Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Jun 1.
Published in final edited form as: Mol Oral Microbiol. 2023 Dec 18;39(3):125–135. doi: 10.1111/omi.12447

Activation of Liver X Receptors suppresses the abundance and osteoclastogenic potential of osteoclast precursors and periodontal bone loss

Yanfang Zhao 1, Kai Yang 1, Thalyta Amanda Ferreira 1, Xuejia Kang 2, Xu Feng 3, Jannet Katz 1, Suzanne M Michalek 4, Ping Zhang 1
PMCID: PMC11096071  NIHMSID: NIHMS1950570  PMID: 38108557

Abstract

Liver-X receptors (LXRs) are essential nuclear hormone receptors involved in cholesterol and lipid metabolism. They are also believed to regulate inflammation and physiological and pathological bone turnover. We have previously shown that infection with the periodontal pathogen Porphyromonas gingivalis (Pg) in mice increases the abundance of CD11b+c-fms+Ly6Chi cells in bone marrow, spleen, and peripheral blood. These cells also demonstrated enhanced osteoclastogenic activity and a distinctive gene profile following Pg infection. Here, we investigated the role of LXRs in regulating these osteoclast precursors (OCPs) and periodontal bone loss. We found that Pg infection down-regulates the gene expression of LXRs, as well as ApoE, a transcription target of LXRs, in CD11b+c-fms+Ly6Chi OCPs. Activation of LXRs by treatment with GW3965, a selective LXR agonist, significantly decreased Pg-induced accumulation of CD11b+c-fms+Ly6Chi population in bone marrow and spleen. GW3965 treatment also significantly suppressed the osteoclastogenic potential of these OCPs induced by Pg infection. Furthermore, activation of LXRs reduces the abundance of OCPs systemically in bone marrow and locally in the periodontium, as well as mitigates gingival c-fms expression and periodontal bone loss in a ligature-induced periodontitis model. These data implicate a novel role of LXRs in regulating OCP abundance and osteoclastogenic potential in inflammatory bone loss.

Keywords: Liver X receptors, osteoclast precursors, Porphyromonas gingivalis, periodontitis

INTRODUCTION

Periodontitis is one of the most common oral diseases leading to tooth loss and represents a serious public burden. It is caused by periodontal microbiota dysbiosis and featured as the presence of periodontal inflammation and subsequent alveolar bone loss. It is also linked with a series of systemic diseases, including cardiovascular diseases, type 2 diabetes, rheumatoid arthritis, and Alzheimer’s disease (Hajishengallis & Chavakis, 2021). However, the exact mechanisms underlying host susceptibility, the chronicity of periodontal inflammation, and alveolar bone loss remain incompletely understood.

Osteoclasts are large multinucleated cells responsible for bone resorption. They are crucial in bone remodeling and under physiologic conditions, bone homeostasis is supported via the equilibrium between bone formation osteoblasts and bone resorption osteoclasts. However, in inflammatory osteolytic diseases such as periodontitis, elevated osteoclast activity occurs, leading to pathological bone loss (Cochran, 2008). Osteoclasts are mainly differentiated from precursor cells of the myeloid/monocytic lineage of hematopoietic stem cells (HSCs), termed osteoclast precursors (OCPs), through the combined action of Macrophage Colony-Stimulating Factor (M-CSF) and Receptor Activator of Nuclear Factor κ B Ligand (RANKL) (Teitelbaum & Ross, 2003). Although numerous studies have demonstrated an indispensable role of osteoclasts in the pathogenesis of inflammatory bone loss, the characterization and regulation of OCPs in inflammatory settings are still obscure.

Myeloid/monocytic cells are highly plastic and versatile cells capable of responding and adapting to environmental cues. Under normal conditions, the differentiation of osteoclasts is limited to a small fraction of myeloid/monocytic cells presented in the bone marrow (BM) and peripheral blood (PB). However, chronic inflammation arising in a wide range of diseases may trigger myeloid-biased differentiation of HSCs and increase the abundance and osteoclastogenic capability of OCPs within BM and circulation. In this regard, studies have shown that PB cells from patients with periodontitis have increased osteoclastogenic potential than those from periodontal healthy subjects (Herrera et al., 2014). In addition, elevated levels and augmented osteoclastogenic activity of circulating OCPs have been reported in individuals diagnosed with arthritis and late-stage chronic kidney disease. (Cafiero et al., 2018; Chiu et al., 2010).

Various myeloid subpopulations have been shown to contain osteoclastogenic potential. We have previously shown in a mouse calvarial infection model that infection with Porphyromonas gingivalis (Pg), a keystone pathogen of periodontitis, up-regulates the number and the osteoclastogenesis of CD11b+c-fms+ cells in BM and spleens (Cai et al., 2020). Recently, using a subcutaneous pump model, we further demonstrated that chronic Pg infection significantly augments the frequency and osteoclastogenesis of the Ly6Chi subpopulation of CD11b+c-fms+ cells in BM, spleen, and the circulation of infected mice (Zhao et al., 2020). In addition, CD11b+c-fms+Ly6Chi cells from infected mice exhibit a unique gene expression pattern in comparison to cells from uninfected mice. Others have later reported similar findings linking these CD11b+c-fms+Ly6Chi cells as the primary OCPs in response to chronic inflammation (Das et al., 2021). These findings suggest a central role of CD11b+c-fms+Ly6Chi OCPs in inflammatory bone loss, as well as the potential of using OCPs as biomarkers for detection of inflammatory bone loss or as therapeutic targets for the amelioration of inflammatory bone loss. Therefore, it is essential to further delineate the molecular mechanism underlying the regulation of OCPs in chronic infection and inflammation, since this could help the development of novel therapeutic targets to curb inflammatory bone loss.

Liver-X receptors (LXRs), comprising the LXRα (NR1H3) and LXRβ (NR1H2) isotypes, are members of the nuclear hormone receptor family of transcription factors that regulate cholesterol, fatty acid, and glucose metabolism (Hong & Tontonoz, 2014). LXRs also play a critical role in regulating inflammation and immune responses (Goel & Vohora, 2021; Zelcer & Tontonoz, 2006). Pharmacological activation of LXRs was found to modulate multiple inflammatory disorders and elicit anti-tumor effects in animal models and patients (Tavazoie et al., 2018). Furthermore, LXRs are believed to play a crucial role in both physiological and pathological bone turnover (Goel & Vohora, 2021). Activation of LXRs was found to inhibit osteoclast differentiation and inflammatory bone loss (H. J. Kim et al., 2013; Kleyer et al., 2012; Remen, Henning, Lerner, Gustafsson, & Andersson, 2011). However, others have shown contradictory results of LXR signaling on osteoclast differentiation and bone loss (Kleyer et al., 2012; Robertson et al., 2006). And no studies have investigated if LXRs are able to regulate OCPs. Interestingly, we have recently shown that chronic Pg infection significantly down-regulates the gene expression of ApoE, a transcriptional target of LXRs, in OCPs (Zhao et al., 2020). In addition, others have shown that LXRs are important for maintaining the balance of hematopoietic populations (Rasheed, Tsai, & Cummins, 2018) and abrogation of LXRs increases the number of myeloid progenitor populations (B. Li et al., 2021). These data suggest that LXRs are involved in the modulation of OCPs.

In this study, we investigated the role of LXRs in regulating CD11b+c-fms+Ly6Chi OCP abundance and function under Pg-infected and in ligature-induced periodontitis. We demonstrated that activation of LXRs using a nonsteroid LXR-selective activator can suppress OCP abundance and osteoclastogenic potential, and consequently protect against periodontal bone loss. These findings provide new insight into our understanding of OCP regulation under infection and inflammatory conditions and underpin the crosstalk between lipid metabolism signaling and inflammatory osteoclastogenic signaling.

MATERIALS AND METHODS

2.1. Animals

C57BL/6 mice (8-12 weeks of age) were bred and housed in an environmentally controlled facility at the University of Alabama at Birmingham (UAB). All animal experiments were approved by the UAB Institutional Animal Care and Use Committee and followed the National Institute of Health (NIH) guidelines.

2.2. Bacterial culture conditions

Pg ATCC 33277 were cultured and maintained on enriched trypticase soy agar plates supplemented with 1% yeast extract, 5 μg/ml hemin, and 1 μg/ml menadione (TSYHM), as well as 5% defibrinated sheep blood, at 37°C in an anaerobic atmosphere of 10% H2, 5% CO2, and 85% N2. To prepare Pg for infection, Pg were cultured in TSYHM broth, bacteria cells were collected by centrifugation in PBS, and quantified by measuring the optical density at 600 nm and extrapolating with a standard curve (Zhao et al., 2020).

2.3. Pg infection model

A micro-osmotic pump system (model 1002; Alzet Osmotic Pumps, Cupertino, CA, USA) was used for Pg infection (Zhao et al., 2020). Mice were anesthetized via intraperitoneal injection of ketamine (100 mg/kg of body weight) and xylazine (50 mg/kg) and prepared for the dorsolumbar implantation of the pump (1 pump/mouse). The pump in infected mice contained 100 µl of Pg in PBS (2 × 1010 CFU/ml) while control mice were implanted with pumps containing PBS only. Groups of Pg-infected were given LXR agonist GW3965 (Selleck Chemicals LLC, Houston, TX, USA) daily (40 mg/kg in corn oil) via oral gavage. Mice were sacrificed on day 14.

2.4. Ligature-induced periodontitis model

Mice were anesthetized as described above. Ligature (5-0 silk) was placed around the maxillary right second molar, and the contralateral molar tooth was left un-ligated (Abe & Hajishengallis, 2013). Groups of ligated mice were given GW3965 daily (40 mg/kg in corn oil) via oral gavage. Ligatures were maintained in position throughout the whole experimental period. To determine ligature-induced periodontal inflammation and bone loss, mice were euthanized after 7 days of ligature placement. To determine the regulation of OCPs in the BM and periodontium, mice were euthanized at 3, 7 or 14 days after ligature placement. Untreated mice were included as baseline controls.

2.5. Flow cytometry analysis and cell sorting

For the Pg infection model, BM and spleen cells were isolated and prepared as described previously (Zhao et al., 2020). Briefly, BM cells flushed from the femur and tibiae, and spleen were mechanically dispersed or minced through a 100-μm cell strainer to prepare single-cell suspensions. Erythrocytes in the cell suspensions were removed with Lyse lysis buffer (BD Biosciences).

For the ligature-induced periodontitis model, periodontal tissues were collected and cut into 1-2 mm2 pieces and digested in digestion medium consisting of 2 mg/ml collagenase II, 1mg/ml DNase I in FACS buffer (PBS containing 3% bovine serum albumin) (Mizraji, Segev, Wilensky, & Hovav, 2013). The digestion was done at 37°C with shaking at 200 rpm for 20 min and was terminated by addition of EDTA (5 mM). The periodontal cells were collected after filtering through a 70-um cell strainer. BM cells were also harvested from ligature-induced periodontitis model as described above.

Subsequently, BM, spleen, and periodontal cells were suspended in FACS buffer and stained with CD11b (M1/70)-FITC (11-0112-82), CD11b (M1/70)-PE (12-0112-82), CD115 (c-fms) (AFS98)-APC (17-1152-82), and Ly-6C (HK1.4)-PE-Cyanine7 (25-5932-82) (eBioscience, Waltham, MA, USA). Analysis was done using a flow Symphony cytometer (BD Biosciences), and data was analyzed using FlowJo (FlowJo, LLC, Ashland, OR). Cell sorting was done on a FACS Aria II system (BD Bioscience).

2.6. Generation of BM-derived macrophages (BMMs)

Mouse BM cells were collected and lysed as described above and were cultured in α-MEM medium supplemented with 10% FCS and 1% Pen-Strep in a humidified 5% CO2 incubator at 37°C overnight. Non-adherent cells were harvested and cultured with α-MEM medium supplemented with 10% FCS, 1% Pen-Strep, and 10% M-CSF. After 4 days of culturing, adherent cells were collected as BMMs (Chen et al., 2015).

2.7. In vitro osteoclastogenesis assay

To induce osteoclast formation, BM and spleen cells isolated from Pg-infected model were cultured in 24-well plates at a density of 1x105 cells/well (BM) or 2x105 cells/well (spleen) in α-MEM supplemented with 10% FBS, 5% M-CSF, and 100 ng/ml RANKL for 5 - 7 days, as described previously (Zhao et al., 2020). Sorted BM cells were cultured in 96-well plates at a density of 104 cells/well for a period of 4 - 6 days. Osteoclast formation was evaluated by staining for tartrate-resistant acid phosphatase (TRAP) activity using a leukocyte acid phosphatase kit (Sigma, St. Louis, MO, USA). TRAP+ mononuclear cells (MNCs) with ≥3 nuclei were counted as osteoclasts.

To evaluate the effect of GW3965 on osteoclast formation in vitro, BMMs (5x104 cells/well in 24-well plates) were cultured in osteoclastogenic medium in the presence or absence of GW3965 (10 µM) or vehicle for 4-5 days and TRAP+ osteoclast formation was assessed.

2.8. Enzyme-linked immunosorbent assay (ELISA)

BMMs were cultured with Pg (MOI =50) in the presence or absence of GW3965 (10 µM) or vehicle for 24 h. The levels of IL-6 and TNF-α in the culture supernatants were analyzed by ELISA using kits (Invitrogen), according to the manufacturer’s instructions.

2.9. Micro-computed tomography (µCT) analysis

To evaluate alveolar bone loss, the maxillae were isolated and fixed in 4% paraformaldehyde, and then stored in 70% Ethanol at 4°C. A Scanco µCT40 desktop cone-beam µCT scanner (Scanco Medical AG, Brüttisellen, Switzerland) was used to scan fixed maxillae. The scanning was conducted at 8 µm resolution, 70 kVp, 114 µA with an integration time of 200 ms. Scans were automatically constructed into 2-D slices and analyzed using the µCT Evaluation Program (v.6.5-2, Scanco Medical). The distances between the cementoenamel junction (CEJ) and alveolar bone crest (ABC) in the buccal surfaces of the second maxillary molar were measured in 3-D reconstructed images.

2.10. Quantitative PCR (qPCR) analysis

Periodontal tissues were collected and stored in 200 µl RNA-later solution at 4°C overnight, and then frozen at −80°C. To extract RNA, periodontal tissues were mechanically minced with Trizol and stainless-steel beads using Bead Mill 4 machine, followed by centrifugation at 10,000 rpm/min. Total RNA was extracted from supernatants using a Direct-zol RNA Miniprep Plus kit (ZYMO RESEARCH, Irvine, CA, USA), and reversed transcribed to cDNA using a PrimeScript III RT reagent kit (Takara Bio, Mountain View, CA, USA). qPCR was done using TB GreenTM Advantage qPCR Premix (Takara Bio) on an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). Primers used are listed in Table 1.

Table 1.

Primer sequences for qPCR.

Gene Forward primer (5ʹ to 3ʹ) Reverse primer (5ʹ to 3ʹ)
Lxrα GAGTTGTGGAAGACAGAACCTCAA GGGCATCCTGGCTTCCTC
Lxrβ CCCCACAAGTTCTCTGGACAC TGGCGGAGGTACTGGGC
Apoe GACCCAGCAAATACGCCTG CATGTCTTCCACTATTGGCTCG
c-fms TGCTGGCCACAGTTTGGCATG CTTTGACATACAAGTGGATGGT
IL-6 TGGAGTCACAGAAGGAGTGGCTAAG TCTGACCACAGTGAGGAATGTCCAC
TNF-α CCCTCACACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG
β-actin CCTTCAACACCCCAGCCATGTACG GGCACAGTGTGGGTGACCCCGTC

2.11. Statistical analysis

Results are expressed as mean ± SD. Statistical significance was analyzed by a 2-tailed Student’s t-test or ANOVA using GraphPad Prism 8 (San Diego, CA). A P value less than 0.05 was considered statistically significant.

RESULTS

3.1. LXR activation reduces Pg-induced accumulation of CD11b+c-fms+Ly6Chi cells in BM and spleen

We have recently showed that Pg infection significantly elevates the abundance of CD11b+c-fms+Ly6Chi OCPs in BM, spleen, and PB (Zhao et al., 2020). In addition, these cells demonstrated enhanced osteoclastogenic activity, as well as a distinctive gene profile by RNA-seq analysis. Among the differentially regulated genes, we found that ApoE gene expression was significantly downregulated in these OCPs following Pg infection. Since ApoE is a direct transcriptional target of LXRs in macrophages, we also evaluated the gene expression of LXRα and LXRβ in OCPs. We found that the expression of LXRα and LXRβ mRNA was significantly down-regulated in CD11b+c-fms+Ly6Chi cells from Pg-infected mice, as shown by RNA-seq and qPCR analysis (Figure 1a). These results suggest that the LXR/ApoE axis is involved in Pg-mediated regulation of OCPs.

FIGURE 1.

FIGURE 1.

LXR activation reduces Pg-induced expansion of the CD11b+c-fms+Ly6Chi cells in bone marrow (BM) and spleen (SPL). (a) Heatmap of Lxrα and Lxrβ gene expression, and mRNA levels of Lxrα and Lxrβ in SPL CD11b+c-fms+Ly6Chi cells of control mice (Ctrl) and mice infected with Pg (Pg). (b) Schematic diagram depicting the experimental design. (c) ApoE gene expression in SPL CD11b+c-fms+Ly6Chi (Ly6Chi) cells from Ctrl, Pg, and Pg-infected and GW3965-treated (Pg+GW) groups. (d) Representative flow cytometry analysis illustrating the percentage of various BM myeloid cell populations in Ctrl, Pg, and Pg+GW groups. (e) Representative flow cytometry analysis illustrating the percentage of various SPL myeloid cell populations in Ctrl, Pg, and Pg+GW groups. *P < 0.05, **P < 0.01, ***P < 0.001.

To explore how LXRs affect Pg-mediated regulation of OCPs, Pg-infected mice were treated with LXRs selective agonist GW3965 or vehicle (Figure 1b). As shown in Figure 1c, GW3965 significantly increased gene expression of ApoE in CD11b+c-fms+Ly6Chi OCPs. In addition, GW3965 significantly reduced Pg-induced accumulation of CD11b+c-fms+ and CD11b+c-fms+Ly6Chi cells in BM and spleen (Figure 1de). These findings indicate that activation of LXRs can suppress Pg-induced OCP expansion in BM and spleen.

3.2. LXR activation impairs Pg-induced enhancement of osteoclastogenesis of BM and spleen CD11b+c-fms+Ly6Chi cells

Since activation of LXRs suppresses Pg-induced accumulation of OCPs in BM and spleen, we next evaluated the ex vivo osteoclastogenesis of BM and spleen cells derived from Pg-infected mice with or without GW3965 treatment. As expected, an enhanced osteoclast potential was seen in BM and spleen cells from Pg-infected mice compared to the cells from uninfected mice (Figure 2ab). However, a significantly decreased number of osteoclast formation was seen in BM and spleen cells from infected mice treated with GW3965 compared to the cells from infected mice without GW3965 treatment.

FIGURE 2.

FIGURE 2.

LXR activation impairs Pg-mediated enhancement of osteoclastgenesis of OCPs in BM and SPL. (a) Representative TRAP staining of BM and SPL cells from Ctrl, Pg, and Pg+GW mice on day 5 (BM) and day 6 (SPL). (b) Quantification of TRAP+ multinucleated cells (MNCs) in BM and SPL cell cultures. (c) Representative TRAP+ staining in the cultures of the BM CD11b+c-fms+Ly6Chi cells from Ctrl, Pg, and Pg+GW mice. (d) Quantification of TRAP+ MNCs in BM CD11b+c-fms+Ly6Chi cell cultures from Ctrl, Pg, and Pg+GW mice. Scale bar, 500 μm. *P < 0.05, **P < 0.01, ***P < 0.001.

To further assess whether LXR activation influences the osteoclastogenic potential of OCPs in the context of Pg infection, CD11b+c-fms+Ly6Chi cells sorted from BM were evaluated for RANKL-induced osteoclast differentiation. Consistent with our previous results, CD11b+c-fms+Ly6Chi cells from Pg-infected mice exhibited a substantial enhanced ability to differentiate into osteoclasts compared to those cells from uninfected mice (Figure 2cd). However, GW3965 treatment of mice significantly suppressed the ex vivo osteoclastogenic activity of CD11b+c-fms+Ly6Chi cells increased by Pg infection (Figure 2cd). These results demonstrate that activation of LXRs not only inhibits Pg-induced OCP expansion in BM and spleen, but also impairs Pg-induced enhancement of osteoclastogenic potential of OCPs.

3.3. LXR activation suppresses RANKL-induced osteoclast differentiation from uncommitted OCPs in vitro

In our previous study, we have shown that OCPs derived from BMMs exhibit dual differentiation pathways in vitro: they either differentiate into inflammatory macrophages upon Pg stimulation or differentiate into osteoclasts following RANKL treatment (Chen et al., 2015). In addition, Pg has a biphasic role in RANKL-indued osteoclast differentiation: it inhibits osteoclast differentiation from un-committed OCPs, while promoting osteoclast differentiation from RANKL-committed OCPs. Activation of LXRs has been shown to inhibit osteoclast differentiation in vitro (H. J. Kim et al., 2013). However, it is not clear if activation of LXRs inhibits osteoclast formation in both un-committed and RANKL-committed states. To answer this question, BMMs were treated with GW3965 at different stages of osteoclast differentiation (Figure 3a). BMMs pre-treated with GW3965 or treated with RANKL and GW3965 at the same time significantly suppressed RANKL-induced osteoclast differentiation (Figure 3a). However, when BMMs were pretreated with RANKL for 24 h and then treated with GW3965, no inhibition of RANKL-induced osteoclast formation was observed. These results indicate that LXRs are mainly involved in RANKL-induced lineage commitment of OCPs.

FIGURE 3.

FIGURE 3.

LXR agonist inhibits RANKL-induced osteoclast formation and Pg-induced cytokine production. (a) Representative TRAP+ MNCs in cultures of BM-derived macrophages (BMMs) in un-committed and RANKL-committed conditions in the presence of GW3965 (10 µM). (b) Pg-induced IL-6 and TNF-α production in the presence of GW3965 (10 µM). Scale bar, 500 μm. *P < 0.05, ***P < 0.001.

We also determined the role of LXR activation on Pg-induced cytokine production by BMMs. Treatment of BMMs with GW3965 led to a significant decrease in IL-6 and TNF-α production (Figure 3b). These results indicate that LXR activation regulates both the inflammatory and osteoclastogenic potentials of OCPs.

3.4. Ligature-induced periodontitis promotes OCP accumulation in BM and periodontal tissue

The ligature model is one of the most widely used periodontitis models to induce alveolar bone loss in a short period of time. To understand how periodontal inflammation affects OCPs, a ligature was placed and maintained around the maxillary right second molar of mice, whereas the contralateral side was left untreated. The presence of CD11b+c-fms+ and CD11b+c-fms+Ly6Chi cells in BM and periodontal tissue was analyzed at different timepoints. Ligature placement was able to significantly increase the percentages of CD11b+c-fms+ and CD11b+c-fms+Ly6Chi cells in BM following 3 days of ligature placement (Figure 4a). Sustained ligature placement for 7 and 14 days did not further increase the accumulation of OCPs in BM. A time-dependent increase in the percentage of CD11b+c-fms+ and CD11b+c-fms+Ly6Chi cells was noted in the periodontium from both the ligated and un-ligated sides (Figure 4b). A notable increase in the percentage of CD11b+c-fms+ and CD11b+c-fms+Ly6Chi cells was seen on day 14 in the un-ligated side compared to naïve controls. In addition, higher frequencies of OCPs were seen in the un-ligated side of the ligated mice compared to naïve mice. It is possible that in the ligated side, OCPs may differentiate into macrophages or osteoclasts in the presence of infection and inflammation, leading to their lower frequencies compared to the un-ligated side. Taken together, our results indicate that periodontal inflammation can increase the abundance of OCPs not only locally in the periodontium but also systemically in BM.

FIGURE 4.

FIGURE 4.

OCP profile in BM and periodontal tissues in the ligature-induced periodontitis model. (a) Flow cytometry anaysis of OCPs in BM of naive controls (NC) and ligature-placed mice (Lig) at different time points. (b) Flow cytometry anaysis of OCPs in periodontal tissue (Perio) of NC, un-ligated sided (uLS), and ligated side (LS) at different time points. *P < 0.05, **P < 0.01, ***P < 0.001.

3.5. LXR agonist protects against periodontal bone loss and decreases the abundance of OCPs in BM and periodontal tissue

We next determined the effect of the LXR agonist on ligature-induced periodontal bone loss, as well as on OCP accumulation in BM and periodontal tissue. Mice were given daily GW3965 or vehicle via the oral route, and a ligature was placed and maintained around the maxillary right second molars for 7 or 14 days (Figure 5a). Significant alveolar bone loss was induced following 7 days in the ligated side compared to the un-ligated side in the vehicle-treated mice (Figure 5bc). GW3965 treatment significantly reduced ligature-induced alveolar bone loss. Furthermore, ligature placement suppressed gingival ApoE gene expression in both the ligated sides and un-ligated sides compared to the negative controls. GW3965 treatment increased gingival ApoE gene expression in periodontal tissue (Figure 5d). Interestingly, GW3965 treatment failed to inhibit the expression of inflammatory cytokine genes including IL-6 and TNF-α (Figure 5d), as well as IL-1β and IL-17 (data not shown) in the gingiva following ligature placement. Nevertheless, we found that ligature placement significantly increased gingival c-fms mRNA expression, whereas GW3965 treatment significantly decreased c-fms gene expression in ligated periodontal tissue (Figure 5d). Moreover, GW3965 treatment significantly decreased the percentage of OCPs in BM, as well as in periodontal tissue in both the un-ligated and ligated sides (Figure 5ef). These findings suggest that LXR activation protects against periodontal bone loss at least partially via inhibition of c-fms expression and local and systemic OCP accumulation.

FIGURE 5.

FIGURE 5.

LXRs agonist protects against periodontal bone loss and decreases local and systemic OCPs. (a) Diagram of experimental design in ligature-induced periodontitis mice model. (b) Representative 3-D µCT images of maxilla from ligated (Lig) and Lig+GW mice. (c) Cementoenamel junction distances (CEJ-ABC) of Lig and Lig+GW mice. (d) mRNA levels of Apoe, c-fms, IL-6 and TNF-α in periodontal tissues from NC, un-ligated side (uLS) and ligated side (LS) of Lig and Lig+GW mice. (e) Flow cytometry anaysis of OCP populations in BM of Lig and Lig+GW mice. (f) Flow cytometry anaysis of OCP populations in periodontal tissues from NC, uLS, and LS of Lig and Lig+GW mice. Scale bar, 1 mm. *P < 0.05, **P < 0.01, ***P < 0.001.

DISCUSSION

Periodontitis is an infectious disease that is primarily caused by microbial dysbiosis and chronic inflammation and is characterized by the irreversible loss of alveolar bone. Understanding the underlying mechanisms that lead to bone loss is crucial for advancing our knowledge of the pathogenesis and promoting effectual strategies for prevention and treatment of the disease. Our previous study demonstrated that Pg infection results in a substantial elevation in the abundance of CD11b+c-fms+Ly6Chi OCP cell in BM and periphery (Zhao et al., 2020). Moreover, these cells presented increased osteoclastogenic activity and a distinctive gene profile following infection. Here we investigated the impact of LXR activation on the frequency and function of OCPs in Pg-infected conditions and in the ligature-induced periodontitis model. We found that LXR agonist GW3965 significantly decreased Pg-induced OCP expansion and osteoclastogenesis. It also suppressed OCP accumulation locally in periodontal tissue and systemically in BM. Furthermore, it protected against alveolar bone loss in the ligature-induced periodontitis model.

As crucial regulators of cholesterol and lipid metabolism, emerging evidence also indicates the involvement of LXR signaling in modulating inflammation and bone remodeling. For instance, studies have shown that LXR signaling is upregulated in synovial macrophages in rheumatoid arthritis and activation of LXRs exacerbated articular inflammatory response in mouse model of rheumatoid arthritis (Asquith et al., 2013). In addition, activation of LXRs has been found to suppress the production of pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α in macrophages and other immune cells (Bi et al., 2016; Myhre et al., 2008). Other have shown that LXR activation reduced Pg-induced TNF-α production but not IL-6 production in BMMs, whereas LXR ablation had no effect on Pg-induced TNF-α production but significantly reduced Pg-induced IL-6 production (Huang, Shaik-Dasthagirisaheb, LaValley, & Gibson, 2015). It has also been reported that long term LXR activation potentiates pro-inflammatory cytokine secretion in LPS-stimulated human macrophages (Fontaine et al., 2007). Others have reported that LXR activation does not alter the secretion of pro-inflammatory cytokines in macrophages following inflammatory stimulation (H. A. Kim, Baek, Han, Jung, & Suh, 2019). In the context of bone remodeling, LXRs have been found to play a dual role on osteoblasts and osteoclasts. Remen et al. (Robertson et al., 2006) has shown that in the absence of LXRs, mice had increased bone mineral density due to impaired osteoclast activity and increased bone formation, suggesting that the presence of LXRs supports osteoclast activity. However, this group later showed that LXR agonist GW3965 potently inhibited osteoclast differentiation in vitro via LXRβ-dependent pathway (Robertson Remen, Lerner, Gustafsson, & Andersson, 2013), suggesting that the presence of endogenous LXRs could have a different effect on bone regulation compared to that of exogenous activation of LXRs. Others demonstrated that LXR activation inhibited osteoclastogenesis by restraining NF-κB and c-fos activity (H. J. Kim et al., 2013). In addition, studies have shown that treatment with LXR agonist could prevent joint destruction in collagen-induced arthritis (Park, Kwon, Chung, Park, & Lee, 2010), LPS-induced bone loss (H. J. Kim et al., 2013), and ovariectomy-induced bone loss in mice (Kleyer et al., 2012). Therefore, the overall impact of LXRs on inflammatory bone loss seems to depend on the specific cellular and molecular context.

In our study, we showed that Pg infection and periodontal inflammation significantly down-regulated LXR and its downstream target ApoE gene expression in OCPs and in periodontium, respectively. Consistently with our results, previous studies have shown that Pg stimulation limited LXRα and LXRβ gene expression in BMMs (Huang et al., 2015), and that oral Pg infection down-regulated LXRα and LXRβ gene expression in aorta (Maekawa et al., 2011). We also showed that LXR agonist GW3965 significantly down-regulated Pg-induced IL-6 and TNF-α production in BMMs. However, GW3965 treatment failed to inhibit gingival IL-6 and TNF-α gene expression but mitigated periodontal bone loss in ligature-induced periodontitis. Interestingly, it has been reported that ablation of LXR increased alveolar bone loss compared to WT mice, whereas no increase in Pg-induced alveolar bone loss were seen in LXRα/β knock out mice compared to WT mice following Pg infection (Huang et al., 2015). Others (Kajikawa et al., 2020) have shown that treatment with GW3965 by periodontal microinjection failed to reduce the gingival inflammatory gene expression and alveolar bone loss developed in CD18−/− mice. It is possible that the variation in the effects of LXRs in inflammation and osteoclastogenesis could be due to the use of different models, and/or the distinct routes or doses of GW3965 was given.

While no significant difference was observed in several inflammatory cytokine gene expression in periodontium following GW3965 treatment, we found that GW3965 treatment significantly decreased OCP abundance systemically in BM and locally in the periodontium. Additionally, we demonstrated in a subcutaneous pump infection model that treatment with GW3965 significantly suppressed Pg-induced OCP expansion in BM and spleen, and reduced the osteoclastogenesis of OCPs following Pg infection. Interestingly, LXRs have been implicated in the fate of myeloid cells. It has been shown that loss of LXRα/β disrupted the balance of hematopoietic population and increased BM and PB myeloid cell numbers (Rasheed et al., 2018). Others have also shown that loss of LXRα resulted in an increased accumulation of myeloid-derived suppressor cells (MDSCs) in liver (B. Li et al., 2021), and that activation of LXR decreased MDSC abundance in animal models and in individuals treated in a clinical trial (Tavazoie et al., 2018). We have shown previously a great overlap of MDSCs and OCPs and the osteoclastogenic potential of MDSCs (Cai et al., 2020; Z. Li et al., 2021; Su, Xu, Zhang, Michalek, & Katz, 2017). Therefore, our results suggest that GW3965 mitigates ligature-induced periodontal bone loss by down-regulation of the frequency of OCPs and their osteoclastogenic potential.

In ligature-induced periodontitis model, a transition from commensal to pathogenic oral microbiome takes place in periodontium, resulting in periodontal inflammation and systemic dissemination of inflammation (Hajishengallis & Chavakis, 2021). Along this line, ligature-indued periodontitis can induce a sustained increase in myelopoiesis (Li et al., 2022). Thus, it is possible that systemic dissemination of inflammation underlines OCP accumulation in the BM and periodontium in periodontitis. We have previously shown that IL-6 is involved in Pg-induced expansion of OCPs in BM and periphery (Zhao et al., 2020). However, we didn’t observe a down-regulation of serum IL-6 level in Pg-infected mice following GW 3965 treatment (data not shown), suggesting that IL-6 may be not involved in LXR-mediated regulation of OCPs in our Pg-infected model. Minimal serum IL-6 was detected in the ligature model (data not shown). Therefore, it is possible that inflammatory signaling other than IL-6 may be also involved in the regulation of OCPs. It is also worthy to point out that in our studies, we observed higher frequencies of OCPs in the un-ligated side compared to the ligated side. These results suggest that periodontal tissues from healthy teeth in subjects with periodontitis may have an altered immune profile compared to periodontal tissues from healthy subjects.

In agreement with other investigation showing that GW3965 effectively suppresses osteoclast differentiation at an early stage (H. J. Kim et al., 2013), our in vitro studies demonstrated that GW3965 treatment inhibited osteoclast differentiation at the early stage of RANKL treatment but had minimal effect following 24 h of RANKL-treatment. Yet others have reported that GW3965 treatment of BMMs at early stage (day 0-2) did not affect osteoclast formation but had an inhibitory effect when BMMs were treated from days 2 to 3, and a weak effect was noted at days 3–4 (Remen et al., 2011). Noteworthy, we further observed that c-fms gene expression was significantly down-regulated in the periodontium following GW3965 treatment. c-fms, the receptor of M-CSF, is expressed exclusively by the lineage of mononuclear phagocyte cells and is essential for macrophage and osteoclast differentiation (Lei et al., 2020). Studies have shown that c-fms-deficient mice and individuals have osteoclast deficiency and exhibit severe osteopetrosis (Zhu et al., 2021). In addition, c-fms kinase inhibitors and anti-c-fms antibodies inhibited the number and/or the function of osteoclasts with subsequent reduced bone loss in animal models (Hume, Batoon, Sehgal, Keshvari, & Irvine, 2022). Therefore, it is possible that in our studies, GW3965 suppressed the number and/or function of osteoclasts in alveolar bone via the downregulation of c-fms.

In summary, our results revealed that LXR signaling plays a crucial role in regulating c-fms expression and the abundance of OCPs, which may ultimately protect against periodontal bone loss. However, the role of LXR signaling in regulating inflammatory bone loss is still an area of ongoing research, and the exact mechanisms underlying its regulation in this context are not yet fully understood. Given the importance of LXR signaling in cholesterol/lipid metabolism and the crosstalk between cholesterol/lipid metabolism and bone metabolism, it is also possible that altered cholesterol/lipid metabolism may be involved in LXRs-mediated modulation of osteoclasts and bone loss. Further research is necessary to fully understand the role of LXRs in inflammatory bone loss and its implications for disease prevention/amelioration and management.

ACKNOWLEDGMENTS

We thank Greg Harber for his technical assistance. This study was supported by a grant from the National Institute of Dental and Craniofacial Research (NIDCR) (R01 DE026465 to P.Z), a pilot grant from UAB Global Center for Craniofacial, Oral and Dental Disorders (to P. Z.), and a NIDCR Dental Academic Research Training grant (R90 DE023056 to Y.Z. and A.F.). UAB Comprehensive Flow Cytometry Core is supported by the National Institutes of Health grants P30AI27667 and P30AR048311.

Abbreviations:

ABC

alveolar bone crest

BM

bone marrow

CEJ

cementoenamel junction

HSCs

hematopoietic stem cells

LXRs

liver X receptors

M-CSF

macrophage colony-stimulating factor

MDSCs

myeloid-derived suppressor cells

OCPs

osteoclast precursors

PB

peripheral blood

Pg

Porphyromonas gingivalis

RANKL

receptor activator of NF-κB ligand

TRAP

tartrate-resistant acid phosphatase

Footnotes

CONFLICT OF INTEREST STATEMENT

All authors declare no conflict of interest.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Abe T, & Hajishengallis G (2013). Optimization of the ligature-induced periodontitis model in mice. J Immunol Methods, 394(1-2), 49–54. doi: 10.1016/j.jim.2013.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Asquith DL, Ballantine LE, Nijjar JS, Makdasy MK, Patel S, Wright PB, … McInnes IB. (2013). The liver X receptor pathway is highly upregulated in rheumatoid arthritis synovial macrophages and potentiates TLR-driven cytokine release. Ann Rheum Dis, 72(12), 2024–2031. doi: 10.1136/annrheumdis-2012-202872 [DOI] [PubMed] [Google Scholar]
  3. Bi X, Song J, Gao J, Zhao J, Wang M, Scipione CA, … Fu G. (2016). Activation of liver X receptor attenuates lysophosphatidylcholine-induced IL-8 expression in endothelial cells via the NF-kappaB pathway and SUMOylation. J Cell Mol Med, 20(12), 2249–2258. doi: 10.1111/jcmm.12903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cafiero C, Gigante M, Brunetti G, Simone S, Chaoul N, Oranger A, … Gesualdo L. (2018). Inflammation induces osteoclast differentiation from peripheral mononuclear cells in chronic kidney disease patients: crosstalk between the immune and bone systems. Nephrol Dial Transplant, 33(1), 65–75. doi: 10.1093/ndt/gfx222 [DOI] [PubMed] [Google Scholar]
  5. Cai X, Li Z, Zhao Y, Katz J, Michalek SM, Feng X, … Zhang P. (2020). Enhanced dual function of osteoclast precursors following calvarial Porphyromonas gingivalis infection. J Periodontal Res, 55(3), 410–425. doi: 10.1111/jre.12725 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen Z, Su L, Xu Q, Katz J, Michalek SM, Fan M, … Zhang P. (2015). IL-1R/TLR2 through MyD88 Divergently Modulates Osteoclastogenesis through Regulation of Nuclear Factor of Activated T Cells c1 (NFATc1) and B Lymphocyte-induced Maturation Protein-1 (Blimp1). J Biol Chem, 290(50), 30163–30174. doi: 10.1074/jbc.M115.663518 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chiu YG, Shao T, Feng C, Mensah KA, Thullen M, Schwarz EM, & Ritchlin CT (2010). CD16 (FcRgammaIII) as a potential marker of osteoclast precursors in psoriatic arthritis. Arthritis Res Ther, 12(1), R14. doi: 10.1186/ar2915 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cochran DL (2008). Inflammation and bone loss in periodontal disease. J Periodontol, 79(8 Suppl), 1569–1576. doi: 10.1902/jop.2008.080233 [DOI] [PubMed] [Google Scholar]
  9. Das A, Wang X, Kang J, Coulter A, Shetty AC, Bachu M, … Thumbigere-Math V. (2021). Monocyte Subsets With High Osteoclastogenic Potential and Their Epigenetic Regulation Orchestrated by IRF8. J Bone Miner Res, 36(1), 199–214. doi: 10.1002/jbmr.4165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fontaine C, Rigamonti E, Nohara A, Gervois P, Teissier E, Fruchart JC, … Chinetti-Gbaguidi G. (2007). Liver X receptor activation potentiates the lipopolysaccharide response in human macrophages. Circ Res, 101(1), 40–49. doi: 10.1161/CIRCRESAHA.106.135814 [DOI] [PubMed] [Google Scholar]
  11. Goel D, & Vohora D (2021). Liver X receptors and skeleton: Current state-of-knowledge. Bone, 144, 115807. doi: 10.1016/j.bone.2020.115807 [DOI] [PubMed] [Google Scholar]
  12. Hajishengallis G, & Chavakis T (2021). Local and systemic mechanisms linking periodontal disease and inflammatory comorbidities. Nat Rev Immunol, 21(7), 426–440. doi: 10.1038/s41577-020-00488-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Herrera BS, Bastos AS, Coimbra LS, Teixeira SA, Rossa C Jr., Van Dyke TE, … Spolidorio LC. (2014). Peripheral blood mononuclear phagocytes from patients with chronic periodontitis are primed for osteoclast formation. J Periodontol, 85(4), e72–81. doi: 10.1902/jop.2013.130280 [DOI] [PubMed] [Google Scholar]
  14. Hong C, & Tontonoz P (2014). Liver X receptors in lipid metabolism: opportunities for drug discovery. Nat Rev Drug Discov, 13(6), 433–444. doi: 10.1038/nrd4280 [DOI] [PubMed] [Google Scholar]
  15. Huang N, Shaik-Dasthagirisaheb YB, LaValley MP, & Gibson FC 3rd. (2015). Liver X receptors contribute to periodontal pathogen-elicited inflammation and oral bone loss. Mol Oral Microbiol, 30(6), 438–450. doi: 10.1111/omi.12103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hume DA, Batoon L, Sehgal A, Keshvari S, & Irvine KM (2022). CSF1R as a Therapeutic Target in Bone Diseases: Obvious but Not so Simple. Curr Osteoporos Rep, 20(6), 516–531. doi: 10.1007/s11914-022-00757-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kajikawa T, Wang B, Li X, Wang H, Chavakis T, Moutsopoulos NM, & Hajishengallis G (2020). Frontline Science: Activation of metabolic nuclear receptors restores periodontal tissue homeostasis in mice with leukocyte adhesion deficiency-1. J Leukoc Biol, 108(5), 1501–1514. doi: 10.1002/JLB.5HI0420-648R [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kim HA, Baek WY, Han MH, Jung JY, & Suh CH (2019). The Liver X Receptor Is Upregulated in Monocyte-Derived Macrophages and Modulates Inflammatory Cytokines Based on LXRalpha Polymorphism. Mediators Inflamm, 2019, 6217548. doi: 10.1155/2019/6217548 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim HJ, Yoon KA, Yoon HJ, Hong JM, Lee MJ, Lee IK, & Kim SY (2013). Liver X receptor activation inhibits osteoclastogenesis by suppressing NF-kappaB activity and c-Fos induction and prevents inflammatory bone loss in mice. J Leukoc Biol, 94(1), 99–107. doi: 10.1189/jlb.1112601 [DOI] [PubMed] [Google Scholar]
  20. Kleyer A, Scholtysek C, Bottesch E, Hillienhof U, Beyer C, Distler JH, … Kronke G (2012). Liver X receptors orchestrate osteoblast/osteoclast crosstalk and counteract pathologic bone loss. J Bone Miner Res, 27(12), 2442–2451. doi: 10.1002/jbmr.1702 [DOI] [PubMed] [Google Scholar]
  21. Lei F, Cui N, Zhou C, Chodosh J, Vavvas DG, & Paschalis EI (2020). CSF1R inhibition by a small-molecule inhibitor is not microglia specific; affecting hematopoiesis and the function of macrophages. Proc Natl Acad Sci U S A, 117(38), 23336–23338. doi: 10.1073/pnas.1922788117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li B, Lian M, Li Y, Qian Q, Zhang J, Liu Q, … Ma X. (2021). Myeloid-Derived Suppressive Cells Deficient in Liver X Receptor alpha Protected From Autoimmune Hepatitis. Front Immunol, 12, 732102. doi: 10.3389/fimmu.2021.732102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li X, Wang H, Yu X, Saha G, Kalafati L, Ioannidis C, … Hajishengallis G. (2022). Maladaptive innate immune training of myelopoiesis links inflammatory comorbidities. Cell, 185(10), 1709–1727 e1718. doi: 10.1016/j.cell.2022.03.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li Z, Zhao Y, Chen Z, Katz J, Michalek SM, Li Y, & Zhang P (2021). Age-related expansion and increased osteoclastogenic potential of myeloid-derived suppressor cells. Mol Immunol, 137, 187–200. doi: 10.1016/j.molimm.2021.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Maekawa T, Takahashi N, Tabeta K, Aoki Y, Miyashita H, Miyauchi S, … Yamazaki K. (2011). Chronic oral infection with Porphyromonas gingivalis accelerates atheroma formation by shifting the lipid profile. PLoS One, 6(5), e20240. doi: 10.1371/journal.pone.0020240 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Mizraji G, Segev H, Wilensky A, & Hovav AH (2013). Isolation, processing and analysis of murine gingival cells. J Vis Exp(77), e50388. doi: 10.3791/50388 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Myhre AE, Agren J, Dahle MK, Tamburstuen MV, Lyngstadaas SP, Collins AJ, … Wang JE. (2008). Liver X receptor is a key regulator of cytokine release in human monocytes. Shock, 29(4), 468–474. doi: 10.1097/shk.0b013e31815073cb [DOI] [PubMed] [Google Scholar]
  28. Park MC, Kwon YJ, Chung SJ, Park YB, & Lee SK (2010). Liver X receptor agonist prevents the evolution of collagen-induced arthritis in mice. Rheumatology (Oxford), 49(5), 882–890. doi: 10.1093/rheumatology/keq007 [DOI] [PubMed] [Google Scholar]
  29. Rasheed A, Tsai R, & Cummins CL (2018). Loss of the Liver X Receptors Disrupts the Balance of Hematopoietic Populations, With Detrimental Effects on Endothelial Progenitor Cells. J Am Heart Assoc, 7(10). doi: 10.1161/JAHA.117.007787 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Remen KM, Henning P, Lerner UH, Gustafsson JA, & Andersson G (2011). Activation of liver X receptor (LXR) inhibits receptor activator of nuclear factor kappaB ligand (RANKL)-induced osteoclast differentiation in an LXRbeta-dependent mechanism. J Biol Chem, 286(38), 33084–33094. doi: 10.1074/jbc.M111.235937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Robertson KM, Norgard M, Windahl SH, Hultenby K, Ohlsson C, Andersson G, & Gustafsson JA (2006). Cholesterol-sensing receptors, liver X receptor alpha and beta, have novel and distinct roles in osteoclast differentiation and activation. J Bone Miner Res, 21(8), 1276–1287. doi: 10.1359/jbmr.060503 [DOI] [PubMed] [Google Scholar]
  32. Robertson Remen KM, Lerner UH, Gustafsson JA, & Andersson G (2013). Activation of the liver X receptor-beta potently inhibits osteoclastogenesis from lipopolysaccharide-exposed bone marrow-derived macrophages. J Leukoc Biol, 93(1), 71–82. doi: 10.1189/jlb.0712339 [DOI] [PubMed] [Google Scholar]
  33. Su L, Xu Q, Zhang P, Michalek SM, & Katz J (2017). Phenotype and Function of Myeloid-Derived Suppressor Cells Induced by Porphyromonas gingivalis Infection. Infect Immun, 85(8). doi: 10.1128/IAI.00213-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tavazoie MF, Pollack I, Tanqueco R, Ostendorf BN, Reis BS, Gonsalves FC, … Tavazoie SF. (2018). LXR/ApoE Activation Restricts Innate Immune Suppression in Cancer. Cell, 172(4), 825–840 e818. doi: 10.1016/j.cell.2017.12.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Teitelbaum SL, & Ross FP (2003). Genetic regulation of osteoclast development and function. Nat Rev Genet, 4(8), 638–649. doi: 10.1038/nrg1122 [DOI] [PubMed] [Google Scholar]
  36. Zelcer N, & Tontonoz P (2006). Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest, 116(3), 607–614. doi: 10.1172/JCI27883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhao Y, Li Z, Su L, Ballesteros-Tato A, Katz J, Michalek SM, … Zhang P. (2020). Frontline Science: Characterization and regulation of osteoclast precursors following chronic Porphyromonas gingivalis infection. J Leukoc Biol, 108(4), 1037–1050. doi: 10.1002/JLB.1HI0620-230R [DOI] [PubMed] [Google Scholar]
  38. Zhu M, Sun BH, Nevius E, Kaplan J, Pereira J, & Insogna K (2021). Selective deletion of the receptor for CSF1, c-fms, in osteoclasts results in a high bone mass phenotype, smaller osteoclasts in vivo and an impaired response to an anabolic PTH regimen. PLoS One, 16(2), e0247199. doi: 10.1371/journal.pone.0247199 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

RESOURCES