Insights into the novel Enterococcus faecalis phage: A comprehensive genome analysis

Sahar Abed; Mohammad Sholeh; Mahshid Khazani Asforooshani; Morvarid Shafiei; Abdolrazagh Hashemi Shahraki; Shaghayegh Nasr

doi:10.1371/journal.pone.0301292

. 2024 May 14;19(5):e0301292. doi: 10.1371/journal.pone.0301292

Insights into the novel Enterococcus faecalis phage: A comprehensive genome analysis

Sahar Abed ^1,², Mohammad Sholeh ², Mahshid Khazani Asforooshani ², Morvarid Shafiei ^2,^*, Abdolrazagh Hashemi Shahraki ³, Shaghayegh Nasr ^1,⁴

Editor: Vinod Kumar Yata⁵

PMCID: PMC11093359 PMID: 38743671

Abstract

Enterococcus faecalis, a Gram-positive bacterium, poses a significant clinical challenge owing to its intrinsic resistance to a broad spectrum of antibiotics, warranting urgent exploration of innovative therapeutic strategies. This study investigated the viability of phage therapy as an alternative intervention for antibiotic-resistant E. faecalis, with a specific emphasis on the comprehensive genomic analysis of bacteriophage SAM-E.f 12. The investigation involved whole-genome sequencing of SAM-E.f 12 using Illumina technology, resulting in a robust dataset for detailed genomic characterization. Bioinformatics analyses were employed to predict genes and assign functional annotations. The bacteriophage SAM-E.f 12, which belongs to the Siphoviridae family, exhibited substantial potential, with a burst size of 5.7 PFU/infected cells and a latent period of 20 min. Host range determination experiments demonstrated its effectiveness against clinical E. faecalis strains, positioning SAM-E.f 12 as a precise therapeutic agent. Stability assays underscore resilience across diverse environmental conditions. This study provides a comprehensive understanding of SAM-E.f 12 genomic composition, lytic lifecycle parameters, and practical applications, particularly its efficacy in murine wound models. These results emphasize the promising role of phage therapy, specifically its targeted approach against antibiotic-resistant E. faecalis strains. The nuanced insights derived from this research will contribute to the ongoing pursuit of efficacious phage therapies and offer valuable implications for addressing the clinical challenges associated with E. faecalis infections.

Introduction

Enterococcus faecalis presents a significant challenge due to its multidrug resistance, including resistance to vancomycin, which is often considered a last-resort antibiotic [1]. This bacterium is intrinsically resistant to certain antibiotics, further limiting treatment options [2]. Studies have demonstrated high levels of resistance in E. faecalis against various antibiotics, with some strains showing resistance to multiple drugs [3]. The presence of antibiotic resistance genes in E. faecalis genomes leads to the rapid selection of resistant strains, complicating infection treatment [4]. Recent data has shown that E. faecalis isolates have exhibited resistance percentages exceeding 40% against key antibiotics such as tetracycline, vancomycin, linezolid, erythromycin, and ampicillin [5]. The rise in antibiotic resistance among Enterococcus species, particularly E. faecalis, underscores the urgent need for the development of new anti-infective therapies [6–8]. The surge in antibiotic-resistant E. faecalis strains has increased the urgency for innovative therapeutic approaches, prompting keen interest in phage-based interventions [9–11]. This burgeoning interest stems from the demonstrated efficacy of phage therapy (PT) in exerting lytic activity against diverse antibiotic-resistant E. faecalis isolates [12–14], thus providing a promising alternative treatment [13].

The pivotal role of E. faecalis phages in the pursuit of novel therapeutic strategies has emerged [12, 15]. These phages exhibit the potential to shield against lethal vancomycin-resistant E. faecalis, as evidenced by murine bacteremia models, and contribute to restoring gut microbiota equilibrium [16]. In delving into the rich landscape of E. faecalis phages, research has uncovered a repertoire of lytic bacteriophages, including vB_EfaS_PHB08, vB_EfsS_V583, LG1, and others. These phages exhibit a commendable ability to target and disrupt E. faecalis biofilms, paving the way for potential applications in treating biofilm-related infections and dental root canal treatments [17–20]. The efficacy demonstrated in inhibiting biofilm formation and eradicating planktonic E. faecalis cultures attests to the promising role of these phages in clinical scenarios [12, 20, 21].

Moreover, investigations into the synergistic effects of bacteriophages and antibiotics revealed a potential avenue for enhancing treatment outcomes against multidrug-resistant E. faecalis infections. This collaborative approach offers hope of addressing the persistent challenge of antibiotic resistance associated with E. faecalis [19, 20].

However, a significant gap in our understanding remains regarding the genetic diversity, evolutionary mechanisms, and therapeutic applicability of E. faecalis phages, particularly in the context of antibiotic resistance. This knowledge gap brings us to the central question of our study: How can comparative genomics advance our understanding and application of E. faecalis phages in combating antibiotic-resistant infections?

Our objective is to conduct a comprehensive genomic analysis of isolated lytic bacteriophages targeting E. faecalis. This analysis aims to elucidate their genetic composition, diversity, and therapeutic potential against antibiotic-resistant strains. Through this exploration, we aspire to bridge existing knowledge gaps and lay the foundation for innovative phage-based therapeutic strategies. By unraveling the genetic intricacies of E. faecalis phages, this research seeks to contribute valuable insights into infectious disease research and the fight against antibiotic resistance, thereby paving the way for the development of novel therapeutic approaches.

Method

Phage isolation procedure

A total of 60 phenotypically confirmed E. faecalis isolates were sourced from Resalat Hospital in Tehran. These isolated were used later to verify the host spectrum of the isolated phages. To verify their identity, a specific primer set was employed in the polymerase chain reaction (PCR) amplification process. The forward primer sequence (ACTTATGTGACTAACTTAACC) and reverse primer sequence (TAATGGTGAATCTTGGTTTGG) used were reported in a prior investigation, ensuring the accuracy of the identification process [22].

The raw sewage samples obtained from Resalat Hospital in Tehran; Iran used as source for phage. The sewage sample was centrifugation at 8000 rpm for 20 min to eliminate bacterial cells and debris. The supernatant, filtered through a 0.22 μm pore size membrane, was stored at 4°C. The host bacterium, vancomycin-resistant E. faecalis (VRE) was cultured in BHI broth at 37°C until the logarithmic growth phase was reached. Equal volumes of VRE cultures and sewage filtrates were amalgamated, supplemented with 2× brain heart infusion (BHI) broth, and incubated for 24 hours at 37°C. Subsequently, the resulting phage lysate underwent purification via three successive cycles of single-plaque selection and co-culturing. Verification of phage isolation was conducted using the double-layer agar (DLA) method.

The plate was incubated at 37°C for 24 h, and clear plaques indicated a successful phage infection.

Three rounds of single-plaque isolation were performed for purification. Phage titration involved tenfold serial dilutions in SM buffer (100 mM NaCl, 8 mM MgSO4, 50 mM Tris (pH 7.5) and 0.002% gelatin (w/v)), and plaques were enumerated after incubation, expressing titration as plaque-forming units (PFU/ml).

Electron microscopy analysis

The examination of the structural characteristics of the isolated phage particles was conducted through Transmission Electron Microscopy (TEM), following established protocols [22]. In brief, a volume of 10 μL of purified phage particles was applied to a carbon-coated copper grid for a duration of 3–5 minutes, followed by staining with 1% (w/v) uranyl acetate at a pH of 7. Microscopic images were acquired using a Zeiss LEO 906 TEM (Carl Zeiss LEO EM 906 E, Germany) operating at an accelerating voltage of 100 kV.

Whole genome sequencing and phage characterization

Following the extraction of the phage genome using a commercial kit (DNA Pure, FAVORGEN, Iran), which adhered to the manufacturer’s guidelines and underwent rigorous quality assessment measures, including optical density measurements, gel electrophoresis, and a PCR assay targeting bacterial 16S primers to confirm the absence of bacterial genome contamination [23], the phage genome was subjected to comprehensive whole-genome sequencing (WGS) on the Illumina HiSeq 2000 platform [24].

The initial step involved the preprocessing of paired-end sequence reads of 150 bp obtained from the Illumina HiSeq 2000 platform, using Genomics Workbench CLC 22 [25]. This preprocessing included the trimming of adapters, ambiguous nucleotides, and low-quality sequences, following standard parameters (i.e., bases less than 15 nt, maximum 2 ambiguous nucleotides, and Q score ≤5 was trimmed).

The subsequent assembly of reads employed default parameters with a word size of 15 nt [25]. Validation of the obtained contigs was performed through a nucleotide BLAST using Geneious version 22 [26]. The selected contigs were then mapped to viral sequences in the GenBank database, and their association with putative bacteriophages was analyzed using the NCBI database [27]. To further validate the results, clean reads were mapped to the viral genomes identified in the BLAST results.

The comprehensive annotation of the whole genome was conducted using the CLC Genomic Microbial Plugin with reference genome-based annotated blast tools [25]. A 95% similarity threshold and a default E value of 0.0001 were utilized for annotation purposes.

Additionally, the genome candid was utilized for whole-genome alignment with selected NCBI phages, facilitated by the Whole Genome Alignment plugin in the CLC Genomics Workbench [27].

Phage characteristics

One-step growth experiment

The replication dynamics of the phage were investigated through a one-step growth experiment [28]. This experiment involved monitoring phage lytic development and provided insights into the growth properties of the phage [29]. Mid-exponential phase VRE was precipitated, resuspended in phage lysate, and incubated at 37°C. Samples were collected at 5-minute intervals over a 2-hour period. The burst size, indicative of the number of progeny phages released per infected cell, was determined using the DLA method.

Multiplicity of infection (MOI) determination

The MOI was assessed to ascertain the optimal ratio of phage particles to host bacteria during infection [30]. This critical parameter provides insights into the efficiency of phage infection and was determined by carefully titrating the phage concentration against a fixed bacterial density.

Host range determination

The specificity of the isolated bacteriophages towards their hosts was evaluated using the Spot test method on 60 clinical isolates of E. faecalis. This process entailed the application of phage lysates onto bacterial cultures to observe clear zones, which signify lytic activity. Furthermore, the lytic potential of these phages was also examined against additional bacterial species, including Enterococcus faecium, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus aureus. These additional bacterial strains were sourced from the Pasteur Institute of Iran’s bacterial repository, ensuring a thorough analysis of the phages’ host range.

Absorption time assay

To explore the initial phases of infection, an absorption time assay was conducted [18]. In this experiment, mid-exponential phase VRE was subjected to exposure to the phage, with samples collected at 1-minute intervals over a 10-minute duration to monitor unabsorbed phages. The assay employed a double-layer agar system, enabling the quantitative assessment of phage concentrations by absorbance measurements. The recorded PFU (Plaque-Forming Units) values were subsequently analyzed, shedding light on the kinetics of phage attachment and entry into host cells. This approach provided detailed insights into the early events of the infection process.

Environmental stability assay

The effect of temperature on phage viability was evaluated by incubating the phage suspensions at different temperatures (-20, 4, 37, 50, 60, and 70°C) for 1h. Survival rates were determined using plaque assays [18].

The effect of pH on phage viability was investigated by incubating phage suspensions at different pH values (2, 4, 7, 10, and 14) for 1 h at 37°C. Survival rates were determined using plaque assays.

The impact of calcium and magnesium ions on phage adsorption rate was assessed by incubating VRE and phage lysates with or without divalent cations. Samples collected at regular intervals were titrated to determine the proportion of adsorbed phage.

The stability of the phages in salts (NaCl) was evaluated by incubating the phage suspension with 5%, 10%, and 15% (w/v) salts for 1 h at 37°C [31]. Survival rates were determined based on log PFU/ml and compared to those of the control.

Effect of phage disruption on biofilms

Microtiter plates were set up by adding 20 μL of OD~0.5 VRE (vancomycin-resistant Enterococci) to 230 μL of Brain Heart Infusion (BHI) broth. We established biofilms at 1, 3, and 5 days old without phage exposure and then subjected them to phage treatment as outlined in reference [32]. Post biofilm formation, we treated them with 10 μL of phage lysate at varying concentrations (10¹⁰ PFU/mL, 10⁸ PFU/mL, and 10⁶ PFU/mL) for 24 hours at 37°C. We quantified the absorption of 2,3,5-Triphenyltetrazolium chloride (TTC) stain in the phage-treated biofilms using a previously described method [33]. The biofilm experiments were performed in triplicate for both the phage-treated and untreated groups.

In vivo assay for phage efficiency

The therapeutic efficacy of bacteriophage intervention against VRE infections was evaluated in a BALB/c mouse wound model [34]. The study involved the use of female mice, aged 5–6 weeks, divided into three experimental groups: a negative control group, a positive control group, and a treatment group infected with E. faecalis and subsequently treated with bacteriophages. The bacteriophage treatment involved the administration of a MOI of 1, six hours post-infection. Prior to treatment, an essential purification step was implemented to ensure the safety and purity of the bacteriophage suspension used. This involved the removal of lipopolysaccharides (LPS) using the EndoTrap^® Red endotoxin removal kit, a widely recognized method for its efficacy in LPS clearance [34]. The effectiveness of LPS removal was confirmed using the Limulus Amebocyte Lysate (LAL) assay, ensuring that the bacteriophage suspension was free from endotoxins and safe for therapeutic application. Following the LPS removal, the bacteriophage suspension underwent concentration and buffer exchange, and was subjected to sterility tests and phage titer measurements to confirm the viability of the phages for therapeutic use [34].

Histopathological analysis

The passage describes the histopathological analysis method employed in the study, involving the careful preparation of wound tissues from euthanized mice. After fixation, embedding, and sectioning, the tissues underwent standardized H&E staining for visualization. Blinded histopathological evaluation, conducted by a professional, included the assessment of various tissue parameters such as fibroblast activity, epidermal thickness, capillary count, hair follicles, collagen growth, neutrophil infiltration, and macrophage infiltration. The study utilized a detailed scoring system, as previously outlined in reference [35], allowing for a quantitative comparison of histopathological changes among different experimental groups. This approach enhances the precision of the analysis, providing valuable insights into variations across diverse experimental conditions.

Results

Isolation and multiplication of effective bacteriophage against e. faecalis

The bacteriophage SAM-E.f 12 was specifically isolated to target E. faecalis. The spot assay results, as illustrated in Fig 1A, along with the DLA assay outcomes presented in Fig 1B, unequivocally affirmed its lytic activity. The Transmission Electron Microscopy analysis, as depicted in Fig 1C, conclusively identified SAM-E.f 12 as a member of the Siphoviridae family. Noteworthy, the one-step growth curves elucidated a succinct latent period of 20 minutes and an impressive burst size of 5.7 PFU per infected cell.

WGS and bioinformatics analysis

A meticulous investigation of the SAM-E.f 12 genome revealed a robust contig coverage distribution, predominantly exceeding 100x, attesting to its high-quality assembly. Employing a specialized commercial column-based DNA extraction protocol ensured material purity without bacterial genomic contamination. WGS produced a comprehensive dataset of 1.5 Gb paired-end reads, designated GenBank accession number OR762047. Using Illumina technology, a robust dataset achieved an impressive 282x coverage of the SAM-E.f 12 genome. Rigorous quality assessment, precise trimming, and de novo assembly using metaSPAdes resulted in a single contig spanning 36,626 bp, confirming the comprehensive coverage and precision.

The annotated contiguous sequence was subjected to BLASTp analysis against the RefSeq viral database, enhancing our understanding of SAM-E.f 12’s genomic composition and facilitating comparison with known sequences. Comparative genomics has placed SAM-E.f 12 within a sparse cluster in the E. faecalis phage population, inviting further exploration of its evolutionary dynamics and therapeutic potential. Comparative analysis with Enterococcus phage NC_0422125 revealed a query coverage of 98.3% and an APNI of 90.16%, emphasizing SAM-E.f 12’s novelty and distinct genomic makeup (Fig 2).

Fig 2 — The map displays sixty-one open reading frames (ORFs) represented as arrows, indicating the direction of transcription. Proposed modules are based on hypothetical functions inferred from bioinformatic analysis.

This finding underscores the need for further research to elucidate SAM-E.f 12’s specific characteristics. SAM-E.f 12’s robust association with Enterococcus phage NC_0422125 in the APNI phylogenetic tree confirms its genetic similarity, supported by a compelling bootstrap value. The formation of a distinct clade involving SAM-E.f 12 and Enterococcus phage NC_0422125 signifies shared common ancestry, supporting the notion of genetic kinship among these phages (Fig 3). SAM-E.f 12’s closer relation between Enterococcus phage NC_0422125 and its distinct divergence within the clade suggests dynamic evolutionary patterns among Enterococcus phages, thus contributing to our understanding of phage evolution and diversity.

Fig 3 — The Figure showcases the comparative analysis of SAM-E.f 12 genome alignment with Enterococcus phage NC_0422125. The alignment reveals a high query coverage of 98.3% and an Adjusted Percentage of Nucleotide Identity (APNI) of 90.16%. Despite minor misalignments, the accurate assembly of SAM-E.f 12’s distinct genomic makeup is evident, highlighting its validity.

SAM-E.f 12’s alignment with Enterococcus phage NC_0422125, featuring a query coverage of 98.3% and an APNI of 90.16%, underscores its distinct genomic makeup. Despite minor misalignments, the accurate assembly reinforces the validity of the SAM-E.f 12 genome (Fig 3).

Host range determination

The spot assays conducted on a diverse group of 60 clinical E. faecalis isolates provided crucial insights into the host specificity of SAM-E.f 12. In these assays, clear plaques were observed in 70% of the E. faecalis strains, demonstrating the phage’s targeted effectiveness. Importantly, SAM-E.f 12 showed no lytic activity against E. faecium, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus aureus, confirming its specific action on select strains and illustrating its limited impact on a broader range of bacteria.

Investigation of phage characteristics and stability to environmental factors

Multiplicity of infection (MOI)

The determination of the MOI for SAM-E.f 12 phage is illustrated in Fig 4A, where a value of 0.1 was established. This critical metric provides insights into the ratio of phage particles to bacterial host cells, laying the foundation for subsequent analyses of SAM-E.f 12’s lytic lifecycle parameters.

One-step growth assays

One-step assays were meticulously conducted to unravel SAM-E.f 12’s lytic lifecycle parameters over a 240-minute post-infection period, as depicted in Fig 4B. The pivotal outcome of these assays was the determination of the average burst size, which was calculated as 5.7 PFU/infected cells. These quantitative data, when coupled with genomic analysis, significantly enhanced the comprehensive understanding of SAM-E.f 12’s lytic lifecycle parameters. The integration of these findings contributes to the robust characterization of SAM-E.f 12 behavior during infection, providing valuable insights for both theoretical understanding and potential practical applications in phage therapy.

Thermal stability

Fig 4C illustrates SAM-E.f 12’s thermal stability. The optimal lytic activity was recorded at 37°C, which is consistent with the typical growth temperature of E. faecalis. The phage displayed detectable activity across a temperature range of -20°C to 40°C, with a significant decline beyond 50°C. This suggests that SAM-E.f 12 possesses moderate thermal tolerance, which enhances its potential for applications in environments with variable temperatures.

pH stability

The influence of pH on SAM-E.f 12’s lytic activity, showcased in Fig 4D) revealed optimal performance within a pH range of 4–10, with a peak activity at pH 7. This versatility suggests SAM-E.f 12’s effectiveness across diverse environmental pH conditions, which is a vital attribute for navigating varying pH gradients within the gastrointestinal tract.

Salt tolerance

Fig 4E shows the response of the SAM-E.f 12 cells to salt stress. Although the number of phage particles decreased with increasing salt concentrations, sustained lytic activity was observed, indicating moderate salt tolerance. This characteristic enhances SAM-E.f 12’s potential applicability in environments with elevated salinity such as certain food matrices.

Adsorption rate

Fig 4F highlights SAM-E.f 12’s adsorption rate of onto E. faecalis. Within 5 min, over 96% of the phage particles were efficiently absorbed by bacterial cells. This rapid adsorption is crucial for effective phage therapy, as it minimizes the timeframe available for the host to develop resistance.

Investigation of phage impact on biofilm disruption

After staining and evaluating the optical absorption of the wells, we noted a significant decrease in absorption levels in most wells compared to the controls. A particular phage lysate, at a concentration of 10¹⁰ PFU/mL, was markedly more effective in combating the biofilm. This was evident from the lowest absorption levels in these wells relative to other variants and control wells, indicating complete biofilm eradication. At a concentration of 10⁸ PFU/mL, the phage lysate was 100% effective against one-day-old biofilms, 80% effective against three-day-old biofilms, and 60% effective against five-day-old biofilms. When the phage lysate concentration was reduced to 10⁶ PFU/mL, it showed 100% effectiveness against one-day-old biofilms, 40% against three-day-old biofilms, and 20% against five-day-old biofilms.

In-vivo efficacy testing

The in vivo assessment of phage therapy in the wound model of mice, as shown in the Fig 5, reveals striking results. Initially, all three groups had wounds of approximately 5mm. However, their healing trajectories diverged dramatically over time. The non-infected group, unsurprisingly, displayed the fastest healing, their wounds shrinking to 2mm by Day 7 and reaching full closure (0 mm) by Day 14. The infected control group showed sluggish progress, with wounds remaining around 4mm at Day 7 and only marginally reduced to 0.2mm by Day 14. Notably, the phage-treated group exhibited the most remarkable improvement. By Day 7, their wounds were significantly reduced to 1mm, and by Day 14, they achieved nearly complete healing with size of 0mm, mirroring the performance of the non-infected group. This striking outcome suggests that phage therapy significantly accelerates wound healing in infected mice, bringing their recovery rate closer to that of healthy control mice.

Histopathological evaluation of wound healing outcomes in phage-treated

The histopathological evaluation of tissue parameters in different experimental groups reveals distinctive patterns of tissue responses, shedding light on the potential therapeutic effects of bacteriophage treatment. In comparison to the positive control group, characterized by intense fibroblast activity with a score of +3, significant collagen growth (+4), and pronounced neutrophil (+3) and macrophage infiltration (+4), the phage-treated group displayed a more controlled tissue response. The phage-treated group exhibited a moderate fibroblast activity (+1), moderate collagen growth (+2), and reduced neutrophil (+2) and macrophage infiltration (+3) compared to the positive control. Remarkably, the number of capillaries in the phage-treated group showed a substantial increase with a score of +3, indicating potential benefits for vascularization. Additionally, the hair follicles in the phage-treated group displayed notable improvement with a score of +3, suggesting positive effects on hair follicle regeneration. These findings suggest that bacteriophage treatment contributes to a more regulated and efficient wound healing process, mitigating excessive inflammation and promoting tissue repair. Comparisons with the negative control (no infection) and healthy mice groups underscore the need for further investigation to delineate the specific benefits and potential drawbacks of bacteriophage therapy in wound healing contexts. Overall, these detailed histopathological results provide a promising foundation for future in-depth studies exploring the therapeutic potential of bacteriophages in tissue repair and infection control (Table 1, and Fig 6).

Table 1. Histopathological evaluation of tissue parameters in different experimental groups.

Categories	Phage-Treated	Positive Control	Negative Control	Healthy Mice
Fibroblast Activity	+1	+3	+3	+1
Epidermal Thickness	+1	+1	+2	+1
Number of Capillaries	+3	+3	+2	+1
Hair Follicles	+3	+1	+1	+4
Collagen Growth	+2	+4	+3	+1
Neutrophil Infiltration	+2	+3	+4	+1
Macrophage Infiltration	+3	+4	+3	+1

Open in a new tab

Experimental Setup: The caption describes the different groups involved in the study. The "Phage-Treated" group refers to the experimental group that received bacteriophage treatment. The "Positive Control" group consists of injured mice with bacterial infection, serving as a comparison. The "Negative Control (No Infection)" group represents injured mice without bacterial infection. Lastly, the "Healthy Mice" group serves as the control group, consisting of mice without any injuries or infections.

Fig 6 — Histopathological Evaluation of Wound Healing Outcomes in Phage-Treated Group; (A): Phage-Treated; Experimental Group Treated with Bacteriophage, (B): Positive Control; Injured Mice with Bacterial Infection, (C): Negative Control (No Infection); Injured Mice without Bacterial Infection, (D): Healthy Mice; Control Group of Healthy Mice.

Discussion

E. faecalis, a Gram-positive bacterium, poses a formidable challenge in clinical settings due to its intrinsic resistance to a broad spectrum of antibiotics, including those vital for combatting bacterial infections [7, 8, 36]. This resistance has prompted its inclusion in the World Health Organization’s priority pathogen list [37]. This resistance has not only placed E. faecalis on the World Health Organization’s priority pathogen list but also highlighted the critical need for innovative therapeutic strategies to combat such resilient bacterial strains. Particularly noteworthy is E. faecalis’s resistance to antibiotics like vancomycin, accentuating the exigency to explore alternative treatment modalities [2]. Phage therapy, characterized by a targeted approach, emerges as an advantageous strategy, especially in combating antibiotic-resistant E. faecalis strains, aligning with broader efforts to address antibiotic resistance through innovative antimicrobial exploration [2, 6].

While systemic use of bacteriophages is hindered by limited understanding of their impact on human physiology, bacteriophage therapy presents distinct advantages in the context of wound infections, particularly those caused by E. faecalis. Previous studies have elucidated the lytic activity of E. faecalis bacteriophages against various Gram-positive pathogens, providing a foundation for their application in wound healing [19, 38]. Encouragingly, bacteriophages have shown efficacy in treating wounds infected by Staphylococcus aureus, chronic nonhealing wounds, and burn wounds infected by Pseudomonas aeruginosa [39]. These findings underscore the potential of bacteriophages in addressing specific infections, such as those caused by E. faecalis, and their significant role in wound healing. We acknowledge the pivotal role of previous studies in laying the groundwork for our research on bacteriophage therapy as a viable alternative to traditional antibiotics. These studies have demonstrated the effectiveness of bacteriophages in not only targeting E. faecalis but also in providing a basis for their application in treating various antibiotic-resistant bacterial infections [2, 6]. The selection of E. faecalis as our primary focus was driven by its alarming resistance to a wide array of antibiotics, including vancomycin, and its significant impact on healthcare systems worldwide.

The bacteriophage SAM-E.f 12, belonging to the Siphoviridae family, exhibits noteworthy lytic activity against E. faecalis, with a latent period of 20 minutes and a burst size of 5.7 PFU per infected cell [40]. Genomic analysis using BLASTp against the RefSeq viral database positions SAM-E.f 12 within a sparse cluster in the E. faecalis phage population. Comparative genomics with Enterococcus phage NC_0422125 highlights SAM-E.f 12’s novelty, with a high query coverage of 98.3% and an APNI of 90.16%. The phylogenetic tree confirms SAM-E.f 12’s genetic similarity to Enterococcus phage NC_0422125, suggesting shared common ancestry and dynamic evolutionary patterns among Enterococcus phages [41–43].

The bacteriophage SAM-E.f 12 demonstrated remarkable effectiveness against select isolates of clinical E. faecalis, evidenced by the formation of clear plaques in 70% of the 60 strains tested in the spot assay. This notable specificity, underscored by the lack of lytic activity against E. faecium, highlights SAM-E.f 12’s targeted action, especially against vancomycin-resistant E. faecalis strains. Such specificity is crucial for addressing the growing challenge of antibiotic resistance and aligns with the findings of previous research, which have documented the efficacy of specific phages in selectively targeting E. faecalis. This alignment not only corroborates SAM-E.f 12’s potential in phage therapy but also reinforces the importance of phage specificity in the development of targeted antibacterial treatments [44, 45].

The optical absorption results of this study significantly contribute to the understanding of SAM-E.f 12’s biofilm disruption capabilities. At a concentration of 10¹° PFU/mL, SAM-E.f 12 showed remarkable effectiveness in completely eliminating biofilms. This was evident from the significantly lower absorption levels observed compared to the controls and other wells. The concentration-dependent efficacy of SAM-E.f 12 was evident, with complete eradication of one-day-old biofilms at 10⁸ PFU/mL. The phage also displayed an 80% success rate against three-day-old biofilms and a 60% effectiveness against five-day-old biofilms at this concentration. However, when the concentration was reduced to 10⁶ PFU/mL, the effectiveness declined, especially against older biofilms. While it achieved 100% effectiveness against one-day-old biofilms, the success rates dropped to 40% and 20% for three-day and five-day-old biofilms, respectively. These findings indicate that the potency of SAM-E.f 12 in biofilm disruption is influenced by both the concentration of the phage and the age of the biofilms.

These findings emphasize the potential of SAM-E.f 12 as a therapeutic agent against biofilm-associated infections. The concentration-dependent efficacy underscores the importance of optimizing phage concentrations to achieve maximum therapeutic benefits, particularly when dealing with older and more resilient biofilms. Consequently, this study positions SAM-E.f 12 as a promising candidate for antibacterial treatments, especially in cases where traditional antibiotics struggle to combat the persistent nature of biofilms. These results indicate the significant prospects of using SAM-E.f 12 as a targeted therapy for biofilm-related infections, highlighting its potential contribution to the field of antibacterial treatments [12, 46].

The results of this study underscore the therapeutic potential of SAM-E.f 12 in addressing biofilm-associated infections. The concentration-dependent efficacy highlights the need for optimizing phage concentrations to maximize therapeutic benefits, particularly when dealing with established and resilient biofilms. These findings position SAM-E.f 12 as a promising candidate for antibacterial treatments, especially in cases where traditional antibiotics face challenges in targeting biofilms. The study suggests that SAM-E.f 12 could serve as a targeted therapy for biofilm-related infections, offering promising prospects in the field of antibacterial treatments [47–49]. One-step assays reveal an average burst size of 5.7 PFU/infected cells over a 240-minute post-infection period, enhancing our understanding of SAM-E.f 12’s behavior during infection [50]. These quantitative data, combined with genomic analysis, contribute to a robust characterization of SAM-E.f 12’s lytic lifecycle parameters, offering valuable insights for both theoretical understanding and practical applications in phage therapy.

SAM-E.f 12’s optimal lytic activity at 37°C, detectable across a broad temperature range (-20°C to 40°C), aligns with the physiological conditions of E. faecalis growth [51]. Moreover, optimal lytic activity within a pH range of 4–10, with peak activity at pH 7, and moderate salt tolerance further enhance SAM-E.f 12’s potential applicability in diverse environmental conditions, such as the gastrointestinal tract and certain food matrices [52, 53]. The rapid adsorption of SAM-E.f 12 onto bacterial cells, a crucial factor for effective phage therapy, underscores its potential in minimizing the timeframe for the development of host resistance [54, 55].

In vivo assessment of SAM-E.f 12 phage therapy in a mouse wound model demonstrates accelerated wound healing, bringing recovery rates closer to healthy controls. This aligns with previous studies showcasing the efficacy of phage therapy in various animal models and bacterial infections [56, 57]. Histopathological evaluation reveals distinctive tissue responses, with the phage-treated group displaying a more controlled tissue response, increased capillaries, and improved hair follicles. These findings suggest that SAM-E.f 12 contributes to a regulated and efficient wound healing process, showcasing potential benefits for tissue repair and infection control [39, 58].

Conclusion

In conclusion, the multifaceted exploration of SAM-E.f 12’s characteristics positions it as a promising candidate for phage therapy against antibiotic-resistant E. faecalis infections. Its distinct genomic makeup, targeted lytic activity, and adaptive environmental features underscore its potential significance in addressing challenges posed by antibiotic-resistant strains and persistent infections. Further research, especially in in vivo settings and clinical trials, will be pivotal in substantiating its therapeutic efficacy and expanding its application in real-world scenarios.

Acknowledgments

We extend our sincere thanks to Dr. Ms. Fatemeh Ashrafi at Resalat Hospital, Tehran, for her crucial support, Dr. Abozar Ghorbani for his collaboration in bioinformatics, and the Pasteur Institute of Iran for providing laboratory facilities. Their contributions have been invaluable to our study.

Data Availability

The genom sequence are availble in the NCBI database (accession number: OR762047).

Funding Statement

The author(s) received no specific funding for this work.

References

1.Garsin DA, Sifri CD, Mylonakis E, Qin X, Singh KV, Murray BE, et al. A Simple Model Host for Identifying Gram-Positive Virulence Factors. Proceedings of the National Academy of Sciences. 2001. doi: 10.1073/pnas.191378698 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.McBrayer DN, Gantman BK, Tal-Gan Y. N-Methylation of Amino Acids in Gelatinase Biosynthesis-Activating Pheromone Identifies Key Site for Stability Enhancement with Retention of the Enterococcus faecalis fsr Quorum Sensing Circuit Response. ACS Infect Dis. 2019;5(6):1035–41. Epub 20190419. doi: 10.1021/acsinfecdis.9b00097 . [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Elsayed MA. Occurrence of Multi-Drug Resistant Bacteria in Some Selected Street Food Samples. Journal of Pharmaceutical Research International. 2019. doi: 10.9734/jpri/2019/v31i130288 [DOI] [Google Scholar]
4.Dozmorov MG, Kyker KD, Saban R, Shankar N, Baghdayan AS, Centola M, et al. Systems Biology Approach for Mapping the Response of Human Urothelial Cells to Infection by Enterococcus Faecalis. BMC Bioinformatics. 2007. doi: 10.1186/1471-2105-8-S7-S2 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Calonico C, Pesavento G, Delfino V, Forni S, Nostro AL. Prevalence of Antibiotic Resistance in Enterococci: A 14 Year Survey. Journal of Food and Nutrition Research. 2018. doi: 10.12691/jfnr-6-10-3 [DOI] [Google Scholar]
6.Moy TI, Ball AR, Anklesaria Z, Casadei G, Lewis K, Ausubel FM. Identification of novel antimicrobials using a live-animal infection model. Proc Natl Acad Sci U S A. 2006;103(27):10414–9. Epub 20060626. doi: 10.1073/pnas.0604055103 . [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Kumar S, Devi S, Sood SK, Kapila S, Narayan KS, Shandilya S. Antibiotic resistance and virulence genes in nisin-resistant Enterococcus faecalis isolated from raw buffalo milk modulate the innate functions of rat macrophages. J Appl Microbiol. 2019;127(3):897–910. Epub 20190626. doi: 10.1111/jam.14343 . [DOI] [PubMed] [Google Scholar]
8.Huang L, Guo W, Lu J, Pan W, Song F, Wang P. Enterococcus faecalis Bacteriophage vB_EfaS_efap05-1 Targets the Surface Polysaccharide and ComEA Protein as the Receptors. Front Microbiol. 2022;13:866382. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Rajendiran S, Veloo Y, Thahir SSA, Shaharudin R. Resistance towards critically important antimicrobials among Enterococcus faecalis and E. faecium in poultry farm environments in Selangor, Malaysia. Antibiotics. 2022;11(8):1118. doi: 10.3390/antibiotics11081118 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Smout E, Palanisamy N, Valappil SP. Prevalence of vancomycin-resistant Enterococci in India between 2000 and 2022: a systematic review and meta-analysis. Antimicrobial Resistance & Infection Control. 2023;12(1):79. doi: 10.1186/s13756-023-01287-z [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Mwikuma G, Kainga H, Kallu SA, Nakajima C, Suzuki Y, Hang’ombe BM. Determination of the prevalence and antimicrobial resistance of Enterococcus faecalis and Enterococcus faecium associated with poultry in four districts in Zambia. Antibiotics. 2023;12(4):657. doi: 10.3390/antibiotics12040657 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Khalifa L, Brosh Y, Gelman D, Coppenhagen-Glazer S, Beyth S, Poradosu-Cohen R, et al. Targeting Enterococcus faecalis biofilms with phage therapy. Appl Environ Microbiol. 2015;81(8):2696–705. Epub 20150206. doi: 10.1128/AEM.00096-15 . [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Xiang Y, Song F, Li H, Ji X. Phage therapy: A renewed approach against oral diseases caused by Enterococcus faecalis infections. Microb Pathog. 2024:106574. doi: 10.1016/j.micpath.2024.106574 [DOI] [PubMed] [Google Scholar]
14.Guo W, Song F, Sheng J, Tan J, Xie H, Wang X. Characterization of an Enterococcus faecalis bacteriophage SFQ1 as a potential therapeutic agent. Front Microbiol. 14:1210319. doi: 10.3389/fmicb.2023.1210319 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Al-Zubidi M, Widziolek M, Court E, Gains A, Smith R, Ansbro K, et al. Identification of novel bacteriophages with therapeutic potential that target Enterococcus faecalis. Infection and immunity. 2019;87(11): doi: 10.1128/IAI.00512-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Cheng M, Liang J, Zhang Y, Hu L, Gong P, Cai R, et al. The Bacteriophage EF-P29 Efficiently Protects against Lethal Vancomycin-Resistant Enterococcus faecalis and Alleviates Gut Microbiota Imbalance in a Murine Bacteremia Model. Front Microbiol. 2017;8:837. Epub 20170509. doi: 10.3389/fmicb.2017.00837 . [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Yang D, Chen Y, Sun E, Hua L, Peng Z, Wu B. Characterization of a Lytic Bacteriophage vB_EfaS_PHB08 Harboring Endolysin Lys08 Against Enterococcus faecalis Biofilms. Microorganisms. 2020;8(9):1332. Epub 20200831. doi: 10.3390/microorganisms8091332 . [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Goodarzi F, Hallajzadeh M, Sholeh M, Talebi M, Mahabadi VP, Amirmozafari N. Biological characteristics and anti-biofilm activity of a lytic phage against vancomycin-resistant Enterococcus faecium. Iran J Microbiol. 2021;13(5):691–702. doi: 10.18502/ijm.v13i5.7436 . [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Song M, Wu D, Hu Y, Luo H, Li G. Characterization of an Enterococcus faecalis Bacteriophage vB_EfaM_LG1 and Its Synergistic Effect With Antibiotic. Front Cell Infect Microbiol. 2021;11:698807. Epub 20210716. doi: 10.3389/fcimb.2021.698807 . [DOI] [PMC free article] [PubMed] [Google Scholar]
20.El-Telbany M, El-Didamony G, Askora A, Ariny E, Abdallah D, Connerton IF, et al. Bacteriophages to Control Multi-Drug Resistant Enterococcus faecalis Infection of Dental Root Canals. Microorganisms. 2021;9(3):517. Epub 20210303. doi: 10.3390/microorganisms9030517 . [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Goodarzi F, Hallajzadeh M, Sholeh M, Talebi M, Pirhajati Mahabadi V, Amirmozafari N. Anti-biofilm Activity of a Lytic Phage Against Vancomycin-Resistant Enterococcus faecalis. Iran J Pathol. 2022;17(3):285–93. Epub 20220812. doi: 10.30699/IJP.2022.541855.2760 . [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Alduhaidhawi AHM, AlHuchaimi SN, Al-Mayah TA, Al-Ouqaili MTS, Alkafaas SS, Muthupandian S, et al. Prevalence of CRISPR-Cas Systems and Their Possible Association with Antibiotic Resistance in Enterococcus faecalis and Enterococcus faecium Collected from Hospital Wastewater. Infect Drug Resist. 2022;15:1143–54. Epub 20220319. doi: 10.2147/IDR.S358248 . [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Gygli SM, Keller PM, Ballif M, Blochliger N, Homke R, Reinhard M, et al. Whole-Genome Sequencing for Drug Resistance Profile Prediction in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2019;63(4): Epub 20190327. doi: 10.1128/AAC.02175-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Bosworth A, Robson J, Lawrence B, Casey AL, Fair A, Khanam S, et al. Deployment of whole genome next-generation sequencing of SARS-CoV-2 in a military maritime setting. BMJ Mil Health. 2023. Epub 20230209. doi: 10.1136/military-2022-002296 . [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012;6(8):1621–4. Epub 20120308. doi: 10.1038/ismej.2012.8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Rossen JWA, Dombrecht J, Vanfleteren D, De Bruyne K, van Belkum A, Rosema S, et al. Epidemiological Typing of Serratia marcescens Isolates by Whole-Genome Multilocus Sequence Typing. J Clin Microbiol. 2019;57(4): Epub 20190328. doi: 10.1128/JCM.01652-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Misu M, Yoshikawa T, Sugimoto S, Takamatsu Y, Kurosu T, Ouji Y, et al. Rapid whole genome sequencing methods for RNA viruses. Front Microbiol. 2023;14:1137086. Epub 20230223. doi: 10.3389/fmicb.2023.1137086 . [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Proctor LM, Okubo A, Fuhrman JA. Calibrating estimates of phage-induced mortality in marine bacteria: Ultrastructural studies of marine bacteriophage development from one-step growth experiments. Microb Ecol. 1993;25(2):161–82. doi: 10.1007/BF00177193 . [DOI] [PubMed] [Google Scholar]
29.Lima FEdS, Batista HBR, Campos FS, Kunert Filho HC, Cibulski S, Finoketti F, et al. The constitutive expression of the V gene of Parainfluenza virus 5 affects the growth properties of bovine herpesvirus 5. Brazilian Archives of Biology and Technology. 2014;57:45–7. [Google Scholar]
30.Abedon ST. Phage therapy dosing: The problem(s) with multiplicity of infection (MOI). Bacteriophage. 2016;6(3):e1220348. Epub 20160811. doi: 10.1080/21597081.2016.1220348 . [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Duyvejonck H, Merabishvili M, Vaneechoutte M, de Soir S, Wright R, Friman VP, et al. Evaluation of the Stability of Bacteriophages in Different Solutions Suitable for the Production of Magistral Preparations in Belgium. Viruses. 2021;13(5):865. Epub 20210508. doi: 10.3390/v13050865 . [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Vashisth M, Jaglan AB, Yashveer S, Sharma P, Bardajatya P, Virmani N, et al. Development and Evaluation of Bacteriophage Cocktail to Eradicate Biofilms Formed by an Extensively Drug-Resistant (XDR) Pseudomonas aeruginosa. Viruses. 2023;15(2):427. Epub 20230202. doi: 10.3390/v15020427 . [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Sasikala D, Srinivasan P. Characterization of potential lytic bacteriophage against Vibrio alginolyticus and its therapeutic implications on biofilm dispersal. Microb Pathog. 2016;101:24–35. Epub 20161026. doi: 10.1016/j.micpath.2016.10.017 . [DOI] [PubMed] [Google Scholar]
34.Horiuchi T, Sakka M, Hayashi A, Shimada T, Kimura T, Sakka K. Complete genome sequence of bacteriophage BC-611 specifically infecting Enterococcus faecalis strain NP-10011. Am Soc Microbiol; 2012. doi: 10.1128/JVI.01424-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Khalaf AA, Hassanen EI, Zaki AR, Tohamy AF, Ibrahim MA. Histopathological, immunohistochemical, and molecular studies for determination of wound age and vitality in rats. Int Wound J. 2019;16(6):1416–25. Epub 20190825. doi: 10.1111/iwj.13206 . [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Mohammadi M, Mirabadi M, Beig M, Nasereslami S, Yazdanmehr M, Monfared FN. The role of nanotechnology in overcoming barriers to phage therapy: an overview. Future Virology. 2023;18(6):387–98. doi: 10.2217/fvl-2022-0229 [DOI] [Google Scholar]
37.Spížek J, Novotná J, Řezanka T, Demain AL. Do we need new antibiotics? The search for new targets and new compounds. J Ind Microbiol Biotechnol. 2010;37(12):1241–8. doi: 10.1007/s10295-010-0849-8 [DOI] [PubMed] [Google Scholar]
38.Zhang J, Kobert K, Flouri T, Stamatakis A. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics. 2014;30(5):614–20. Epub 20131018. doi: 10.1093/bioinformatics/btt593 . [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Seth AK, Nguyen KT, Geringer MR, Hong SJ, Leung KP, Mustoe TA, et al. Noncontact, low-frequency ultrasound as an effective therapy against Pseudomonas aeruginosa-infected biofilm wounds. Wound Repair Regen. 2013;21(2):266–74. Epub 20130219. doi: 10.1111/wrr.12000 . [DOI] [PubMed] [Google Scholar]
40.Horiuchi T, Sakka M, Hayashi A, Shimada T, Kimura T, Sakka K. Complete genome sequence of bacteriophage BC-611 specifically infecting Enterococcus faecalis strain NP-10011. J Virol. 2012;86(17):9538–9. doi: 10.1128/JVI.01424-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Kwan T, Liu J, DuBow M, Gros P, Pelletier J. The complete genomes and proteomes of 27 Staphylococcus aureus bacteriophages. Proc Natl Acad Sci U S A. 2005;102(14):5174–9. Epub 20050323. doi: 10.1073/pnas.0501140102 . [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Oechslin F, Zhu X, Dion MB, Shi R, Moineau S. Phage endolysins are adapted to specific hosts and are evolutionarily dynamic. PLoS Biol. 2022;20(8):e3001740. Epub 20220801. doi: 10.1371/journal.pbio.3001740 . [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Zhai Z, Zhang Z, Zhao G, Liu X, Qin F, Zhao Y. Genomic Characterization of Two Novel RCA Phages Reveals New Insights into the Diversity and Evolution of Marine Viruses. Microbiol Spectr. 2021;9(2):e0123921. Epub 20211020. doi: 10.1128/Spectrum.01239-21 . [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Song JY, Hwang IS, Eom JS, Cheong HJ, Bae WK, Park YH, et al. Prevalence and molecular epidemiology of vancomycin-resistant enterococci (VRE) strains isolated from animals and humans in Korea. Korean J Intern Med. 2005;20(1):55–62. doi: 10.3904/kjim.2005.20.1.55 . [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Lee WG, Park IJ, Jin HY, Park MH. Relapse and reacquisition of rectal colonization by vancomycin-resistant Enterococcus faecium after decolonization. Epidemiol Infect. 2010;138(10):1449–53. Epub 20100129. doi: 10.1017/S0950268810000038 . [DOI] [PubMed] [Google Scholar]
46.Pires DP, Dotsch A, Anderson EM, Hao Y, Khursigara CM, Lam JS, et al. A Genotypic Analysis of Five P. aeruginosa Strains after Biofilm Infection by Phages Targeting Different Cell Surface Receptors. Front Microbiol. 2017;8:1229. Epub 20170630. doi: 10.3389/fmicb.2017.01229 . [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Barr JJ, Auro R, Sam-Soon N, Kassegne S, Peters G, Bonilla N, et al. Subdiffusive motion of bacteriophage in mucosal surfaces increases the frequency of bacterial encounters. Proc Natl Acad Sci U S A. 2015;112(44):13675–80. Epub 20151019. doi: 10.1073/pnas.1508355112 . [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Tan CH, Jiang L, Li W, Chan SH, Baek JS, Ng NKJ, et al. Lipid-Polymer Hybrid Nanoparticles Enhance the Potency of Ampicillin against Enterococcus faecalis in a Protozoa Infection Model. ACS Infect Dis. 2021;7(6):1607–18. Epub 20210419. doi: 10.1021/acsinfecdis.0c00774 . [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Chi D, Zhang Y, Lin X, Gong Q, Tong Z. Caspase-1 Inhibition Reduces Occurrence of PANoptosis in Macrophages Infected by E. faecalis OG1RF. J Clin Med. 2022;11(20). Epub 20221021. doi: 10.3390/jcm11206204 . [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Simon-Baram H, Kleiner D, Shmulevich F, Zarivach R, Zalk R, Tang H, et al. SAMase of Bacteriophage T3 Inactivates Escherichia coli’s Methionine S-Adenosyltransferase by Forming Heteropolymers. mBio. 2021;12(4):e0124221. Epub 20210803. doi: 10.1128/mBio.01242-21 . [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Abd-Allah IM, El-Housseiny GS, Alshahrani MY, El-Masry SS, Aboshanab KM, Hassouna NA. An Anti-MRSA Phage From Raw Fish Rinse: Stability Evaluation and Production Optimization. Front Cell Infect Microbiol. 2022;12:904531. Epub 20220517. doi: 10.3389/fcimb.2022.904531 . [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Sharma M, Kumar D, Poluri KM. Elucidating the pH-Dependent Structural Transition of T7 Bacteriophage Endolysin. Biochemistry. 2016;55(33):4614–25. Epub 20160811. doi: 10.1021/acs.biochem.6b00240 . [DOI] [PubMed] [Google Scholar]
53.Kumar P, Meghvansi MK, Kamboj DV. Phenotypic Characterization and Whole-Genome Analysis of a Novel Bacteriophage HCF1 Infecting Citrobacter amalonaticus and C. freundii. Front Microbiol. 2021;12:644013. Epub 20210125. doi: 10.3389/fmicb.2021.644013 . [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Abedon ST. Bacteriophage Adsorption: Likelihood of Virion Encounter with Bacteria and Other Factors Affecting Rates. Antibiotics (Basel). 2023;12(4). Epub 20230407. doi: 10.3390/antibiotics12040723 . [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Dabrowska K, Abedon ST. Pharmacologically Aware Phage Therapy: Pharmacodynamic and Pharmacokinetic Obstacles to Phage Antibacterial Action in Animal and Human Bodies. Microbiol Mol Biol Rev. 2019;83(4). Epub 20191030. doi: 10.1128/MMBR.00012-19 . [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Arumugam SN, Manohar P, Sukumaran S, Sadagopan S, Loh B, Leptihn S, et al. Antibacterial efficacy of lytic phages against multidrug-resistant Pseudomonas aeruginosa infections in bacteraemia mice models. BMC Microbiol. 2022;22(1):187. Epub 20220801. doi: 10.1186/s12866-022-02603-0 . [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Kifelew LG, Warner MS, Morales S, Vaughan L, Woodman R, Fitridge R, et al. Efficacy of phage cocktail AB-SA01 therapy in diabetic mouse wound infections caused by multidrug-resistant Staphylococcus aureus. BMC Microbiol. 2020;20(1):204. Epub 20200709. doi: 10.1186/s12866-020-01891-8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Mendes JJ, Leandro C, Corte-Real S, Barbosa R, Cavaco-Silva P, Melo-Cristino J, et al. Wound healing potential of topical bacteriophage therapy on diabetic cutaneous wounds. Wound Repair Regen. 2013;21(4):595–603. Epub 20130611. doi: 10.1111/wrr.12056 . [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0301292.r001

Decision Letter 0

Vinod Kumar Yata

21 Feb 2024

PONE-D-24-03766Insights into the Novel Enterococcus faecalis Phage: A Comprehensive Genome AnalysisPLOS ONE

Dear Dr. Shafiei,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 06 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Vinod Kumar Yata, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

3. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

The manuscript titled "Insights into the Novel Enterococcus faecalis Phage: A Comprehensive Genome Analysis" lays a robust foundation for a promising investigation into phage therapy against antibiotic-resistant E. faecalis.

Authors are requested to adhere to the "manuscript body formatting guidelines," with a specific emphasis on modifying the abstract in accordance with the provided guidelines. It is essential to ensure that the revised abstract aligns appropriately with the specified formatting requirements.

Authors are kindly urged to resubmit the manuscript after addressing the reviewers' comments. We appreciate your cooperation and anticipate the revised submission to meet the specified formatting guidelines and further enhance the overall quality of the manuscript.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The overall work is good. Methods and materials results and discussions are represented clearly.

I encourage the authors to revise their manuscript and to resubmit it to the journal. This work is technically sound and isolation of phages is very difficult but isolation and charectarisation do it perfectly.

Reviewer #2: The research article “Insights into the Novel Enterococcus faecalis Phage: A Comprehensive Genome Analysis” by Abed et al., provides important insights on the bacteriophage SAM-E.f 12 genomic potentials. The abstract is well written however the introduction is poorly cited and the research question and context on importance of bacterial comparative genomics needs to be established. With the minor modifications I believe the manuscript can be accepted for publication in Plos One.

The specific comments are as follows.

1. Line 48: enlist the class of antibiotics bacteria E. faecalis known for with appropriate citations.

2. Line 49-51: Citation needed.

3. Methods results are well written and represented.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: DSC

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: minor revision.docx

pone.0301292.s001.docx^{(13.2KB, docx)}

PLoS One. 2024 May 14;19(5):e0301292. doi: 10.1371/journal.pone.0301292.r002

Author response to Decision Letter 0

8 Mar 2024

Reviewer #1: The overall work is good. Methods and materials results and discussions are represented clearly.

Response to reviewer 1:

Thank you for your encouraging feedback and constructive comments on our manuscript. We are heartened by your recognition of the clarity of our methods, materials, results, and discussions, as well as your acknowledgment of the technical soundness of our work and the successful isolation and characterization of phages.

We will take your encouragement to revise and resubmit our manuscript as an opportunity to further refine our work. We appreciate the support and guidance provided by your feedback, which we believe will enhance the overall quality and impact of our study.

Sincerely,

Reviewer #2:

The research article “Insights into the Novel Enterococcus faecalis Phage: A Comprehensive Genome Analysis” by Abed et al., provides important insights on the bacteriophage SAM-E.f 12 genomic potentials. The abstract is well written however the introduction is poorly cited and the research question and context on importance of bacterial comparative genomics needs to be established. With the minor modifications I believe the manuscript can be accepted for publication in Plos One.

Response to reviewer: We have revised the introduction section according your suggestions.

The specific comments are as follows.

1. Line 48: enlist the class of antibiotics bacteria E. faecalis known for with appropriate citations.

We have updated Line 46-55 to include a list of the classes of antibiotics that Enterococcus faecalis is known to resist, accompanied by appropriate citations to ensure comprehensive support for our statements.

2. Line 49-51: Citation needed.

In all introduction section we have now incorporated the necessary citations to fully reference the background information provided in this section, thereby strengthening the manuscript's credibility and scholarly depth.

3. Methods results are well written and represented.

We are pleased to hear your positive feedback on the methods and results sections. We believe that the clarity and representation of these sections contribute significantly to the overall quality of our research.

We are confident that these revisions address your concerns and enhance the manuscript's suitability for publication in Plos One. We look forward to the possibility of our work being accepted and thank you again for your valuable insights.

Sincerely,

Reviewer #3:

Reviewer comment 1: The overall work is good. Methods and materials results and discussions are represented clearly.

Dear Reviewer,

Thank you for your positive feedback and constructive comments regarding our manuscript. We are grateful for the encouragement to revise and resubmit our work, and we have meticulously addressed the specific concerns you raised to enhance the clarity and impact of our study. Below, we detail our responses and the amendments made to the manuscript in accordance with your suggestions.

Reviewer comment 2: I encourage the authors to revise their manuscript and to resubmit it to the journal.

Give the explanation regarding the following comments:

• In discussion part please mention supporting results of previous study.

Response to reviewer: In response to your request for the inclusion of supporting results from previous studies in our discussion, we have meticulously revised the discussion section to incorporate more substantial evidence and references to prior research. Specifically, we have enriched lines 402-408 and lines 417-425 with additional details, now presented as follows:

“We acknowledge the pivotal role of previous studies in laying the groundwork for our research on bacteriophage therapy as a viable alternative to traditional antibiotics. These studies have demonstrated the effectiveness of bacteriophages in not only targeting E. faecalis but also in providing a basis for their application in treating various antibiotic-resistant bacterial infections [27, 28]. The selection of E. faecalis as our primary focus was driven by its alarming resistance to a wide array of antibiotics, including vancomycin, and its significant impact on healthcare systems worldwide.”

“The bacteriophage SAM-E.f 12 demonstrated remarkable effectiveness against select isolates of clinical E. faecalis, evidenced by the formation of clear plaques in 70% of the 60 strains tested in the spot assay. This notable specificity, underscored by the lack of lytic activity against E. faecium, highlights SAM-E.f 12's targeted action, especially against vancomycin-resistant E. faecalis strains. Such specificity is crucial for addressing the growing challenge of antibiotic resistance and aligns with the findings of previous research, which have documented the efficacy of specific phages in selectively targeting E. faecalis. This alignment not only corroborates SAM-E.f 12's potential in phage therapy but also reinforces the importance of phage specificity in the development of targeted antibacterial treatments [35, 36].”

Reviewer comment 3:

• Why you only choose Enterobacter faecalis instead of E. coli? Is there any special characteristics having Enterobacter faecalis? Explain clearly in discussion part.

Response to Reviewer Comment 3:

To clarify our rationale for selecting Enterococcus faecalis over E. coli, we have thoroughly revised the initial part of the discussion section, specifically lines 383-393, to elucidate our objectives and decision-making process. The revised passage now reads:

“E. faecalis, a Gram-positive bacterium, poses a formidable challenge in clinical settings due to its intrinsic resistance to a broad spectrum of antibiotics, including those vital for combatting bacterial infections [1, 2, 25]. This resistance has prompted its inclusion in the World Health Organization's priority pathogen list [26]. This resistance has not only placed E. faecalis on the World Health Organization's priority pathogen list but also highlighted the critical need for innovative therapeutic strategies to combat such resilient bacterial strains. Particularly noteworthy is E. faecalis's resistance to antibiotics like vancomycin, accentuating the exigency to explore alternative treatment modalities [27]. Phage therapy, characterized by a targeted approach, emerges as an advantageous strategy, especially in combating antibiotic-resistant E. faecalis strains, aligning with broader efforts to address antibiotic resistance through innovative antimicrobial exploration [27, 28].”

The overall paper is good. I strongly agree this work as a publication.

Closing Remarks:

We sincerely thank you for your positivity and constructive comments. We believe that these revisions have significantly strengthened our manuscript, making a compelling case for the publication of our work. We look forward to the possibility of our revised manuscript being favorably considered for publication.

Warm regards

Attachment

Submitted filename: Respond to reviewers.docx

pone.0301292.s002.docx^{(30.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0301292.r003

Decision Letter 1

Vinod Kumar Yata

14 Mar 2024

Insights into the Novel Enterococcus faecalis Phage: A Comprehensive Genome Analysis

PONE-D-24-03766R1

Dear Dr. Shafiei,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at http://www.editorialmanager.com/pone/ and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Vinod Kumar Yata, PhD

Academic Editor

PLOS ONE

PLoS One. doi: 10.1371/journal.pone.0301292.r004

Acceptance letter

Vinod Kumar Yata

25 Apr 2024

PONE-D-24-03766R1

PLOS ONE

Dear Dr. Shafiei,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Vinod Kumar Yata

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Attachment

Submitted filename: minor revision.docx

pone.0301292.s001.docx^{(13.2KB, docx)}

Attachment

Submitted filename: Respond to reviewers.docx

pone.0301292.s002.docx^{(30.5KB, docx)}

Data Availability Statement

The genom sequence are availble in the NCBI database (accession number: OR762047).

[pone.0301292.ref001] 1.Garsin DA, Sifri CD, Mylonakis E, Qin X, Singh KV, Murray BE, et al. A Simple Model Host for Identifying Gram-Positive Virulence Factors. Proceedings of the National Academy of Sciences. 2001. doi: 10.1073/pnas.191378698 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref002] 2.McBrayer DN, Gantman BK, Tal-Gan Y. N-Methylation of Amino Acids in Gelatinase Biosynthesis-Activating Pheromone Identifies Key Site for Stability Enhancement with Retention of the Enterococcus faecalis fsr Quorum Sensing Circuit Response. ACS Infect Dis. 2019;5(6):1035–41. Epub 20190419. doi: 10.1021/acsinfecdis.9b00097 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref003] 3.Elsayed MA. Occurrence of Multi-Drug Resistant Bacteria in Some Selected Street Food Samples. Journal of Pharmaceutical Research International. 2019. doi: 10.9734/jpri/2019/v31i130288 [DOI] [Google Scholar]

[pone.0301292.ref004] 4.Dozmorov MG, Kyker KD, Saban R, Shankar N, Baghdayan AS, Centola M, et al. Systems Biology Approach for Mapping the Response of Human Urothelial Cells to Infection by Enterococcus Faecalis. BMC Bioinformatics. 2007. doi: 10.1186/1471-2105-8-S7-S2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref005] 5.Calonico C, Pesavento G, Delfino V, Forni S, Nostro AL. Prevalence of Antibiotic Resistance in Enterococci: A 14 Year Survey. Journal of Food and Nutrition Research. 2018. doi: 10.12691/jfnr-6-10-3 [DOI] [Google Scholar]

[pone.0301292.ref006] 6.Moy TI, Ball AR, Anklesaria Z, Casadei G, Lewis K, Ausubel FM. Identification of novel antimicrobials using a live-animal infection model. Proc Natl Acad Sci U S A. 2006;103(27):10414–9. Epub 20060626. doi: 10.1073/pnas.0604055103 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref007] 7.Kumar S, Devi S, Sood SK, Kapila S, Narayan KS, Shandilya S. Antibiotic resistance and virulence genes in nisin-resistant Enterococcus faecalis isolated from raw buffalo milk modulate the innate functions of rat macrophages. J Appl Microbiol. 2019;127(3):897–910. Epub 20190626. doi: 10.1111/jam.14343 . [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref008] 8.Huang L, Guo W, Lu J, Pan W, Song F, Wang P. Enterococcus faecalis Bacteriophage vB_EfaS_efap05-1 Targets the Surface Polysaccharide and ComEA Protein as the Receptors. Front Microbiol. 2022;13:866382. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref009] 9.Rajendiran S, Veloo Y, Thahir SSA, Shaharudin R. Resistance towards critically important antimicrobials among Enterococcus faecalis and E. faecium in poultry farm environments in Selangor, Malaysia. Antibiotics. 2022;11(8):1118. doi: 10.3390/antibiotics11081118 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref010] 10.Smout E, Palanisamy N, Valappil SP. Prevalence of vancomycin-resistant Enterococci in India between 2000 and 2022: a systematic review and meta-analysis. Antimicrobial Resistance & Infection Control. 2023;12(1):79. doi: 10.1186/s13756-023-01287-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref011] 11.Mwikuma G, Kainga H, Kallu SA, Nakajima C, Suzuki Y, Hang’ombe BM. Determination of the prevalence and antimicrobial resistance of Enterococcus faecalis and Enterococcus faecium associated with poultry in four districts in Zambia. Antibiotics. 2023;12(4):657. doi: 10.3390/antibiotics12040657 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref012] 12.Khalifa L, Brosh Y, Gelman D, Coppenhagen-Glazer S, Beyth S, Poradosu-Cohen R, et al. Targeting Enterococcus faecalis biofilms with phage therapy. Appl Environ Microbiol. 2015;81(8):2696–705. Epub 20150206. doi: 10.1128/AEM.00096-15 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref013] 13.Xiang Y, Song F, Li H, Ji X. Phage therapy: A renewed approach against oral diseases caused by Enterococcus faecalis infections. Microb Pathog. 2024:106574. doi: 10.1016/j.micpath.2024.106574 [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref014] 14.Guo W, Song F, Sheng J, Tan J, Xie H, Wang X. Characterization of an Enterococcus faecalis bacteriophage SFQ1 as a potential therapeutic agent. Front Microbiol. 14:1210319. doi: 10.3389/fmicb.2023.1210319 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref015] 15.Al-Zubidi M, Widziolek M, Court E, Gains A, Smith R, Ansbro K, et al. Identification of novel bacteriophages with therapeutic potential that target Enterococcus faecalis. Infection and immunity. 2019;87(11): doi: 10.1128/IAI.00512-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref016] 16.Cheng M, Liang J, Zhang Y, Hu L, Gong P, Cai R, et al. The Bacteriophage EF-P29 Efficiently Protects against Lethal Vancomycin-Resistant Enterococcus faecalis and Alleviates Gut Microbiota Imbalance in a Murine Bacteremia Model. Front Microbiol. 2017;8:837. Epub 20170509. doi: 10.3389/fmicb.2017.00837 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref017] 17.Yang D, Chen Y, Sun E, Hua L, Peng Z, Wu B. Characterization of a Lytic Bacteriophage vB_EfaS_PHB08 Harboring Endolysin Lys08 Against Enterococcus faecalis Biofilms. Microorganisms. 2020;8(9):1332. Epub 20200831. doi: 10.3390/microorganisms8091332 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref018] 18.Goodarzi F, Hallajzadeh M, Sholeh M, Talebi M, Mahabadi VP, Amirmozafari N. Biological characteristics and anti-biofilm activity of a lytic phage against vancomycin-resistant Enterococcus faecium. Iran J Microbiol. 2021;13(5):691–702. doi: 10.18502/ijm.v13i5.7436 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref019] 19.Song M, Wu D, Hu Y, Luo H, Li G. Characterization of an Enterococcus faecalis Bacteriophage vB_EfaM_LG1 and Its Synergistic Effect With Antibiotic. Front Cell Infect Microbiol. 2021;11:698807. Epub 20210716. doi: 10.3389/fcimb.2021.698807 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref020] 20.El-Telbany M, El-Didamony G, Askora A, Ariny E, Abdallah D, Connerton IF, et al. Bacteriophages to Control Multi-Drug Resistant Enterococcus faecalis Infection of Dental Root Canals. Microorganisms. 2021;9(3):517. Epub 20210303. doi: 10.3390/microorganisms9030517 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref021] 21.Goodarzi F, Hallajzadeh M, Sholeh M, Talebi M, Pirhajati Mahabadi V, Amirmozafari N. Anti-biofilm Activity of a Lytic Phage Against Vancomycin-Resistant Enterococcus faecalis. Iran J Pathol. 2022;17(3):285–93. Epub 20220812. doi: 10.30699/IJP.2022.541855.2760 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref022] 22.Alduhaidhawi AHM, AlHuchaimi SN, Al-Mayah TA, Al-Ouqaili MTS, Alkafaas SS, Muthupandian S, et al. Prevalence of CRISPR-Cas Systems and Their Possible Association with Antibiotic Resistance in Enterococcus faecalis and Enterococcus faecium Collected from Hospital Wastewater. Infect Drug Resist. 2022;15:1143–54. Epub 20220319. doi: 10.2147/IDR.S358248 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref023] 23.Gygli SM, Keller PM, Ballif M, Blochliger N, Homke R, Reinhard M, et al. Whole-Genome Sequencing for Drug Resistance Profile Prediction in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2019;63(4): Epub 20190327. doi: 10.1128/AAC.02175-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref024] 24.Bosworth A, Robson J, Lawrence B, Casey AL, Fair A, Khanam S, et al. Deployment of whole genome next-generation sequencing of SARS-CoV-2 in a military maritime setting. BMJ Mil Health. 2023. Epub 20230209. doi: 10.1136/military-2022-002296 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref025] 25.Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012;6(8):1621–4. Epub 20120308. doi: 10.1038/ismej.2012.8 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref026] 26.Rossen JWA, Dombrecht J, Vanfleteren D, De Bruyne K, van Belkum A, Rosema S, et al. Epidemiological Typing of Serratia marcescens Isolates by Whole-Genome Multilocus Sequence Typing. J Clin Microbiol. 2019;57(4): Epub 20190328. doi: 10.1128/JCM.01652-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref027] 27.Misu M, Yoshikawa T, Sugimoto S, Takamatsu Y, Kurosu T, Ouji Y, et al. Rapid whole genome sequencing methods for RNA viruses. Front Microbiol. 2023;14:1137086. Epub 20230223. doi: 10.3389/fmicb.2023.1137086 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref028] 28.Proctor LM, Okubo A, Fuhrman JA. Calibrating estimates of phage-induced mortality in marine bacteria: Ultrastructural studies of marine bacteriophage development from one-step growth experiments. Microb Ecol. 1993;25(2):161–82. doi: 10.1007/BF00177193 . [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref029] 29.Lima FEdS, Batista HBR, Campos FS, Kunert Filho HC, Cibulski S, Finoketti F, et al. The constitutive expression of the V gene of Parainfluenza virus 5 affects the growth properties of bovine herpesvirus 5. Brazilian Archives of Biology and Technology. 2014;57:45–7. [Google Scholar]

[pone.0301292.ref030] 30.Abedon ST. Phage therapy dosing: The problem(s) with multiplicity of infection (MOI). Bacteriophage. 2016;6(3):e1220348. Epub 20160811. doi: 10.1080/21597081.2016.1220348 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref031] 31.Duyvejonck H, Merabishvili M, Vaneechoutte M, de Soir S, Wright R, Friman VP, et al. Evaluation of the Stability of Bacteriophages in Different Solutions Suitable for the Production of Magistral Preparations in Belgium. Viruses. 2021;13(5):865. Epub 20210508. doi: 10.3390/v13050865 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref032] 32.Vashisth M, Jaglan AB, Yashveer S, Sharma P, Bardajatya P, Virmani N, et al. Development and Evaluation of Bacteriophage Cocktail to Eradicate Biofilms Formed by an Extensively Drug-Resistant (XDR) Pseudomonas aeruginosa. Viruses. 2023;15(2):427. Epub 20230202. doi: 10.3390/v15020427 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref033] 33.Sasikala D, Srinivasan P. Characterization of potential lytic bacteriophage against Vibrio alginolyticus and its therapeutic implications on biofilm dispersal. Microb Pathog. 2016;101:24–35. Epub 20161026. doi: 10.1016/j.micpath.2016.10.017 . [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref034] 34.Horiuchi T, Sakka M, Hayashi A, Shimada T, Kimura T, Sakka K. Complete genome sequence of bacteriophage BC-611 specifically infecting Enterococcus faecalis strain NP-10011. Am Soc Microbiol; 2012. doi: 10.1128/JVI.01424-12 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref035] 35.Khalaf AA, Hassanen EI, Zaki AR, Tohamy AF, Ibrahim MA. Histopathological, immunohistochemical, and molecular studies for determination of wound age and vitality in rats. Int Wound J. 2019;16(6):1416–25. Epub 20190825. doi: 10.1111/iwj.13206 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref036] 36.Mohammadi M, Mirabadi M, Beig M, Nasereslami S, Yazdanmehr M, Monfared FN. The role of nanotechnology in overcoming barriers to phage therapy: an overview. Future Virology. 2023;18(6):387–98. doi: 10.2217/fvl-2022-0229 [DOI] [Google Scholar]

[pone.0301292.ref037] 37.Spížek J, Novotná J, Řezanka T, Demain AL. Do we need new antibiotics? The search for new targets and new compounds. J Ind Microbiol Biotechnol. 2010;37(12):1241–8. doi: 10.1007/s10295-010-0849-8 [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref038] 38.Zhang J, Kobert K, Flouri T, Stamatakis A. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics. 2014;30(5):614–20. Epub 20131018. doi: 10.1093/bioinformatics/btt593 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref039] 39.Seth AK, Nguyen KT, Geringer MR, Hong SJ, Leung KP, Mustoe TA, et al. Noncontact, low-frequency ultrasound as an effective therapy against Pseudomonas aeruginosa-infected biofilm wounds. Wound Repair Regen. 2013;21(2):266–74. Epub 20130219. doi: 10.1111/wrr.12000 . [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref040] 40.Horiuchi T, Sakka M, Hayashi A, Shimada T, Kimura T, Sakka K. Complete genome sequence of bacteriophage BC-611 specifically infecting Enterococcus faecalis strain NP-10011. J Virol. 2012;86(17):9538–9. doi: 10.1128/JVI.01424-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref041] 41.Kwan T, Liu J, DuBow M, Gros P, Pelletier J. The complete genomes and proteomes of 27 Staphylococcus aureus bacteriophages. Proc Natl Acad Sci U S A. 2005;102(14):5174–9. Epub 20050323. doi: 10.1073/pnas.0501140102 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref042] 42.Oechslin F, Zhu X, Dion MB, Shi R, Moineau S. Phage endolysins are adapted to specific hosts and are evolutionarily dynamic. PLoS Biol. 2022;20(8):e3001740. Epub 20220801. doi: 10.1371/journal.pbio.3001740 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref043] 43.Zhai Z, Zhang Z, Zhao G, Liu X, Qin F, Zhao Y. Genomic Characterization of Two Novel RCA Phages Reveals New Insights into the Diversity and Evolution of Marine Viruses. Microbiol Spectr. 2021;9(2):e0123921. Epub 20211020. doi: 10.1128/Spectrum.01239-21 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref044] 44.Song JY, Hwang IS, Eom JS, Cheong HJ, Bae WK, Park YH, et al. Prevalence and molecular epidemiology of vancomycin-resistant enterococci (VRE) strains isolated from animals and humans in Korea. Korean J Intern Med. 2005;20(1):55–62. doi: 10.3904/kjim.2005.20.1.55 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref045] 45.Lee WG, Park IJ, Jin HY, Park MH. Relapse and reacquisition of rectal colonization by vancomycin-resistant Enterococcus faecium after decolonization. Epidemiol Infect. 2010;138(10):1449–53. Epub 20100129. doi: 10.1017/S0950268810000038 . [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref046] 46.Pires DP, Dotsch A, Anderson EM, Hao Y, Khursigara CM, Lam JS, et al. A Genotypic Analysis of Five P. aeruginosa Strains after Biofilm Infection by Phages Targeting Different Cell Surface Receptors. Front Microbiol. 2017;8:1229. Epub 20170630. doi: 10.3389/fmicb.2017.01229 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref047] 47.Barr JJ, Auro R, Sam-Soon N, Kassegne S, Peters G, Bonilla N, et al. Subdiffusive motion of bacteriophage in mucosal surfaces increases the frequency of bacterial encounters. Proc Natl Acad Sci U S A. 2015;112(44):13675–80. Epub 20151019. doi: 10.1073/pnas.1508355112 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref048] 48.Tan CH, Jiang L, Li W, Chan SH, Baek JS, Ng NKJ, et al. Lipid-Polymer Hybrid Nanoparticles Enhance the Potency of Ampicillin against Enterococcus faecalis in a Protozoa Infection Model. ACS Infect Dis. 2021;7(6):1607–18. Epub 20210419. doi: 10.1021/acsinfecdis.0c00774 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref049] 49.Chi D, Zhang Y, Lin X, Gong Q, Tong Z. Caspase-1 Inhibition Reduces Occurrence of PANoptosis in Macrophages Infected by E. faecalis OG1RF. J Clin Med. 2022;11(20). Epub 20221021. doi: 10.3390/jcm11206204 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref050] 50.Simon-Baram H, Kleiner D, Shmulevich F, Zarivach R, Zalk R, Tang H, et al. SAMase of Bacteriophage T3 Inactivates Escherichia coli’s Methionine S-Adenosyltransferase by Forming Heteropolymers. mBio. 2021;12(4):e0124221. Epub 20210803. doi: 10.1128/mBio.01242-21 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref051] 51.Abd-Allah IM, El-Housseiny GS, Alshahrani MY, El-Masry SS, Aboshanab KM, Hassouna NA. An Anti-MRSA Phage From Raw Fish Rinse: Stability Evaluation and Production Optimization. Front Cell Infect Microbiol. 2022;12:904531. Epub 20220517. doi: 10.3389/fcimb.2022.904531 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref052] 52.Sharma M, Kumar D, Poluri KM. Elucidating the pH-Dependent Structural Transition of T7 Bacteriophage Endolysin. Biochemistry. 2016;55(33):4614–25. Epub 20160811. doi: 10.1021/acs.biochem.6b00240 . [DOI] [PubMed] [Google Scholar]

[pone.0301292.ref053] 53.Kumar P, Meghvansi MK, Kamboj DV. Phenotypic Characterization and Whole-Genome Analysis of a Novel Bacteriophage HCF1 Infecting Citrobacter amalonaticus and C. freundii. Front Microbiol. 2021;12:644013. Epub 20210125. doi: 10.3389/fmicb.2021.644013 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref054] 54.Abedon ST. Bacteriophage Adsorption: Likelihood of Virion Encounter with Bacteria and Other Factors Affecting Rates. Antibiotics (Basel). 2023;12(4). Epub 20230407. doi: 10.3390/antibiotics12040723 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref055] 55.Dabrowska K, Abedon ST. Pharmacologically Aware Phage Therapy: Pharmacodynamic and Pharmacokinetic Obstacles to Phage Antibacterial Action in Animal and Human Bodies. Microbiol Mol Biol Rev. 2019;83(4). Epub 20191030. doi: 10.1128/MMBR.00012-19 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref056] 56.Arumugam SN, Manohar P, Sukumaran S, Sadagopan S, Loh B, Leptihn S, et al. Antibacterial efficacy of lytic phages against multidrug-resistant Pseudomonas aeruginosa infections in bacteraemia mice models. BMC Microbiol. 2022;22(1):187. Epub 20220801. doi: 10.1186/s12866-022-02603-0 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref057] 57.Kifelew LG, Warner MS, Morales S, Vaughan L, Woodman R, Fitridge R, et al. Efficacy of phage cocktail AB-SA01 therapy in diabetic mouse wound infections caused by multidrug-resistant Staphylococcus aureus. BMC Microbiol. 2020;20(1):204. Epub 20200709. doi: 10.1186/s12866-020-01891-8 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0301292.ref058] 58.Mendes JJ, Leandro C, Corte-Real S, Barbosa R, Cavaco-Silva P, Melo-Cristino J, et al. Wound healing potential of topical bacteriophage therapy on diabetic cutaneous wounds. Wound Repair Regen. 2013;21(4):595–603. Epub 20130611. doi: 10.1111/wrr.12056 . [DOI] [PubMed] [Google Scholar]

PERMALINK

Insights into the novel Enterococcus faecalis phage: A comprehensive genome analysis

Sahar Abed

Mohammad Sholeh

Mahshid Khazani Asforooshani

Morvarid Shafiei

Abdolrazagh Hashemi Shahraki

Shaghayegh Nasr

Roles

Abstract

Introduction

Method

Phage isolation procedure

Electron microscopy analysis

Whole genome sequencing and phage characterization

Phage characteristics

One-step growth experiment

Multiplicity of infection (MOI) determination

Host range determination

Absorption time assay

Environmental stability assay

Effect of phage disruption on biofilms

In vivo assay for phage efficiency

Histopathological analysis

Results

Isolation and multiplication of effective bacteriophage against e. faecalis

Fig 1. Morphology of SAM-E.f 12 phage.

WGS and bioinformatics analysis

Fig 2. Annotated genome map of SAM-E.f 12 bacteriophage.

Fig 3. Comparative analysis of phage genome alignment and AP heat map.

Host range determination

Investigation of phage characteristics and stability to environmental factors

Multiplicity of infection (MOI)

Fig 4. Phage characteristics and environmental stability.

One-step growth assays

Thermal stability

pH stability

Salt tolerance

Adsorption rate

Investigation of phage impact on biofilm disruption

In-vivo efficacy testing

Fig 5. Efficiency of phage therapy in E. faecalis-infected BALB/c mouse wounds.

Histopathological evaluation of wound healing outcomes in phage-treated

Table 1. Histopathological evaluation of tissue parameters in different experimental groups.

Fig 6.

Discussion

Conclusion

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Vinod Kumar Yata

Roles

Author response to Decision Letter 0

Decision Letter 1

Vinod Kumar Yata

Roles

Acceptance letter

Vinod Kumar Yata

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases