral proteins. (B and C) Interaction between OASL and VP4 determined by western blotting. (D) Interaction between OASL and VP2 determined by western blotting. (E and F) Colocalization between OASL and VP2 or VP4. (E) A confocal assay was used to indicate the co-localization between OASL and VP2 (F) and the interaction of OASL and VP4. The results of western blotting are representative of one of three independent experiments.

OASL targets VP2 for degradation via autophagy pathway

To further determine whether OASL inhibited IBDV replication by targeting VP2 or VP4 for degradation, we co-transfected different doses of pFLAG-OASL plasmids (0, 1, 2, or 4 µg, respectively) and pHA-VP2 or pHA-VP4 into DF-1 cells, and then detected the transcription and translation levels of VP2 and VP4 proteins at 36 h post-transfection (hpt). RT-qPCR and western blotting results showed that there was no difference in the protein and mRNA levels of VP4 in the different OASL overexpression groups compared with the pHA-VP4 only transfected group (Fig. 5A through C). However, the results of RT-qPCR showed that the mRNA level of VP2 was unchanged co-expressed with or without OASL, whereas the VP2 expression level was significantly reduced with the increase in OASL expression in a dose-dependent manner (Fig. 5D through F). To further determine the above results, DF-1 cells were transfected with pFLAG-OASL plasmids and infected with IBDV (MOI = 0.01) at 24 hpt. As shown in Fig. 5G, VP2 expression was reduced by OASL during IBDV infection. These results suggest that OASL degrades VP2 rather than VP4 in a dose-dependent manner.

Fig 5.

OASL targets VP2 for degradation via autophagy pathway. Different doses of pFLAG-OASL plasmids (0, 1, 2, or 3 µg, respectively) and pHA-VP4 (0.5 µg) or pHA-VP2 (0.5 µg) were co-transfected into DF-1 cells. (A–C) OASL did not influence the expression of VP4. (A) Expression level of pHA-VP4 determined using western blotting. (B) Relative intensities of VP4 normalized to β-actin. (C) VP4 mRNA level detected using RT-qPCR. (D–F) OASL decreased the expression level of VP2. (D) Expression level of pHA-VP2 determined using western blotting. (E) Relative intensities of VP2 normalized to β-actin. (F) VP2 mRNA level detected using RT-qPCR. (G) Expression level of IBDV VP2 determined using western blotting and relative intensities of VP2 normalized to β-actin. (H–K) OASL targeted VP2 for degradation through the autophagy pathway. DF-1 cells were co-transfected with pHA-VP2 (0.5 µg) and pFLAG-OASL (3 µg) or empty vector (3 µg) plasmids for 24 h and treated with dimethyl sulfoxide (DMSO) (negative control), MG132 (10 µM), bafilomycin A1 (100 nM), 3-methyladenine (5 mM), or wortmannin (10 µM) for 12 h. (H and J) Expression levels of VP2 determined using western blotting. (I and K) Relative intensities of VP2 normalized to β-actin. (L) The sequence analysis of wild-type (WT) and ATG5 knockout (ATG5KO) DF-1 cell lines. (M) Expression level of VP2 determined using western blotting and relative intensities of VP2 normalized to β-actin. The results of western blotting are representative of one of three independent experiments. The data of RT-qPCR are shown as means ± standard deviations for triplicates from the representative experiment. *, P < 0.05; **, P < 0.01, ***, P < 0.001.

The ubiquitin-proteasome system and autophagy are the two major intracellular pathways involved in protein degradation (26). To further determine the degradation pathway of VP2 induced by OASL, we co-transfected pFLAG-OASL and pHA-VP2 into DF-1 cells for 24 h and then treated them with proteasome inhibitor MG132 (10 µM), autophagy inhibitors [bafilomycin A1 (BafA1, 100 nM), wortmannin (Wort, 10 µM), and 3-methyladenine (3-MA, 5 mM)] for 12 h. As shown in Fig. 5H through K, overexpressed OASL more effectively degraded VP2 in the group treated with MG132 than in the group treated with BafA1 or 3-MA, and barely in the group treated with Wort. All above results indicated that OASL may target VP2 for degradation in the autophagy way. The autophagic protein ATG5 is essential for the activation of conventional autophagy and autophagosome formation (27). To further verify the above results, ATG5 knockout (ATG5KO) DF-1 cell lines were constructed by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system (9) and co-transfected with different doses of pFLAG-OASL plasmids (0, 1, 2, or 4 µg, respectively) and pHA-VP2 for 24 hpt. The results indicated that ATG5KO DF-1 cell lines were constructed successfully (Fig. 5L) and the viral protein VP2 protein only undergoes slight degradation after OASL overexpressed in the ATG5KO DF-1 cell line (Fig. 5M). Collectively, all these results demonstrate that OASL targets VP2 for degradation via autophagy pathway.

IBDV VP2 protein is degraded through the OASL-p62/SQSTM1 autophagy pathway

To explore the specific molecular mechanism of OASL-induced VP2 degradation via the autophagy pathway, the hallmark of autophagy, microtubule-associated protein 1 light chain 3 (MAP1LC3/LC3) (28), was determined in pFLAG-OASL and pHA-VP2 co-expressing cells. Western blotting results showed that VP2 and OASL co-expression in the cells promoted the conversion of LC3-I to LC3-II (Fig. 6A), which suggested that OASL co-expressed with VP2 could induce autophagy. During the autophagy process, ubiquitinated substrate proteins can be recognized by autophagy receptors and transported to lysosomes for degradation (26). To confirm the ubiquitination of VP2 induced by OASL, we co-transfected with pFLAG-VP2, pHA-Ub, and pGST-OASL plasmids into HEK293T cells. Co-IP results indicated that the overexpression of OASL considerably enhanced the ubiquitination of VP2 (Fig. 6B). A previous study showed that VP2 of IBDV is ubiquitinated and can be recognized by the autophagy receptor p62/SQSTM1 (29). The Co-IP results also showed that OASL interacts with p62/SQSTM1 (Fig. 6C). This suggests that OASL degrades VP2 of IBDV in the autophagy pathway through interaction with the autophagy receptor p62/SQSTM1.

Fig 6.

IBDV VP2 protein is degraded through the OASL-p62/SQSTM1 autophagy pathway. To further determine the degradation of VP2 induced by OASL, pFLAG-OASL and pHA-VP2 were co-transfected into DF-1 cells for 24 h. (A) Expression level of LC3 detected using western blotting. (B–C) Interaction between OASL and VP2. (B) OASL-induced ubiquitination of VP2 detected using western blotting. (C) OASL interacted with autophagy receptor p62/SQSTM1. (D–F) Different VP2 plasmids [wild type (WT) and mutant] were co-transfected with pFLAG-OASL for 36 h. The lysates were analyzed using western blotting. (D–G) Interaction between OASL and different VP2 mutants. (D–F) Degradation of different VP2 mutants induced by OASL detected using western blotting and relative intensities of VP2 normalized with β-actin. (G) Interaction between OASL and VP2K316R. (H) Replication activity analysis between WT IBDV (rmGt) and mutant IBDV with the K316R mutation in VP2 (rGt-VP2K316R) in vivo. (I) Viral loads of bursae in the two groups infected with rmGt and rGt-VP2K316R, respectively. (J) Bursa:body weight index (BBIX) of chickens infected with rmGt or rGt-VP2K316R. (K). Histopathological analysis of chickens in the two groups infected with rmGt and rGt-VP2K316R, respectively.

Ubiquitylation is the process of transferring the ubiquitin molecule to the lysine residue of the target protein. To determine the key site of VP2 responsible for OASL-induced autophagy degradation, we constructed 10 VP2 mutants, pFLAG-VP2K35R, pFLAG-VP2K84R, pFLAG-VP2K154R, pFLAG-VP2K192R, pFLAG-VP2K309R, pFLAG-VP2K316R, pFLAG-VP2K381R, pFLAG-VP2K399R, pFLAG-VP2K400R, and pFLAG-VP2K411R, and co-transfected them with OASL. Western blotting results indicated that the 316-residue mutant of VP2 could not be degraded by OASL and could not interact with OASL (Fig. 6D through G). To further determine the function of IBDV replication at the key site of VP2, the mutant virus (rGt-VP2K316R) and wild-type virus (rmGt) were rescued. The replication kinetics curve in vivo showed that the mutant virus (rGt-VP2K316R) possessed a stronger replication ability, having an approximately 6.29-fold higher load than the wild-type virus (Fig. 6H). To further confirm the above results, the specific pathogen-free (SPF) chickens were infected with rGt-VP2K316R and rmGt viruses at a dose of 10⁵ TCID₅₀/200 L and the bursae were collected at at 3, 4, 5, and 6 days post-infection (dpi). The RT-qPCR results indicated viral loads of rGt-VP2K316R with a 1.57- to 2.77-fold increase in bursae (Fig. 6I). These results suggested that the destruction of the K316 ubiquitination site of VP2 could enhance the replication abilities of IBDV in vitro and in vivo.

To further determine the influence of K316 of VP2 on the virulence of IBDV, the bodies and bursae were weighed for the calculation of bursa:body weight index (BBIX), and the bursae were fixed for histopathological study (9). Results showed that the BBIX of the rGt-VP2K316R group was above 0.7 at 3, 4, 5, and 6 dpi (Fig. 6J). Furthermore, the histopathological analysis results showed that rGt-VP2K316R did not induce any lesions in the bursae of SPF chickens, similar to rmGt (Fig. 6K). The above results indicated that the mutation of K316 of VP2 could enhance the replication ability of mutant virus (rGt-VP2K316R) in vitro and in vivo, but did not influence its virulence compared to the wild-type virus (rmGt).

DISCUSSION

The replication of IBDV, as an obligate parasite, is strictly regulated by host factors during infection. Exploring the antiviral ability of host factors and their potential molecular mechanisms contributes to further analysis of IBDV infection characteristics and the development of prevention and control measures. In the present study, we found that OASL was induced by IBDV infection and restricted IBDV replication, for the first time, indicating that OASL plays an antiviral role during IBDV (a double-stranded RNA virus) infection. Subsequently, we confirmed that OASL could directly target the ubiquitinated VP2 for degradation by relying on the autophagy receptor p62/SQSTM1, thereby limiting the replication of IBDV. Importantly, the 316K residue of VP2 was the key site for autophagy degradation, and its replacement with arginine disrupted VP2 degradation and enhanced IBDV replication. Generally, OASL exerts antiviral ability only by increasing IFN production by targeting the pattern recognition receptors MDA5 or RIG-I. Interestingly, our results for the first time revealed the novel antiviral mechanism of OASL (Fig. 7). OASL directly targeted VP2 for degradation to inhibit double-stranded virus (IBDV) replication. The novel antiviral role and regulatory mechanism of OASL broadens the antiviral spectrum of OASL to double-stranded RNA viruses.

Fig 7.

Model by which OASL suppresses infectious bursal disease virus replication by targeting VP2 for degrading through the autophagy pathway. OASL induced the degradation of VP2 dependent on the autophagy receptor p62/SQSTM1. Our results indicate a distinct relationship between virus and host restriction factors and reveal a novel mechanism by which OASL inhibits IBDV replication.

In many studies, OASL has been found to be a host restriction factor that limits viral infection, as indicated by its strong inhibitory effect on single-stranded RNA virus replication (23, 24). However, in this study, we found that avian OASL inhibits IBDV (a double-stranded RNA virus) replication. OASL is a member of the 2´,5´-oligadenylate synthetase family and exerts antiviral effects by canonically cleaving viral RNA to inhibit viral proliferation (30). Although OASL has a conserved NTase-OAS-like UBL domain in different species, it sometimes inhibits viral replication independently of its enzymatic activity (23–25). For example, mammalian OASL, without enzymatic activity, activates type I IFN to limit virus replication (22). OASL derived from chicken has been proven to have enzymatic activity, but its antiviral effect is independent of its enzymatic activity (18). For example, OASL mutant with UBL domain deleted does not have enzymatic activity, but still can inhibit flavivirus replication (23, 30). In our study, we also found that despite deletion of the UBL domain, OASL-DelUBL still restricted IBDV replication. Based on the antiviral effects of OASL in avian species and mammals and our current data, OASL inhibition of viral replication is not entirely dependent on its enzymatic activity but might depend on a non-canonical pathway, such as enhancing the innate immune response.

During IBDV infection, host factors directly target specific viral proteins to regulate replication. For example, our previous results demonstrated that TRIM25 only interacts with VP3 to induce its ubiquitination and degradation and inhibit IBDV replication (9). In this study, we found that OASL interacted with both VP2 and VP4 simultaneously, but only specifically targeted VP2 for degradation in the autophagy pathway and did not influence the stability of VP4. Therefore, targeting a particular viral protein for degradation may be a crucial pathway for the host to combat IBDV infection. Conversely, to maintain a balance between viral infection and antiviral responses, we speculated that VP4 of IBDV might antagonize the antiviral activity of the host by targeting OASL. However, the specific molecular mechanism requires further study (31). In addition to OASL inhibiting viral replication by inducing type I IFN production, our study showed that OASL also interacted with VP2 to inhibit IBDV replication. Therefore, we broaden the knowledge on the antiviral mechanism of OASL and for the first time show that it inhibits viral replication by directly targeting viral proteins for degradation.

When pathogens invade cells, autophagy is activated as an innate immune response to resist infection, and viral proteins utilize cellular autophagy to regulate viral replication (32). Previous studies have mainly focused on VP2 and VP3, which can induce cellular autophagy and promote IBDV replication (33, 34). However, our study is the first to show that the host factor OASL restricts IBDV replication by targeting the viral protein VP2 for degradation via the autophagy pathway. The autophagy pathway targets specific ubiquitinated substrates through various autophagy receptors (e.g., p62/SQSTM1) and selectively packages the targets into autophagosomes, finally forming autophagic lysosomes, which then undergo degradation (35). In line with a previous study that showed that VP2 of IBDV is ubiquitinated and interacts with the autophagy receptor p62/SQSTM1 (29), we found in the current study that the host factor OASL derived from chicken interacted with the autophagic receptor p62/SQSTM1 and increased the ubiquitination level of VP2. These results suggest that the OASL derived from chicken may inhibit IBDV replication by targeting VP2 for degradation through the autophagy pathway. Collectively, our results highlight the promoting role of autophagy in the inhibition process of host factors antagonizing IBDV replication, which might be considered a novel means to remove invading pathogens in chickens.

The target protein ubiquitination process is completed by the transfer of ubiquitin molecules to the lysine molecules of the target protein to form a polyubiquitin chain (32). Our study revealed that 316 lysine was the key ubiquitination site of VP2. Mutation of 316 lysine reversed OASL-induced degradation of VP2 and weakened the interaction between OASL and VP2. We further found that the recombinant virus rGt-VP2K316R, with a mutation at a key autophagy degradation site, had a higher replication titer than the parent virus. Therefore, the key ubiquitination site of VP2 of IBDV is considered a possible mutation strategy to rescue the recombinant virus and subsequently improve the viral titer, providing new insights into the development of high-titer and low-cost IBDV vaccines.

Taken together, these results confirm that OASL plays an antiviral role against a double-stranded RNA virus, i.e., on the IBDV infection. OASL commonly inhibits virus replication through increasing IFN production, but our results showed that OASL directly targeted VP2 for degradation, by which it exerted its antiviral activity. These findings not only elucidate the novel regulatory mechanism of the host factor OASL in inhibiting IBDV replication, but also provide novel insights into the prevention and control of IBD.

MATERIALS AND METHODS

Cells, viruses, and plasmids

HEK293T and DF-1 cells were purchased from the American Type Culture Collection and maintained in Dulbecco’s modified Eagle’s medium (DMEM; Basal Media, L110KJ) containing 10% fetal bovine serum (FBS; Sigma-Aldrich, F0193). Chicken embryo fibroblasts (CEF) were kept in DMEM containing 5% FBS. DF-1 cells were cultured in a humidified incubator containing 5% CO₂ at 38.5°C. HEK293T and CEF cells were maintained in a humidified incubator with 5% CO₂ at 37°C. The IBDV strain was previously described and preserved in our laboratory (9).

OASL was amplified from DF-1 cells and inserted into the pCAGGS plasmid with a FLAG tag, a HA tag, or a GST tag at the C-terminus. The autophagy receptor p62/SQSTM1 was amplified from DF-1 cells and inserted into the pCAGGS plasmid with an HA or Myc tag fused to its 3´ end. Other plasmids related to interaction and virus replication were plasmids for N-terminal fused HA-tagged VP1–VP5 and plasmids for C-terminal fused FLAG-tagged VP2 and OASL-DelUBL.

The used plasmids related to the autophagy degradation site were pFLAG-VP2K35R, pFLAG-VP2K84R, pFLAG-VP2K154R, pFLAG-VP2K192R, pFLAG-VP2K309R, pFLAG-VP2K316R, pFLAG-VP2K381R, pFLAG-VP2K399R, pFLAG-VP2K400R, pFLAG-VP2K411R, and rGt-VP2K316R A-segment plasmids according to the site-specific mutation experiments.

Antibodies and reagents

The monoclonal antibodies used were anti-IBDV VP2, anti-IBDV VP3, and anti-OASL antibodies generated and preserved in our laboratory, and anti-FLAG M2 (Sigma-Aldrich, F1804), anti-HA (Sigma-Aldrich, H9658), anti-β-actin (Sigma-Aldrich, A1978), and anti-Myc (Sigma-Aldrich, M4439 and C3956) antibodies purchased from Sigma-Aldrich.

The secondary antibodies were Anti-Mouse IgG (whole molecule)-fluorescein isothiocyanate (FITC) antibody (Sigma-Aldrich, F9137) purchased form Sigma-Aldrich, Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 (Invitrogen, A-11003), Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Invitrogen, A-11008) obtained from Invitrogen, IRDye 800CW Goat anti-Mouse IgG Secondary Antibody (LI-COR, 926-32210), and IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody (LI-COR, 926-68071) purchased from LI-COR.

The reagents used in the study included bafilomycin A1 (Med Chem Express, HY-100558), wortmannin (Med Chem Express, HY-10197), 3-methyladenine (Med Chem Express, HY-19312), and MG132 (Med Chem Express, HY-13259), supplied by Med Chem Express. TB Green Premix Ex Taq II (Tli RNaseH Plus; Takara, RR820A), Preix Ex Taq (Probe qPCR) (Takara, RR390A), and PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047) were used.

RNA-sequencing (RNA-seq)

DF-1 cells were infected with IBDV at an MOI of 0.01. At 12, 24, and 36 hpi, the cells were collected and used to extract total RNA using RNAiso Plus (catalog no. 9109; TaKaRa) according to the manufacturer’s instructions. RNA quantification and qualification were performed using the RNA Nano 6000 assay kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The mRNAs with poly(A) tails were enriched and purified from the total mRNAs by poly(T) oligonucleotide-coupled magnetic beads. RNA-seq libraries were prepared and assessed using an AMPure XP system kit (Beckman Coulter, Beverly, USA) in the Agilent Bioanalyzer 2100 system. Subsequently, RNA-seq libraries were sequenced on a BGIseq platform. We mapped all the genes to Terms in the Gene Ontology database and calculated the numbers of differentially enriched genes in each term. We next used topGO to perform GO enrichment analysis on the changed host genes in DF-1 cells infected with IBDV comparing to the non-infected DF-1 cells at 12, 24, and 36 hpi.

IBDV infection

DF-1 cells were seeded in 12-well plates and infected with the appropriately diluted viruses. After 1.5 h of absorption at 38.5°C, DF-1 cells were washed with DMEM without FBS and maintained in DMEM containing 5% FBS for a different time. The 42 3-week-old SPF chickens were divided into infected and non-infected groups and infected with 10³ TCID₅₀ of IBDV or phosphate buffered saline (PBS). Then, we collected the bursa to detect virus infection and the expression level of host genes at the appropriate time.

Furthermore, to determine the inhibitory role of OASL on IBDV replication, DF-1 cells transfected with targeted plasmids were infected with IBDV (MOI = 0.01) and collected for study at different time points.

Transfection

For overexpression, DF-1 cells were transfected with 2 µg of pFLAG-OASL, pFLAG-OASL-DelUBL, or pCAGGS plasmids, respectively, using the TransIT-X2 Dynamic Delivery System (Mirusbio, MIR 6000). After culturing for 24 h, the cells were infected with IBDV at an MOI of 0.01 and subsequently cultured to detect viral replication.

For RNAi, the siRNAs specifically targeting the chOASL mRNA were designed by GenePharma. siSTING was synthesized by GenePharma, and its knockdown efficiency was verified previously (15). The siRNA sequences used in the experiments were as follows: siOASL-1 (5ʹ-GCACUGGUACAAGGCUGAATT-3ʹ), siOASL-2 (5ʹ-GGACUUCAGCAUGGCUGAATT-3ʹ), siOASL-3 (5ʹ-GCAAGAACUGGGACUUGGUTT-3ʹ),

and siSc. (5ʹ-UUCUCCGAACGUGUCACGUTT-3ʹ). The siRNAs targeting OASL were separately transfected into DF-1 cells using X-tremeGENE siRNA Transfection Reagent (Roche, 4476093001). After 24 h of transfection, the DF-1 cells were collected or infected with IBDV for further research. The endogenous knockdown level of OASL was detected by western blotting and quantitative real-time reverse transcription.

RT-qPCR

The total RNA was extracted from the different experimental groups using RNAiso Plus (TaKaRa, 9109) and subsequently reverse-transcribed into cDNA using a PrimeScript RT reagent Kit with gDNA Eraser. The relative expression level of host genes was detected with the relative RT-qPCR. The relative mRNA levels of OASL, VP2, and VP4 were normalized to the β-actin mRNA level in each sample. The viral loads of IBDV in the infected cells were detected with absolute RT-qPCR.

Co-IP and western blotting

DF-1 cells were co-transfected with different plasmids fused with FLAG, HA, GST, or Myc tags. At 36 hpt, DF-1 cells were washed three times with PBS and lysed in 400 µL of western blotting and IP lysis buffers (Beyotime, P0013) for 20 min. The cell lysates were centrifugated and its supernatants were incubated with monoclonal antibodies for 6–8 h. Then, 40 µL of protein A/G agarose (Abmart, A10001) was added to the lysate mixture for another 6–8 h. Finally, the mixture was centrifugated and washed five times with ice-cold PBS for 5 min at 4°C.

For western blotting, the collected samples were boiled in 5× sodium dodecyl-sulfate loading buffer or 2× sodium dodecyl-sulfate loading buffer (Beyotime, P0015L) for 10 min, separated on 12.5% SDS-polyacrylamide gels, and transferred onto nitrocellulose membranes. Then, the membrane was incubated with the primary and secondary antibodies and scanned using an Odyssey Infrared Imaging System (LICOR BioSciences, Lincoln, USA) for further analysis.

Confocal microscopy

DF-1 cells cultured in 35 mm dishes were co-transfected with the indicated plasmids. After 24 h of incubation, the cells were washed three times with PBS and fixed in 4% (vol/vol) paraformaldehyde for 30 min. Then, the cells were incubated with the indicated monoclonal and secondary antibodies. Finally, the cells were stained with 4',6-diamidino-2-phenylindole (DAPI) for 10 min and examined using a Leica SP2 confocal system (Leica Microsystems, Wetzlar, Germany).

Generation of ATG5 knockout DF-1 cells line

The ATG5KO DF-1 cells line were built by using CRISPR/Cas9 method with the gRNA targeting ATG5 mRNA sites (ATG5: TCCTTGGAGCATCACACTGC). The generation method of ATG5KO DF-1 cells line was performed as described previously (9).

Virus growth curve

CEFs were cultured on flasks and infected with wild-type (rmGt) and mutant IBDV (rGt-VP2K316R) viruses at an MOI of 0.01, respectively. Then, the supernatant in the two groups was collected at 12, 24, 36, 48, 60, and 72 h, respectively. The released viral titers of the supernatant were detected using the TCID₅₀ assay. Finally, the virus growth curve was drawn according to the detected viral titers.

Animal experiments

Thirty SPF chickens of 4 weeks old were individually divided into two group. One group (n = 15) was challenged with 10⁵ TCID₅₀/200 µL rmGt and the other group (n = 15) was challenged with 10⁵ TCID₅₀/200 µL mutant IBDV (rGt-VP2K316R) viruses, respectively. Then, the bursae in the two groups were collected at 3, 4, 5, and 6 dpi, respectively. The viral copies of bursa were detected using the RT-qPCR. And the bursa injury was detected by body weight index (BBIX) and hematoxylin-eosin (HE) staining (9).

Statistical analysis

The experiments were conducted in triplicate. All results are representative of three independent experiments. The data are presented as mean ± standard deviations. Moreover, the data were analyzed by two-way analysis of variance using the GraphPad Prism 8.0 software (GraphPad Software, USA). A P-value <0.05 was considered statistically significant. Differences between groups are indicated with asterisks (*), *, P < 0.05; **, P < 0.01; ***, P < 0.001.

DATA AVAILABILITY

The raw sequencing data have been deposited in the National Center for Biotechnology Information Sequence Read Archive under accession numbers SRR26895055 to SRR26895072.

ETHICS APPROVAL

All animal experiments were approved by the Committee on the Ethics of Animal Experiments of Harbin Veterinary Research Institute (HVRI), Chinese Academy of Agricultural Sciences (CAAS). Specific pathogen-free (SPF) chickens were purchased from the Experimental Animal Center of the HVRI and housed in negative-pressure isolators with adequate food and light. All animal procedures were performed according to the international standards for animal welfare.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/jvi.00181-24.

Table S1. jvi.00181-24-s0001.docx.

The change of expression level of host factors after IBDV infection.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.