Abstract
Cotton (Gossypium barbadense L.) is a leading fiber and oilseed crop globally, but genetic diversity among breeding materials is often limited. This study analyzed genetic variability in 14 cotton genotypes from Egypt and other countries, including both cultivated varieties and wild types, using agro-morphological traits and genomic SSR markers. Field experiments were conducted over two seasons to evaluate 12 key traits related to plant growth, yield components, and fiber quality. Molecular diversity analysis utilized 10 SSR primers to generate DNA profiles. The Molecular diversity analysis utilized 10 SSR primers to generate DNA profiles. Data showed wide variation for the morphological traits, with Egyptian genotypes generally exhibiting higher means for vegetative growth and yield parameters. The top-performing genotypes for yield were Giza 96, Giza 94, and Big Black Boll genotypes, while Giza 96, Giza 92, and Giza 70 ranked highest for fiber length, strength, and fineness. In contrast, molecular profiles were highly polymorphic across all genotypes, including 82.5% polymorphic bands out of 212. Polymorphism information content was high for the SSR markers, ranging from 0.76 to 0.86. Genetic similarity coefficients based on the SSR data varied extensively from 0.58 to 0.91, and cluster analysis separated genotypes into two major groups according to geographical origin. The cotton genotypes displayed high diversity in morphology and genetics, indicating sufficient variability in the germplasm. The combined use of physical traits and molecular markers gave a thorough understanding of the genetic diversity and relationships between Egyptian and global cotton varieties. The SSR markers effectively profiled the genotypes and can help select ideal parents for enhancing cotton through hybridization and marker-assisted breeding.
Keywords: Cotton, Yield, Genetic diversity, SSR, DNA fingerprinting, Fiber traits
Introduction
Cotton (Gossypium L.) is an important economic and fiber crop grown annually in over eight countries including the USA, India, China, and Egypt. It provides over 95% of the raw natural fibers used in the textile industry and has value as a bioenergy and oilseed crop [1, 2]. Cotton belongs to the Gossypieae tribe in the Malvaceae family, comprising about 53 species including 46 diploids (2n = 2x = 26) and 7 allotetraploids (2n = 4x = 52) [1, 3]. The modern cotton cultivars are allotetraploid with 26 chromosomes (n = 2x = 26), evolved through hybridization and domestication of A1-genome diploids Gossypium herbaceum (n = x = 13) with indigenous D5-genome diploids G. raimondii, a new world cotton species [4, 5] [6, 7].
Importantly, over 97% of the global cotton fiber production comes from the two main cultivated allotetraploid species, G. hirsutum L. and G. barbadense L [8]. In addition, the genus Gossypium contains over 50 species (45 diploid and 5 allotetraploid) including the most widely grown G. hirsutum and G. barbadense. This has led to extensive phenotypic diversity in cotton crops across many geographic regions worldwide [9]. However, the Egyptian cotton (G. barbadense) known by its extra-long and staple fiber Pima cotton characteristics is a famous cotton source for textile industry worldwide due to its unique chemical composition properties.
Traditional cotton breeding methods aim to improve cotton quality and yield by identifying high-performing parent lines with desirable agronomic traits for crosses. However, these classical techniques have limitations. More advanced molecular breeding utilizing genetic markers and genotyping could overcome these limitations and accelerate cotton improvement [5, 10, 11]. It is an important goal for cotton breeders to predict genetic similarities/dissimilarities and assess genetic diversity among cotton germplasm including genotypes, cultivated species, and wild relatives [12]. This allows accurate selection of potential lines to accelerate cotton improvement programs and obtain satisfactory yield and quality by maintaining sufficient genetic variability in cotton gene pools [13, 14].
Therefore, the lack of suitable genetic diversity in breeding germplasm is a major constraint slowing cotton breeders' progress in developing new cultivars [15–19]. Using molecular markers as an alternative tool to identify and select superior parents early in breeding programs and incorporate them into marker-assisted selection (MAS) could significantly enhance genetics and reduce time and costs required to develop novel cotton cultivars [12, 20–22].
Taking together, one of the main tools for cotton breeders to study the genetic diversity is using the molecular markers system that have already overcome the obstacles and disadvantages of morphological markers/characters that have a limit number and are affected by different plant growth stages as well as various environmental conditions [23–25]. In this regard, there are many types of DNA molecular markers that have been extensively used for various genetic analyses of cotton crop species such as RFLPs, RAPD, AFLPs, ISSRs, SSRs, and SNPs [26–29]. SSR markers, which are small motifs consisting of one to six tandem repeats, have been extensively and effectively utilized in genetic diversity, DNA fingerprinting, and QTL mapping studies for cotton crops. This is due to their distinctive DNA-based markers, which possess high specificity in amplifying genomic loci, a simple and easy operation system, a high degree of polymorphism, codominant nature, good reproducibility, and a wide distribution throughout the entire genome [26, 30, 31].
Given this context, the primary objective for cotton breeders is to create a publicly accessible database of molecular markers that can be used as a genetic diversity detection system. These markers, such as SSR markers, are closely associated with important agronomic and fiber quality traits. The aim is to expedite the process of selecting and breeding these traits to ensure sustainable cotton production [32, 33]. To date, genomic libraries contain over 1000 publicly available SSR designed primers from existing cotton DNA sequences generated by research groups worldwide [34, 35]. Many studies have used SSR markers to determine genetic diversity in diverse cotton germplasm. For example, Manonmani et al. [36] characterized genetic diversity of 12 Indian cotton genotypes using 55 SSR primer pairs. They found 40 pairs (25 polymorphic and 15 monomorphic) showed clear, scorable bands and an average of 1.8 alleles per locus [37].
The objective of this study was to explore and evaluate the molecular diversity and genetic polymorphisms among fourteen cotton genotypes using agronomic/morphological characters and genomic SSR markers. The goal was to identify suitable elite divergent genotypes that could be used as parents in future cotton breeding programs.
Materials and Methods
Experimental plant materials
A total of fourteen cotton (Gossypium barbadense L.) genotypes consisted of some Egyptian cotton genotypes and other foreign cotton cultivars were used for this investigation as experimental materials. The seed materials of these studied genotypes were obtained from Cotton Breeding and Genetics Department, Cotton Research Institute, Agricultural Research Center (ARC), Egypt. Details of these genotypes are presented in Table 1.
Table 1.
Origin, and pedigree for the fourteen parental cotton genotypes utilize in this study
| No. | Genotype | Pedigree | Origin |
|---|---|---|---|
| 1. | Giza 86 | G.75 × G.81 | Egypt |
| 2. | Giza 68 | G.36 × G.56 | |
| 3. | Giza 96 | G.84 × (G.70 × G.51B) × Pima62 | |
| 4. | Giza 94 | 10,229 × G.86 | |
| 5. | Giza 92 | G.84 × (G.74 × G.68) | |
| 6. | Giza 70 | G.59A × G.51B | |
| 7. | Giza 93 | G.77 × PimaS6 | |
| 8. | Giza 45 | G.28 × G.7 | |
| 9. | Karchenky Branches | Unknown | Russia |
| 10. | Suvin | Sujata × Vincent | India |
| 11. | Pima s6 | 5934–23–2 × 615,903–98–4–4 | USA |
| 12. | Pima high percentage | Unknown | |
| 13. | C.B. 58 | Unknown | |
| 14. | Big Black Boll (B.B.B) | Unknown | Greek |
Experimental design and field assay
The field experiment for this study was conducted in the Agricultural Research Station in Sakha, which is part of the Egyptian governate of Kafr El-Shaikh. During the 2015 and 2016 growing seasons, this study used a randomized complete block design (RCBD) using triplicates.
Measurements of studied traits
Twelve morphological along with fiber traits were evaluated in the field as follows: 1. Position of first fruiting node (P.F.F.N); 2. Days to first flower (D.F.F); 3. Number of vegetative branches per plant (NO.V.B./P); 4. Number of fruiting branches per plant (NO.F.B./P); 5. Boll weight (B.W); 6.Seed cotton yield per plant (S.C.Y./P); 7. Lint yield per plant (L.Y./P); 8. Lint percentage (L.%) 9. Fiber length. (F.L); 10. Fiber fineness (F.F); 11. Fiber strength (F.S); 12. Uniformity ratio (UR). All morphological, agronomical and fiber traits/properties tests were measured according to known cotton measurement standards.
DNA assay for diversity assessment
All molecular work related to this study was conducted in genetics and biotechnology laboratories, Faculty of Agriculture, Kafr El-Sheikh University and GEBRI, University of Sadat City, Egypt.
Genomic DNA samples collection, isolation, purification, and quantification
To assess the genetic diversity of these genotypes, the fresh leaves from each genotype were collected separately during the seedling growth stage. Then, pre-weighted leave tissue samples from 0.2 to 0.5 g were immediately frozen in liquid nitrogen and fully grounded to fine powder using a pestle and mortar. The subsequent steps of total genomic DNA extraction and purification were carried out using the CTAB method [38] with a few modifications. The isolated DNA samples were measured quantitatively using UV Mass spectrophotometer at a specific optical density (A260 and A280) as well as were qualitatively checked 1.5% agarose gel along with the standard DNA marker/ladder. The DNA samples were stored at –20 °C in a final concentration of 50 ng per microliter for further downstream steps.
PCR amplification, electrophoresis detection and polymorphism analysis protocols
The isolated genomic DNA samples from the 14 cotton genotypes were screened using 10 BNL series SSR primers/markers. These examined primers were obtained and designed based on available sequence information in the Cotton Marker Database (CMD) as summarized in Table 2. The DNA samples were amplified using polymerase chain reaction (PCR) in a 20 μl final reaction volume according to the method described by Saif et al. [39]. The PCR amplification reactions were conducted using 20 ng of DNA in a 25-μL reaction volume, comprising 0.3 μM of each primer, 200 μM of dNTPs, 5 μL (1X) of Taq polymerase buffer, 1.5 mM MgCl2, and 0.5 U Taq DNA polymerase. For SSR reactions, a Touchdown PCR program was employed. The primary program involved 9 cycles at 94ºC for 1 min, 54ºC for 1 min (with a 1ºC decrease in every cycle), and 72ºC for 1 min. Subsequently, 28 cycles were executed at 94ºC for 1 min, 45ºC for 1 min, and 72ºC for 1 min. The initial cycles were preceded by a denaturation step at 94ºC for 5 min and followed by an extension step at 72ºC for 5 min. Then, the PCR products (amplicons) were stored at 4 °C for the next step of gel electrophoresis. The amplified PCR products were separated by gel electrophoresis on 3% agarose gel [39]. The gel photos were visualized and taken under UV light using Gel Documentation System, and the bands were scored as 1 while the absence of a band was recorded as 0, and the [0,1] binary data matrix was constructed.
Table 2.
Detailed summary of SSR primers involved in the molecular analysis of present study
| Primer code | Forward sequence (5′-3′) | Reverse sequence (5′-3′) |
|---|---|---|
| BNL2823 | ATATTCATGCCTCTGCAGCC | GTTTTTAGTTTTTGGACTTAGAGGC |
| BNL2827 | ATCGCGGGCATTAATGAATA | AATACATCCGCTCATTTCGC |
| BNL1044 | TGCTCTTTTTTGGGGGACTA | ATTGGCTTTGGTTGGTTGAG |
| BNL1440B | CCGAAATATACTTGTCATCTAAACG | CCCCCGGACTAATTTTTCAA |
| BNL3408A | ATCCAAACCATTGCACCACT | GTGTACGTTGAGAAGTCATCTGC |
| BNL3408B | ATCCAAACCATTGCACCAGC | GTGTACGTTGAGAAGTCATCTAT |
| BNL2634A | AACAACATTGAAAGTCGGGG | CCCAGCTGCTTATTGGTTTC |
| BNL193 | TGTGAGCCATTGCTGTTAGC | TAAGTGCTGGCATTGTGAGC |
| BNL1047 | GCTTGTCATCTCCATTGCTG | TAGCCCGGTTCATGTTCTTC |
| BNL1061 | GCTTGTCATCTCCATTGCTG | TAGCCCGGTTCATGTTCTTC |
Data and genetic diversity analysis
The observed field data was analyzed to estimate the mean performance differences between studied cotton genotypes based on 12 agro-morphological and fiber collected traits using SPSS 21.0 software (https://www.ibm.com/products/spss-statistics). While the genotypic data based on SSR markers screening assay was analyzed as follows; For each cotton genotype, the amplified gel bands of each target SSR primer representing different alleles were scored, and the allelic bands reflecting the allelic variation were compared with 100 bp DNA ladder. Quantity one software (Gel Doc, Bio-Rad Laboratory, Inc.) was used for capturing gel images and the length of generated DNA fragments were estimated. Then, its data was converted into [0,1] binary matrix subjected to multivariate analysis. The polymorphism information content (PIC) analysis was estimated for all cotton genotypes based on their SSR markers allelic frequency according to the described method of Anderson et al. [40] which showed various PIC values [41] indicating different informative potential of each used SSR marker (High: more than 0.5; Moderate: between 0.5 and 0.25; Slightly below: 0.25.). The cluster dendrogram was constructed using UPGMA method based on the pairwise genetic distances [42] between the cotton genotypes using Numerical Taxonomy System, NTSYS-PC and NTSYS Pc 2.1 software [43]. Finally, the similarity matrices based on Jaccard similarity coefficients [44] were estimated by NTSYS-PC and NTSYS Pc 2.1 software.
Results
Agronomic and morphological characters
Table 3 displays the mean values of agro-morphological traits derived from the genotypes that were examined in the field. In general, the initial fruiting node location character showed the highest mean values from the Egyptian cotton genotypes; G.96 (8.33), G.68 (8.33), and G.93 (8.17), in that order. Conversely, the C.B. 58 genotype had the lowest mean value (5.42), while the Karchenky Branches and Suvin genotypes came in at 5.92 and 6.08, respectively. But in the genotypes that were considered, this feature varied between 5.42 and 8.33. While G.45 (25.58) had the best mean value for fruiting branches per plant, G.68 (22.17) and Suvin (20.08) were next ideal. On the other hand, genotypes G.93 (17.58), G.86 (17.75), and G.94 (17.92) yielded the lowest mean values.
Table 3.
The mean performances of fourteen genotypes for earliness, growth habit, yield, and fiber quality traits for two years
| Genotype | P.F.F.N | No.F.B.P | NO.V.B.P | D.F.F | B.W | S.C.Y.P | L.Y.P | L.% | F.L | F.S | F.F | U.R |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| G.86 | 7.92 | 17.75 | 3.58 | 74.05 | 3.05 | 108.70 | 42.61 | 0.3919 | 33.97 | 10.37 | 4.10 | 87.27 |
| G.68 | 8.33 | 22.17 | 4.00 | 72.11 | 3.13 | 100.01 | 34.85 | 0.3489 | 35.93 | 10.67 | 3.63 | 86.70 |
| Pima s6 | 8.08 | 17.92 | 3.83 | 70.71 | 3.06 | 96.08 | 34.78 | 0.3618 | 35.50 | 10.57 | 4.07 | 85.67 |
| Suven | 6.08 | 20.08 | 2.50 | 68.52 | 2.99 | 78.91 | 29.54 | 0.3744 | 34.50 | 10.37 | 4.03 | 84.23 |
| G.96 | 8.33 | 18.08 | 3.17 | 70.16 | 3.31 | 97.71 | 38.28 | 0.3907 | 36.00 | 11.07 | 4.10 | 87.37 |
| G.94 | 7.17 | 17.92 | 2.25 | 68.58 | 3.31 | 111.59 | 45.14 | 0.4047 | 34.53 | 11.20 | 3.90 | 87.57 |
| C.B. 58 | 5.42 | 19.00 | 2.08 | 67.13 | 2.82 | 90.16 | 34.25 | 0.3800 | 34.63 | 10.50 | 4.10 | 84.67 |
| P.H.P | 6.58 | 18.33 | 2.08 | 66.59 | 2.85 | 80.79 | 32.01 | 0.3955 | 34.03 | 11.00 | 3.50 | 85.87 |
| G.92 | 7.67 | 18.75 | 4.08 | 69.40 | 3.03 | 81.39 | 27.82 | 0.3433 | 33.83 | 11.50 | 4.00 | 86.87 |
| K.B | 5.92 | 18.67 | 2.33 | 67.79 | 3.05 | 68.75 | 24.67 | 0.3604 | 35.43 | 10.40 | 4.23 | 84.47 |
| G.70 | 8.00 | 19.50 | 3.75 | 74.79 | 2.57 | 106.64 | 38.04 | 0.3567 | 36.80 | 11.40 | 3.90 | 88.10 |
| G.93 | 8.17 | 17.58 | 3.33 | 70.18 | 2.84 | 102.40 | 35.07 | 0.3425 | 37.07 | 11.43 | 3.33 | 87.27 |
| G.45 | 8.17 | 25.58 | 5.00 | 70.04 | 2.54 | 92.41 | 31.51 | 0.3412 | 36.83 | 11.17 | 3.27 | 86.97 |
| B.B.B | 6.58 | 19.25 | 2.42 | 67.00 | 3.15 | 101.14 | 40.81 | 0.4041 | 34.07 | 11.17 | 4.13 | 85.53 |
| L.S.D 0.05* | 0.59 | 1.83 | 0.70 | 2.01 | 0.19 | 14.81 | 5.86 | 2.12 | 0.82 | 0.28 | 0.25 | 0.98 |
| L.S.D 0.01** | 0.78 | 2.43 | 0.92 | 2.66 | 0.25 | 19.60 | 7.76 | 2.81 | 1.09 | 0.38 | 0.338 | 1.30 |
P.F.F.;/ First Fruiting Node, No. FB/P Number of fruiting branches per plant, No.V.B.P. Number of vegititive branches per plant, D.F.F Days to first flower, B.W. Boll weight, LCY.p. Lint cotton yield per plant, SCY.p Seed cotton yieldper plant, L% Lint percentage, F.L. Fiber length, FF Fiber fineness, FS Fiber strength, UR% Uniformity ratio
*LSD0.05 = least significant differences of means (p < 0.05), **LSD0.01 = least significant differences of means (p < 0.01)
The highest mean values for the number of vegetative branches per plant were obtained from genotypes G.68 (5 branches), G.92 (4 branches), and G.45 (5 branches), as shown in Table 3. However, genotypes C.B. 58 (2.08), Pima high percentage (2.08), and G.94 (2.25), in that order, produced the lowest mean values. Curiously, the Egyptian genotypes G.70 (74.79), G.86 (74.05), and G.68 (72.11), in that order, had the highest mean values for the days to first flower trait. In contrast, the genotype Pima high percentage (66.59), B.B.B. (67), and C.B. 58 (67.13), in that order, had the lowest mean values.
Yield and its component characters
The mean values of yield and its associated parameters for all cotton genotypes are detailed in Table 3. In terms of boll weight (B.W), the data indicates that the genotypes G.96, G.94, and B.B.B exhibited the highest mean values at 3.31, 3.31, and 3.15, respectively, while the lowest mean values were observed in G.45, G.70, and C.B.58 at 2.54, 2.57, and 2.82, respectively. Analysis of seed cotton yield per plant (S.C.Y./P) in Table 3 reveals that the top-performing international cotton genotypes were Karchenky Branches, Suvin, and Pima high percentage, with mean values of 68.75, 78.91, and 80.79, respectively. Considering the lint yield per plant (L.Y./P), the data in Table 3 demonstrates that the genotypes G.94, G.86, and B.B.B exhibited the highest mean values at 45.14, 42.61, and 40.81, respectively. Conversely, the cotton genotypes Karchenky Branches, G.92, and Suvin recorded the lowest mean values at 24.67, 27.82, and 29.54, respectively. In terms of lint percentage (L.%), the results indicated that the genotypes G.94, B.B.B, and Pima high percentage had the highest mean values at 40.47, 40.41, and 39.55, respectively. On the other hand, the Egyptian cotton genotypes G.45, G.93, and G.92 exhibited the lowest mean values at 34.12, 34.25, and 34.33, respectively.
Fiber quality properties traits
In the case of cotton quality characteristics and properties, it was stated that the highest mean values for fiber length (F.L) trait were acquired from the Egyptian cotton genotypes, G.93, G.45 and G.70 (37.07, 36.83 and 36.8) respectively. Conversely, the lowest mean values were found from genotypes G.92, G.86 and P.H.P (33.83, 33.97 and 34.03), respectively. On the other side, the results in Table 3 exhibited that the highest mean values for the traits of fiber strength (F.S) were (11.5, 11.43 and 11.4) on the Egyptian genotypes G.92, G.93 and G.70, respectively whereas the lowest mean values were obtained from genotypes Suvin, G.86 and Karchenky Branches (10.37, 10.37 and 10.4), respectively.
In addition, the fiber fineness (F.F) character showed higher mean values from the cotton genotypes; Karchenky Branches, B.B.B and G.86 (4.23, 4.13, 4.1), respectively. While the lowest mean values were obtained from genotypes G.45, G.93 and P.H.P (3.27, 3.33 and 3.5), respectively. Finally, almost all the tested genotypes showed high ratio of uniformity but the highest mean values for uniformity ratio (U.R) trait were obtained from The Egyptian genotypes; G.70, G.94 and G.96 (88.1, 87.57 and 87.37) respectively. While the lowest mean values were attained from the Indian genotype (Suvin), the Russian genotype (Karchenky Branches), and one of American cottons (C.B. 58). Taking together, most of the Egyptian cotton genotypes showed high agronomic performance compared to the international genotypes.
Molecular diversity revealed by SSR markers.
Ten SSR markers, revealing a notably high level of polymorphism (polymorphic DNA), as outlined in Table 4 and Fig. 1. Across all tested cotton genotypes, the results indicated that the primer pairs designed for SSR analysis generated a total of 212 bands, with 175 of them being polymorphic. This accounted for 82.54% of the total bands, with an average of 17.5 polymorphic bands per marker. The number of bands varied between 5 and 8 for the primer pairs BNL2827 and BNL2823. The polymorphic bands percentage ranged from 72.4% for the primer pair BNL1440B to 100% for the primer pair BNL193. The Polymorphic Information Content (PIC) values for the SSR primer pairs ranged from 0.76 for BNL193 to 0.86 for BNL2827, with the latter recording the highest PIC value among the ten SSR markers. In summary, all examined SSR markers were deemed informative, collectively revealing an average PIC of 0.815.
Table 4.
The diversity analysis results generated by ten simple sequence repeats (SSR) markers used in the study
| No. | Marker name | Chr. No. | No. of allele | Polymorphic bands | PIC |
|---|---|---|---|---|---|
| 1 | BNL2823 | 6 | 8 | 16 | 0.84 |
| 2 | BNL2827 | 1 | 8 | 12 | 0.86 |
| 3 | BNL1044 | 4 | 5 | 18 | 0.81 |
| 4 | BNL1440B | 25 | 4 | 14 | 0.79 |
| 5 | BNL3408A | 3 | 3 | 12 | 0.80 |
| 6 | BNL3408B | 3 | 2 | 18 | 0.78 |
| 7 | BNL2634A | 7 | 6 | 19 | 0.83 |
| 8 | BNL193 | 18 | 3 | 24 | 0.76 |
| 9 | BNL1047 | 25 | 6 | 22 | 0.85 |
| 10 | BNL1061 | 25 | 5 | 20 | 0.83 |
| Total | 50 | 175 | 8.15 | ||
| Average | 5 | 17.5 | 0.82 | ||
Fig. 1.
DNA fingerprints showed the polymorphism of fourteen cotton genotypes with ten SSR primers
Similarity coefficient assessment
The genetic similarity co-efficient matrix of cotton genotypes used in this study (Table 5) showed that the similarity index (SI) values ranged from 0.5824 to 0.9066 with an average of 0.7473 as well as a high dissimilarity coefficient of 0.5824 and 0.6044 for the Egyptian genotype Giza 68 with genotypes Pima s6 and Pima high percentage, respectively. On the other hand, the highest similarity coefficient was recorded for the genotypes Giza 70 and Giza 93 (0.9066) and the genotypes Pima s6 and Pima high percentage respectively (0.9011). In addition to that, the Indian genotype (Suvin) recorded the higher genetic similarity index with the American genotypes; Pima high percentage (0.8901 followed by Pima s6 (0.8681) cotton respectively.
Table 5.
Genetic similarity co-efficient matrix of 14 cotton genotypes based on genomic SSR molecular analysis
| Genotype | Giza 86 | Giza 68 | Giza 96 | Giza 94 | Giza 92 | Giza 70 | Giza 93 | Giza 45 | K.P | Suvin | Pima s6 | P.H.P | C.B. 58 | B.B.B |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Giza 86 | 1.0000 | |||||||||||||
| Giza 68 | 0.6538 | 1.0000 | ||||||||||||
| Giza 96 | 0.7747 | 0.7143 | 1.0000 | |||||||||||
| Giza 94 | 0.6868 | 0.6703 | 0.6923 | 1.0000 | ||||||||||
| Giza 92 | 0.6978 | 0.7363 | 0.6813 | 0.8242 | 1.0000 | |||||||||
| Giza 70 | 0.6923 | 0.7198 | 0.7308 | 0.8077 | 0.8846 | 1.0000 | ||||||||
| Giza 93 | 0.6868 | 0.7582 | 0.6703 | 0.7912 | 0.8462 | 0.9066 | 1.0000 | |||||||
| Giza 45 | 0.6648 | 0.6813 | 0.6703 | 0.7912 | 0.8242 | 0.8407 | 0.8571 | 1.0000 | ||||||
| K.P | 0.6593 | 0.6758 | 0.6758 | 0.7857 | 0.8077 | 0.8462 | 0.8297 | 0.8956 | 1.0000 | |||||
| Suvin | 0.7527 | 0.6374 | 0.7692 | 0.7473 | 0.7253 | 0.7967 | 0.7582 | 0.7253 | 0.7198 | 1.0000 | ||||
| Pima s6 | 0.7198 | 0.5824 | 0.7473 | 0.7802 | 0.7473 | 0.7857 | 0.7363 | 0.7692 | 0.8077 | 0.8681 | 1.0000 | |||
| P.H.P | 0.7418 | 0.6044 | 0.7582 | 0.7802 | 0.7473 | 0.7967 | 0.7692 | 0.7692 | 0.7637 | 0.8901 | 0.9011 | 1.0000 | ||
| C.B. 58 | 0.6319 | 0.7363 | 0.6813 | 0.6703 | 0.7143 | 0.7308 | 0.7363 | 0.7033 | 0.6923 | 0.7088 | 0.7418 | 0.7418 | 1.0000 | |
| B.B.B | 0.6319 | 0.7363 | 0.6813 | 0.6703 | 0.7143 | 0.7308 | 0.7363 | 0.7033 | 0.7198 | 0.6154 | 0.6374 | 0.6593 | 0.7747 | 1.0000 |
| Maximum: 0.9066 | Average:0.7473 | Minimum:0.5824 | ||||||||||||
Cluster analysis
For this study, the fourteen cotton genotypes were scored based on the presence and absence of amplified band for each SSR marker and its specific alleles. Thus, genetic distance analysis showed that for each genotype combination, the genetic distance ranged from 0.64 to 0.78 and according to the cluster analysis of combined SSR data, all 14 genotypes used in this study were separated into two major clusters (Fig. 2). The constructed dendrogram has grouped the used genotypes into two distinguished clusters namely, A and B. According to the phylogenetic tree, it shown in Fig. (2) that the genetic similarity of 0.66 was the start separation point for main cluster to two sub clusters A1 and A2, the first sub cluster consisted of A11 and A12 at genetic similarity of 0.70, the A12 sub cluster included Giza 92 and Giza 70 at genetic similarity of 0.73. The A12 sub cluster separated to A11a and A11b, the A11a included G.68 and G.86 at genetic similarity 0.78 while the A11b included Pima s6 and Suvin at genetic similarity 0.75. The A2 sub cluster separated to A21 and A22, the A21 included individual cultivars G.93, while A22 included G.45 and B.B.B genotypes at genetic similarity 0.75. On the other side, the second main cluster was separated into two sub main clusters namely, B1 and B2 at the genetic similarity of 0.66. Then, the first sub cluster B1 was subsequently divided into another sub clusters of B11 and B12 at genetic similarity 0.71 while, The B2 included two genotype G.94 and C. B. 58 at genetic similarity 0.72. The B11 included G.96 and Pima high percentage at genetic similarity 0.71, while B12 included only one cultivar Karchenk Branches.
Fig. 2.
Cluster analysis dendogram constructed from the studied cotton genotypes through ten SSR primers
Discussions
One of the essential goals for cotton breeders, is to develop modern varieties with promissing characteristiques in terms of fiber quality as well as agronomical economic traits to increase the farmers profitability under its current cultivation system. Unfortantely, the achievement of this goal is hindered by the poor and tapered of genetic base of modern crop varieties due to the continued extensive selection process during its progress course that eventually has leaded to a lack genetic variability amongest the core cotton genotypes [17, 37, 45]. Therefore, the current investigation was aimed to estimate the genetic diversity/variability among different Egyptian and international cotton genotypes using important agro-morphological traits and DNA based SSR markers.
The results of our investigation suggest that the Egyptian cotton genotypes demonstrated the most elevated mean performance values across all assessment criteria for growth performance. On the other hand, the genotypes G.96, G.94, B.B.B, and G.70 demonstrated the highest average values for both yield and its constituent components. The cotton genotypes G.96, G.92, Karchenky, G.94, G.93, B.B.B, and G.70 had the greatest average values for fiber qualities when compared to the other cotton genotypes. Likewise, a multitude of previous studies have demonstrated comparable patterns in the assessed agro-morphological parameters [46, 47].
The results obtained from the analysis of fourteen cotton genotypes using ten SSR/microsatellite molecular markers are of significance. It is crucial to note that the effectiveness of various DNA-based markers in assessing genetic variation in crops can vary based on genetic principles and the rationale behind using each molecular marker [48]. In our genetic diversity analysis, as depicted in Table 4, the total and average number of polymorphic bands for the studied SSR markers were found to be higher compared to the findings of Kurt et al. [30] In another study, they analyzed twenty-nine genotypes, including interspecific hybrid cotton, using twelve genomic SSR markers. They observed a different number of amplified alleles ranging from 2 to 4 for each locus, with an average of 2.53 alleles per locus. [12, 41, 49–51].
Moreover, the investigation carried out by Dongre et al. [52] found that out twenty-five25 SSR markers tested in their study, 17 markers were able to produce 56 polymorphic bands in addition to four SSR markers showed a monomorphic pattern while the remaining markers were non-scorable and non-reproducible bands. Taking together, the similar findings by using genomic SSR markers have been reported by various researchers such as [26, 31, 53–55]. In our investigation, the Polymorphic Information Content (PIC) values for all analyzed SSR markers varied, ranging from 0.76 for the primer pair BNL193 to 0.86 for the primer pair BNL2827, with an average PIC of 0.82. Additionally, it is crucial to emphasize that the discerned genetic diversity in the examined germplasm materials is not solely indicated by the varying number of amplified alleles for each marker. It also correlates with other factors, such as the type of marker system utilized, the separation technique of PCR products, and the resolution power of the analysis [56].
On the other side, the genetic similarity co-efficient and phylogenetic analysis results were figured out the genetic relationships amongst the studied cotton genotypes. These results were based on the molecular profiling data of examined cotton genotypes and it might be help to design as well as to conduct a hybridization-based breeding programs with the wide clustered related genotypes [57]. For example, as per our results, the hybridization between the Egyptian cotton genotypes such as Giza 68 with genotypes Pima s6 or Pima high percentage is a suitable parental combination in next breeding schemes due to the high dissimilarity coefficient between these genotypes. With this respect, SSR markers are a highly preferable tool to characterizes different crop genotypes to describe their expansion regarding its genetic diversity as well as it is the suitable choice marker system to assess DNA-based fingerprinting for the major crop improvement schemes [58, 59]. In addition, the higher genetic variability in cotton genotypes was recorded through the implementation of SSR based markers system in cotton genetic diversity analysis and marker assisted selection studies [60]. On the other hand, according to Ditta et al. [41] It was asserted by the individual that a PIC value exceeding 0.5 for each SSR marker indicated the informative capacity of said marker. The findings of our investigation revealed that the polymorphism information content (PIC) results indicated a PIC value over 0.5 for all SSR markers that were evaluated. Thus, in summary, these SSR markers can serve as a valuable tool for cotton crop breeders to investigate the genetic diversity and expand the genetic resources of cotton. This will help identify appropriate parental lines and establish a strong foundation for future marker assisted selection (MAS) schemes aimed at enhancing new modern cotton genotypes.
Conclusion
In conclusion, the superior performance of Egyptian cotton genotypes, particularly G.96, G.68, and G.93, in key agronomic traits underscores their potential for cultivation and breeding programs. The robust fiber quality traits exhibited by these genotypes further highlight their significance in contributing to high-quality cotton production. The molecular analysis, using SSR markers, not only revealed a substantial level of genetic polymorphism but also facilitated the identification of distinct genetic relationships among the studied genotypes. This comprehensive understanding of both phenotypic and genotypic characteristics provides valuable insights for cotton breeders and farmers, aiding in the selection and development of improved cotton varieties with enhanced agronomic performance and fiber quality.
Acknowledgements
Authors would like to acknowledge their universities for supporting the research.
Authors’ contributions
Mona A. Farid, Youssef A. El-Mahalawy, A. A. A. El-Akheder, Ali A. Aboshosha, Aysam M. Fayed, W. M. B. Yehia, Sobhi F. Lamlom and Ehab A. A. Salama, design idea, methodology, data analysis and wrote the main manuscript text. Sobhi F. Lamlom and Ehab A. A. Salama. editing and reviewing. All authors reviewed the manuscript.
Author’s information
Not Applicable (NA).
Funding
Not Applicable (NA).
Availability of data and materials
All data generated or analysed during this study are included in this published article.
Declarations
Ethics approval and consent to participate
This article does not contain any studies with human or animal subjects. The current experimental research and field study including the collection of plant material, is complying with relevant institutional, national, and international guidelines and legislation and used for research and development.
Consent for publication
Not applicable (NA).
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Kranthi KR. Cotton production practices: snippets from global data 2017. The ICAC Recorder. 2018;36:4–14. [Google Scholar]
- 2.Zhang Z-S, Xiao Y-H, Luo M, Li X-B, Luo X-Y, Hou L, Li D-M, Pei Y. Construction of a genetic linkage map and QTL analysis of fiber-related traits in upland cotton (Gossypium hirsutum L.) Euphytica. 2005;144:91–99. doi: 10.1007/s10681-005-4629-x. [DOI] [Google Scholar]
- 3.Chen ZJ, Scheffler BE, Dennis E, Triplett BA, Zhang T, Guo W, Chen X, Stelly DM, Rabinowicz PD, Town CD. Toward sequencing cotton (Gossypium) genomes. Plant Physiol. 2007;145(4):1303–1310. doi: 10.1104/pp.107.107672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sanamyan MF, Bobohujayev SU, Abdukarimov SS, Makamov AK, Silkova OG. Features of Chromosome Introgression from Gossypium barbadense L. into G. hirsutum L. during the Development of Alien Substitution Lines. Plants. 2022;11(4):542. doi: 10.3390/plants11040542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Sarode D, Sharma K, Shinde N, Gaikwad A, Chavhan R, Pimpale P. Molecular Characterization of Cotton (Gossypium hirsutum L.) Genotypes Using SSR Markers for Fiber Quality Traits. Int J Curr Microbiol App Sci. 2021;10(03):1748–1759. [Google Scholar]
- 6.Grover CE, Zhu X, Grupp KK, Jareczek JJ, Gallagher JP, Szadkowski E, Seijo JG, Wendel JF. Molecular confirmation of species status for the allopolyploid cotton species, Gossypium ekmanianum Wittmack. Genet Resour Crop Evol. 2015;62(1):103–114. doi: 10.1007/s10722-014-0138-x. [DOI] [Google Scholar]
- 7.Wendel J, Brubaker C. RFLP diversity in Gossypium hirsutum L. and new insights into the domestication of cotton. Am J Bot. 1993;80(6):71. [Google Scholar]
- 8.Zhang H-B, Li Y, Wang B, Chee PW. Recent advances in cotton genomics. International Journal of plant genomics. 2008;2008:742304. doi: 10.1155/2008/742304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Wendel JF, Brubaker C, Alvarez I, Cronn R, Stewart JM. Evolution and natural history of the cotton genus. Genet Genomics Cotton. 2009:3–22.
- 10.Guiamba HDSS, Zhang X, Sierka E, Lin K, Ali MM, Ali WM, Lamlom SF, Kalaji HM, Telesiński A, Yousef AF. Enhancement of photosynthesis efficiency and yield of strawberry (Fragaria ananassa Duch.) plants via LED systems. Frontiers Plant Science. 2022;13:918038. doi: 10.3389/fpls.2022.918038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. H Ren F Zhang SF Lamlom B Zhang. Manipulating rhizosphere microorganisms to improve crop yield in saline-alkali soil: a study on soybean growth and development. Front Microbiol 2023;14:1233351 [DOI] [PMC free article] [PubMed]
- 12.Ditta A, Zhou Z, Cai X, Shehzad M, Wang X, Okubazghi KW, Xu Y, Hou Y, Sajid Iqbal M, Khan MKR. Genome-wide mining and characterization of SSR markers for gene mapping and gene diversity in Gossypium barbadense L. and Gossypium darwinii G. watt accessions. J Agronomy. 2018;8(9):181. doi: 10.3390/agronomy8090181. [DOI] [Google Scholar]
- 13.Lacape J-M, Llewellyn D, Jacobs J, Arioli T, Becker D, Calhoun S, Al-Ghazi Y, Liu S, Palaï O, Georges S. Meta-analysis of cotton fiber quality QTLs across diverse environments in a gossypium hirsutum x G. barbadenseRIL population. BMC Plant Biol. 2010;10(1):1–24. doi: 10.1186/1471-2229-10-132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lamlom SF, Irshad A, Mosa WF. The biological and biochemical composition of wheat (Triticum aestivum) as affected by the bio and organic fertilizers. BMC Plant Biol. 2023;23(1):111. doi: 10.1186/s12870-023-04120-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Rafiq M, Saqib M, Jawad H, Javed T, Hussain S, Arif M, Ali B, Bazmi MSA, Abbas G, Aziz M. Improving quantitative and qualitative characteristics of Wheat (Triticum aestivum L.) through nitrogen application under semiarid conditions. Phyton. 2023;92(4):1001–1017. doi: 10.32604/phyton.2023.025781. [DOI] [Google Scholar]
- 16.Kandil EE, Lamlom SF, Gheith E-SM, Javed T, Ghareeb RY, Abdelsalam NR, Hussain S. Biofortification of maize growth, productivity and quality using nano-silver, silicon and zinc particles with different irrigation intervals. J Agric Sci. 2023;161(3):339–355. doi: 10.1017/S0021859623000345. [DOI] [Google Scholar]
- 17.Abdel-Aty M, Sorour F, Yehia W, Kotb H, Abdelghany AM, Lamlom SF, Shah AN, Abdelsalam NR. Estimating the combining ability and genetic parameters for growth habit, yield, and fiber quality traits in some Egyptian cotton crosses. BMC Plant Biol. 2023;23(1):1–21. doi: 10.1186/s12870-023-04131-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ibrahim IA, Yehia W, Saleh FH, Lamlom SF, Ghareeb RY, El-Banna AA, Abdelsalam NR. Impact of plant spacing and nitrogen rates on growth characteristics and yield attributes of Egyptian cotton (Gossypium barbadense l.) Frontier Plant Science. 2022;13:916734. doi: 10.3389/fpls.2022.916734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ochar K, Su B-h, Zhou M-m, Liu Z-x, Gao H-w, Lamlom SF, Qiu L-j. Identification of the genetic locus associated with the crinkled leaf phenotype in a soybean (Glycine max L.) mutant by BSA-Seq technology. J Integr Agric. 2022;21(12):3524–3539. doi: 10.1016/j.jia.2022.08.095. [DOI] [Google Scholar]
- 20.Ren H, Zhang F, Zhu X, Lamlom SF, Liu X, Wang X, Zhao K, Wang J, Sun M, Yuan M. Cultivation model and deficit irrigation strategy for reducing leakage of bundle sheath cells to CO2, improve 13C carbon isotope, photosynthesis and soybean yield in semi-arid areas. J Plant Physiol. 2023;285:153979. doi: 10.1016/j.jplph.2023.153979. [DOI] [PubMed] [Google Scholar]
- 21.Abdel-Aty M, Youssef-Soad A, Yehia W, El-Nawsany R, Kotb H, Ahmed GA, Hasan ME, Salama EA, Lamlom SF, Saleh FH. Genetic analysis of yield traits in Egyptian cotton crosses (Gossypium barbdense L.) under normal conditions. BMC Plant Biology. 2022;22(1):462. doi: 10.1186/s12870-022-03839-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zhang B, Zhao K, Ren H, Lamlom SF, Liu X, Wang X, Zhang F, Yuan R, Wang J. Comparative study of isoflavone synthesis genes in two wild soybean varieties using transcriptomic analysis. Agriculture. 2023;13(6):1164.
- 23.Kohel RJ, Bird LS. Inheritance and linkage analysis of the yellow pulvinus mutant of cotton. J Cotton Sci. 2002;6:115–118. [Google Scholar]
- 24.AbdElgalil MAS, Hefzy M, Sas-Paszt L, Ali HM, Lamlom SF, Abdelghany AM. Unraveling the influence of water and nitrogen management on quinoa (Chenopodium quinoa Willd.) agronomic and yield traits. Water. 2023;15(7):1296. doi: 10.3390/w15071296. [DOI] [Google Scholar]
- 25.Ren H, Zhang B, Zhang F, Liu X, Wang X, Zhang C, Zhao K, Yuan R, Lamlom SF, Abdelghany AM. Integration of physiological and transcriptomic approaches in investigating salt-alkali stress resilience in soybean. Plant Stress. 2024;11:100375. doi: 10.1016/j.stress.2024.100375. [DOI] [Google Scholar]
- 26.Siu L, Saha S, Stelly D, Burr B, Cantrell R. Chromosomal assignment of microsatellite loci in cotton. J Hered. 2000;91(4):326–332. doi: 10.1093/jhered/91.4.326. [DOI] [PubMed] [Google Scholar]
- 27.Hakki EE, Savaskan C, Akkaya MS. Genotyping of Anatolian doubled-haploid durum lines with SSR markers. Euphytica. 2001;122:257–262. doi: 10.1023/A:1012955516198. [DOI] [Google Scholar]
- 28.Lamlom SF, Zhang Y, Su B, Wu H, Zhang X, Fu J, Zhang B, L-j QIU. Map-based cloning of a novel QTL qBN-1 influencing branch number in soybean [Glycine max (L.) Merr.] The Crop Journal. 2020;8(5):793–801. doi: 10.1016/j.cj.2020.03.006. [DOI] [Google Scholar]
- 29.Hayatu NG, Liu Y-R, Han T-F, Daba NA, Zhang L, Zhe S, Li J-W, Muazu H, Lamlom SF, Zhang H-M. Carbon sequestration rate, nitrogen use efficiency and rice yield responses to long-term substitution of chemical fertilizer by organic manure in a rice–rice cropping system. J Integr Agric. 2023;22(9):2848–2864. doi: 10.1016/j.jia.2022.12.006. [DOI] [Google Scholar]
- 30.Kurt Y, Bilgen B, Kaya N, IŞIK K. Genetic comparison of Pinus brutia Ten. populations from different elevations by RAPD markers. Notulae Botanicae Horti Agrobotanici Cluj-Napoca. 2011;39(2).
- 31.Gutierrez O, Basu S, Saha S, Jenkins J, Shoemaker D, Cheatham C, McCarty J., Jr Genetic distance among selected cotton genotypes and its relationship with F2 performance. Crop Sci. 2002;42(6):1841–1847. doi: 10.2135/cropsci2002.1841. [DOI] [Google Scholar]
- 32.M Shaukat A Abbasi K Ramzan H Aiman 2024 MEMON SQ, MAQSOOD Z, GAAFAR A-RZ, HODHOD MS, LAMLOM SF: Ameliorating heat stressed conditions in wheat by altering its physiological and phenotypic traits associated with varying nitrogen levels Notulae Botanicae Horti Agrobotanici Cluj-Napoca 52 1 13471 13471
- 33.Ibrahim MF, Ali MM, Lamlom SF, Kalaji HM, Yousef AF. Climate change necessitates a change in the cultivation date of caraway (Carum carvi L.). J Water Land Dev. 2022;54.
- 34.Chen ZJ. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. J Annu Rev Plant Biol. 2007;58:377–406. doi: 10.1146/annurev.arplant.58.032806.103835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Elmahdy AM, Ahmed YM, Bakr AA, Abdallah AM, Abdelghany AM, El-Sorady GA, et al. Revolutionizing Maize Farming with Potassium Silicate Foliar Spray and Water Management Techniques. Silicon. 2023;15(16):7121–35.
- 36.Manonmani K, Mahalingam L, Malarvizhi D, Premalatha N, Sritharan N. Molecular diversity studies in cotton (Gossypium hirsutum L.) using SSR markers. Int J Curr Microbiol App Sci. 2019;8(7):1731–1737. doi: 10.20546/ijcmas.2019.807.205. [DOI] [Google Scholar]
- 37.Ren H, Zhao K, Zhang C, Lamlom SF, Liu X, Wang X, Zhang F, Yuan R, Gao Y, Cao B. Genetic analysis and QTL mapping of seed hardness trait in a soybean (Glycine max) recombinant inbred line (RIL) population. Gene. 2024;905:148238. doi: 10.1016/j.gene.2024.148238. [DOI] [PubMed] [Google Scholar]
- 38.Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: version II. Plant Mol Biol Report. 1983;1:19–21. doi: 10.1007/BF02712670. [DOI] [Google Scholar]
- 39.Saif I, MA S, Riad S, Elbagoury M. Molecular characterization of some Egyptian cotton varieties. Alexandria Sci Exch J. 2017;38:44–52. doi: 10.21608/asejaiqjsae.2017.2319. [DOI] [Google Scholar]
- 40.Anderson JA, Churchill G, Autrique J, Tanksley S, Sorrells M. Optimizing parental selection for genetic linkage maps. Genome. 1993;36(1):181–186. doi: 10.1139/g93-024. [DOI] [PubMed] [Google Scholar]
- 41.Ditta A, Zhou Z, Cai X, Wang X, Okubazghi KW, Shehzad M, Xu Y, Hou Y, Sajid Iqbal M, Khan MKR. Assessment of genetic diversity, population structure, and evolutionary relationship of uncharacterized genes in a novel germplasm collection of diploid and allotetraploid Gossypium accessions using EST and genomic SSR markers. Int J Mol Sci. 2018;19(8):2401. doi: 10.3390/ijms19082401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Nei M, Li W-H. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci. 1979;76(10):5269–5273. doi: 10.1073/pnas.76.10.5269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Rohlf F. NTSYS-pc: microcomputer programs for numerical taxonomy and multivariate analysis. Am Stat. 1987;41:330. doi: 10.2307/2684761. [DOI] [Google Scholar]
- 44.Jaccard P. Nouvelles recherches sur la distribution florale. Bull Soc Vaud Sci Nat. 1908;44:223–270. [Google Scholar]
- 45.Obaid-ur-Rehman SHK, Sajjad M. Genetic diversity among cotton (Gossypium hirsutum L.) genotypes existing in Pakistan. Am Eurasian J Sustain Agric. 2009;3(4):816–823. [Google Scholar]
- 46.Yehia W, El-Hashash EF. Estimates of genetic parameters for cotton yield, its components, and fiber quality traits based on line x tester mating design and principal component analysis. Egypt J Agric Res. 2022;100(3):302–315. [Google Scholar]
- 47.Abdel-Aty MS, Youssef-Soad A, Yehia WMB, El-Nawsany RTE, Kotb HMK, Ahmed GA, Hasan ME, Salama EAA, Lamlom SF, Saleh FH, et al. Genetic analysis of yield traits in Egyptian cotton crosses (Gossypium barbdense L.) under normal conditions. BMC Plant Biol. 2022;22(1):462. doi: 10.1186/s12870-022-03839-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Ambreen I, Sadia A, Usman I, Tayyaba S. Molecular characterization of cotton using simple sequence repeat (SSR) markers and application of genetic analysis. Int JGenet MolBiol. 2013;5(4):49–53. [Google Scholar]
- 49.Medini M, Hamza S, Rebai A, Baum M. Analysis of genetic diversity in Tunisian durum wheat cultivars and related wild species by SSR and AFLP markers. Genet Resour Crop Evol. 2005;52:21–31. doi: 10.1007/s10722-005-0225-0. [DOI] [Google Scholar]
- 50.Code C. The efficiency of AFLP and SSR markers in genetic diversity estimation and gene pool classification of common bean (Phaseolus vulgaris L.) J Acta Agric Slov. 2008;91:87–96. [Google Scholar]
- 51.Kuang Z, Xiao C, Ilyas MK, Ibrar D, Khan S, Guo L, Wang W, Wang B, Huang H, Li Y. Use of SSR markers for the exploration of genetic diversity and DNA finger-printing in early-maturing upland cotton (Gossypium hirsutum L.) for future breeding Program. Agronomy. 2022;12(7):1513. doi: 10.3390/agronomy12071513. [DOI] [Google Scholar]
- 52.Dongre A, Bhandarkar M, Banerjee S. Genetic diversity in tetraploid and diploid cotton (Gossypium spp.) using ISSR and microsatellite DNA markers. NIScPR Online Periodicals Repository. 2007.
- 53. CH Bertini I Schuster T Sediyama 2006 Barros EGd, Moreira MA: Characterization and genetic diversity analysis of cotton cultivars using microsatellites Genetics Molecular Biology 29 321 329
- 54.Khan AI, Fu Y-B, Khan IA. Genetic diversity of Pakistani cotton cultivars as revealed by simple sequence repeat markers. Commun Biometry Crop Sci. 2009;4(1):21.
- 55.Ma Q, Zhao J, Lin H, Ning X, Liu P, Deng F, Si A, Li J. Association between SSR markers and fibre traits in sea island cotton (Gossypium barbadense) germplasm resources. J Genet. 2017;96:55–63. doi: 10.1007/s12041-017-0849-9. [DOI] [PubMed] [Google Scholar]
- 56.Lacape J-M, Nguyen T-B, Thibivilliers S, Bojinov B, Courtois B, Cantrell RG, Burr B, Hau B. A combined RFLP SSR AFLP map of tetraploid cotton based on a Gossypium hirsutum× Gossypium barbadense backcross population. Genome. 2003;46(4):612–626. doi: 10.1139/g03-050. [DOI] [PubMed] [Google Scholar]
- 57.Mishra KK, Fougat RS, Ballani A. Validation of fiber quality linked SSR markers derived from allotetraploid (Gossypium hirsutum) in diploid (Gossypium arboreum) Int J Sci R Know. 2013;1:349–357. [Google Scholar]
- 58.Bligh HFJ, Blackhall NW, Edwards KJ, McClung AM. Using amplified fragment length polymorphisms and simple sequence length polymorphisms to identify cultivars of brown and white milled rice. Crop Sci. 1999;39(6):1715–1721. doi: 10.2135/cropsci1999.3961715x. [DOI] [Google Scholar]
- 59.Jeung JU, Hwang HG, Moon HP, Jena KK. Fingerprinting temperate japonica and tropical indica rice genotypes by comparative analysis of DNA markers. Euphytica. 2005;146(3):239–251. doi: 10.1007/s10681-005-9022-2. [DOI] [Google Scholar]
- 60.Li Z, Wang X, Zhang Y, Zhang G, Wu L, Chi J, Ma Z. Assessment of genetic diversity in glandless cotton germplasm resources by using agronomic traits and molecular markers. Front Mech Eng China. 2008;2:245–252. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analysed during this study are included in this published article.


