Skip to main content
Open Medicine logoLink to Open Medicine
. 2024 May 15;19(1):20240941. doi: 10.1515/med-2024-0941

ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis

Hao Wang 1,2, Wei Zhao 2, Daorong Wang 2,3,4,, Jin Chen 5,6,
PMCID: PMC11097043  PMID: 38756246

Abstract

Herein, we elucidate the potential role of ANO6 (TMEM16F) in gastrointestinal stromal tumors (GISTs). ANO6 expression in GIST and adjacent normal tissues was determined using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting. Cell proliferation, apoptosis, and pyroptosis were examined utilizing 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, terminal deoxynucleotidyl transferase dUTP Nick-End Labeling staining, and flow cytometry. In addition, the total iron and Fe2+ levels were assessed. IL-18 and IL-1β levels were also evaluated. Lipid reactive oxygen species (ROS), cystine (Cys), glutathione (GSH), and glutathione peroxidase 4 (GPX4) levels were evaluated using appropriate kits. Ferroptotic markers, including Ptgs2, Chac1, SLC7A11, and SLC3A2, were analyzed by RT-qPCR, western blotting, and immunohistochemistry. ANO6 expression decreased in GIST tissues. ANO6-plasmid inhibits proliferation, induces apoptosis, and promotes pyroptosis in GIST-T1 and GIST-T1 IR cells. The ANO6-plasmid induced ferroptosis, as confirmed by enhanced lipid ROS levels, increased intracellular concentrations of total iron and Fe2+, promoted Ptgs2 and Chac1 expression, reduced Cys, GSH, and GPX4 levels, and downregulated SLC7A11 and SLC3A2 expression after in vitro and in vivo treatment with ANO6-plasmid. Moreover, the ANO6-plasmid inhibited GIST growth in vivo. Therefore, ANO6 may be a promising therapeutic target for blocking the development of GIST via the induction of apoptosis, pyroptosis, and ferroptosis.

Keywords: ANO6 (TMEM16F), gastrointestinal stromal tumor, ferroptosis

1. Introduction

Gastrointestinal stromal tumor (GIST) is a type of tumor originating from the mesenchymal tissue of the gastrointestinal tract, accounting for the majority of gastrointestinal mesenchymal tumors [1,2]. GIST, as a special type of tumor, is not sensitive to traditional chemotherapy and radiotherapy [3,4]. Surgical resection is considered the most effective treatment method [5]. Moreover, cancer immunotherapy is increasingly receiving attention due to breakthroughs in immune checkpoint inhibitors [6,7], and the immunotherapeutic strategies for GIST are growing fast [8]. Yeh et al. identified aurora kinase A as an unfavorable prognostic factor and a potential treatment target for metastatic GIST [9]. However, at present, the recurrence rate of GIST is high, and the survival rate of patients is poor. Therefore, it is necessary to develop new and more effective treatment strategies for patients with GIST.

Recently, there have been reports that several new types of programmed cell death, such as ferroptosis and pyroptosis, play important roles in regulating cancer progression and are considered a promising strategy for cancer treatment. Ferroptosis and cell pyroptosis are highly correlated with immune regulation in the tumor microenvironment. Ferroptosis is a newly discovered mode of cell death, and its development depends on intracellular free iron (Fe2+). Abnormal regulation of iron levels in cells can result in an imbalance between cell membrane redox and lipid peroxidation, eventually resulting in cell death [10]. Ferroptosis plays a vital role in the progression and development of several diseases [11,12]. In addition, antioxidants and glutathione peroxidase 4 (GPX4) are involved in the progression of ferroptosis. For instance, Zhou et al. found that ferroptosis is initiated by glutathione (GSH) depletion or GPX4 inactivation [13]. The cystine (Cys)/glutamate antiporter system Xc, which consists of SLC7A11 and SLC3A2, is closely associated with ferroptosis [14]. Li et al. verified that inhibition of the SLC7A11-GPX4 signaling pathway is involved in aconitine-induced ferroptosis in vivo and in vitro [15]. In recent years, ferroptosis has garnered enormous interest in cancer research communities. Ferroptosis can be seen in radiotherapy, chemotherapy, and tumor immunotherapy. Therefore, activation of ferroptosis may be a potential strategy to overcome the resistance mechanisms of traditional cancer treatments [10]. In addition, as a form of programmed cell death mediated by gasdermin, cell pyroptosis is a product of continuous cell expansion until cell membrane rupture, leading to the release of cell contents and activation of strong inflammatory and immune responses [16]. Pyroptosis is an innate immune response that can be triggered by various influencing factors that activate inflammasomes. Evidence has demonstrated that pyroptosis exerts benefits on cancer immunotherapies [17]. However, the specific mechanisms underlying ferroptosis and pyroptosis in GIST require further investigations.

ANO6 (TMEM16F) is a protein with ten transmembrane segments that exists in various tissues and cells [18]. Studies have shown that ANO6 (TMEM16F) plays important roles in cell growth and migration [19]. Zhao et al. found that ANO6 (TMEM16F) inhibition limited pain-associated behavior and improved motor function by promoting microglial M2 polarization in mice [20]. Bricogne et al. found that ANO6 (TMEM16F) activation by Ca(2+) triggers plasma membrane expansion and directs PD-1 trafficking [21]. Lin et al. found that TMEM16F/ANO6 is negatively regulated by the actin cytoskeleton and intracellular MgATP [22]. Moreover, evidence indicates that activation of ANO6 (TMEM16F) contributes to various forms of regulated cell death [23]. However, the expression and role of ANO6 (TMEM16F) in GISTs remains unclear.

Thus, our study was designed to illustrate the functions of ANO6 (TMEM16F) in GIST ferroptosis and elucidate its potential mechanism. Our findings provide the first evidence that ANO6 (TMEM16F) inhibits GIST growth and induces ferroptosis by regulating SLC7A11 and SLC3A2C expression, thereby providing a therapeutic basis for GIST treatment.

2. Methods

2.1. Clinical specimen collection

GIST and adjacent normal tissues were collected from 15 patients with GIST at the The Yangzhou School of Clinical Medicine of Nanjing Medical University. All specimens were rapidly frozen and stored in liquid nitrogen and preserved at −80°C for further analysis.

2.2. Cell culture

GIST-T1 cells were bought from the American Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium (Thermo Fisher) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA) and 100 U/mL penicillin and 100 μg/mL streptomycin at 37°C in a humid atmosphere containing 5% CO2.

2.3. Construction of drug-resistant cell lines

Intermittent imatinib (IM) administration was performed on cells in the logarithmic growth phase. After 48 h of treatment, a drug-free culture medium was used instead of the culture medium. Specific IM concentrations were administered until normal cell growth was observed. Subsequently, the concentration was increased, and the above process was repeated to obtain drug-resistant cell lines.

2.4. Cell transfection

GIST-T1 and GIST-T1 IR cells were induced by 1 µg control-plasmid (sc-437275; Santa Cruz Biotechnology) and 1 µg ANO6-plasmid (sc-402736-ACT Santa Cruz Biotechnology) using Lipofectamine 2000 (11668019; Thermo Fisher) for 48 h following the manufacturer’s protocol. The cells were harvested after transfection.

2.5. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

After treatment, GIST-T1 and GIST-T1 IR cells were implanted into 96-well plates and cultured for 24 h at 37°C. Then, cells were treated with 10 μL of MTT solution and continuously incubated for a further 4 h. Afterward, the solution was removed and 100 μL of dimethyl sulfoxide was added to each well to solubilize the formazan product. Finally, the optical density at 570 nm was measured using a microplate reader (BioTek, Richmond, USA) after 15 min of vibration mixing, following the manufacturer’s instructions.

2.6. Flow-cytometry analysis

After treatment, GIST-T1 and GIST-T1 IR cells were implanted into 96-well plates and cultured for 24 h at 37°C. The cells were collected by centrifugation at 4°C for 5 min. The cells were then washed with phosphate-buffered saline (PBS). Apoptosis was detected using the Annexin V-FITC/PI Apoptosis Detection Kit (Beyotime, Beijing, China) following the manufacturer’s instructions. Apoptosis was assessed using a BD Aria III flow cytometer (BD Technologies). Pyroptosis in GIST-T1 and GIST-T1 IR cells was determined by flow cytometry according to the manufacturer’s instructions.

2.7. Reactive oxygen species (ROS) assay

2'-7'-Dichlorodihydrofluorescein diacetate (DCFH-DA) was used to quantify the ROS levels according to the protocol of the ROS fluorescence assay kit (E-BC-K138-F; Elabscience). GIST-T1 and GIST-T1 IR cells were plated in six-well plates and incubated for 24 h. After washing with PBS for three times, cells were labeled with 5 μM DCFH-DA under standard conditions for 30 min, cells were collected, and fluorescence intensity of DCF was detected using a microplate reader (SMR16.1, USCNK).

2.8. Iron assay

The Iron Assay Kit (E-BC-K772-M/E-BC-K773-M; Elabscience) was used to detect the total iron or Fe2+ levels in GIST-T1 and GIST-T1 IR cells. According to the manufacturer’s protocol, the iron assay buffer and iron reducer were sequentially added to the cells. The samples were thoroughly mixed in the dark, added to an iron-reducing agent and iron probe, and cultured for 30 min. Intracellular ferrous levels were quantified using a kit, and the absorbance at 593 nm was calculated as the intracellular Fe2+ level.

2.9. Cys, GSH level, and GPX4 activity measurements

GIST-T1 and GIST-T1 IR cells were collected after treatment with dimethyl sulfoxide or a specified concentration of the drug for 24 h, according to the manufacturer’s instructions. Cys and GSH levels were detected using a human Cys enzyme-linked immunosorbent assay (ELISA) kit (ELK9092; ELK Biotechnology) and a GSH Assay Kit (A006-2; Nanjing Jiancheng Biotechnology). The GPX4 activity was measured using a Human GPX4 ELISA Kit (ELK4775; ELK Biotechnology).

2.10. ELISA

After GIST-T1 and GIST-T1 IR cells were transfected with the control plasmid and ANO6-plasmid, we centrifuged and collected the supernatant of the cells for ELISA. Then, the levels of IL-18 (ELK1245; ELK Biotechnology) and IL-1β (ELK1270; ELK Biotechnology) were assessed following the manufacturer’s instructions.

2.11. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

Total RNA was extracted from GIST cells and GIST-T1 IR lines or tissues using the TRIzol Total RNA Extraction Reagent (EP013; ELK Biotechnology) according to the manufacturer’s protocol. The levels of ANO6, Bax, Bcl-2, SLC7A11, SLC3A2, Ptgs2, and Chac1 were measured using RT-qPCR. Total RNA was reverse transcribed into cDNA following the instructions of EntiLink 1st Strand cDNA Synthesis Super Mix (EQ031; ELK Biotechnology), and RT-qPCR analysis was conducted using EnTurbo SYBR Green PCR SuperMix (EQ001; ELK Biotechnology) with an ABI 7500 Real-Time PCR System (Applied Biosystems). Target gene expressions were calculated using the 2−ΔΔCt method [24]. Primer sequences for PCR are listed in Table 1.

Table 1.

Primer sequences for PCR

Gene Sequences (5′–3′)
GAPDH sense CATCATCCCTGCCTCTACTGG
antisense GTGGGTGTCGCTGTTGAAGTC
Ptgs2 sense AGATTATGTGCAACACTTGAGTGG
antisense ATTCCTACCACCAGCAACCCT
Chac1 sense GTGGTGACGCTCCTTGAAGAT
antisense GCCTCTCGCACATTCAGGTAC
SLC7A11 sense TGTGGGGTCCTGTCACTATTTG
antisense GATATCACAGCAGTAGCTGCAGG
Bax sense TCTGAGCAGATCATGAAGACAGG
antisense ATCCTCTGCAGCTCCATGTTAC
Bcl-2 sense AGGATTGTGGCCTTCTTTGAG
antisense AGCCAGGAGAAATCAAACAGAG
SLC3A2 sense CGATTACCTGAGCTCTCTGAAG
antisense TAAGGTCCAGAATGACACGGAT

2.12. Western blot assay

GIST-T1 and GIST-T1 IR cell proteins were extracted using radioimmunoprecipitation assay buffer (AS1004; ASPEN) and evaluated using a bicinchoninic acid assay kit (AS1086; ASPEN). Average protein concentrations were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. Then, the membrane was blocked in 5% skim milk for 2 h at room temperature and incubated in specific antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ab181602, 1:10,000 dilution; Abcam), ANO6 (20784-1-AP, 1:1,000 dilution; Wuhan Sanying Biotechnology), Bax (50599-2-Ig, 1:2,000 dilution; Wuhan Sanying Biotechnology), Bcl-2 (ab321124, 1:1,000 dilution; Abcam), SLC7A11 (26864-4-AP, 1:1,000 dilution; Wuhan Sanying Biotechnology), SLC3A2 (15193-1-AP, 1:5,000 dilution; Wuhan Sanying Biotechnology), GSDMD-N (A22523, 1:1,000 dilution; abclonal), or cleaved-Caspase1 (AF4005, 1:500 dilution; affbiotech) overnight at 4°C. Membranes were then incubated with secondary antibodies (AS1107, 1:10,000 dilution; ASPEN) for 1 h. Finally, signals were developed using electrochemiluminescence detection system reagents (AS1059; ASPEN) according to the manufacturer’s instructions.

2.13. Animal studies

All mice were placed in a specific pathogen-free environment with a standard light–dark cycle of 25°C for 12 h and had free access to food and water. Then, GIST-T1 cells were injected subcutaneously into nude mice with 100 μL of normal saline. The tumor volume (V) was calculated using the formula: V = L × W 2/2, where L is the tumor length and W is the tumor width. Tumors were collected and weighed from all mice after euthanasia. This study is reported in accordance with ARRIVE guidelines. Animal care and experimental procedures were approved by the Animal Ethics Committee of Yangzhou University (Approval number: 202111020).

2.14. Immunohistochemical analysis

Tumor samples were fixed with 4% paraformaldehyde at room temperature for 24 h, dehydrated, and waxed. Then, the sample was cut into 2–3 μm slices. The slices were placed in 0.01 M citrate buffer (pH 6.0), heated in a microwave oven for antigen repair on medium heat for 2–8 min. The slices were exposed to 3% H2O2 for 15–30 min to bleach the endogenous peroxidase and then rinsed in PBS for three times. Then, a sufficient amount of diluted primary antibodies against ANO6, SLC7A11, or SLC3A2 were added to each slice and incubated overnight at 4°C. These sections were then incubated with the secondary antibody for 30 min. The slices were examined using light microscopy (Olympus).

2.15. Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) analysis

The tissue of GIST was fixed with 4% paraformaldehyde for more than 24 h, and 2–3 μm paraffin sections were taken after dehydration. The slices were then dewaxed in xylene for 5–10 min, washed with anhydrous ethanol for 5 min, soaked in 0.2% Triton X-100 for 15 min, and soaked in 3,3′-diaminobenzidine solution for 30 min. Images were analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Inc.), and the slices were photographed and counted under an optical microscope.

2.16. Statistical analysis

Statistical analyses were conducted using SPSS 19.0 (SPSS Inc., Chicago, IL, USA). We used the Kolmogorov–Smirnov test to determine the normality of the data in SPSS. All findings are displayed by mean ± standard deviation from three independent experiments. Mean differences among groups were estimated using the unpaired Student’s t-test or one-way analysis of variance with Tukey’s post hoc test. Statistical significance was set at P < 0.05.

Ethics approval and consent to participate: This study is reported in accordance with ARRIVE guidelines. The research procedure was approved by the ethics committee of The Yangzhou School of Clinical Medicine of Nanjing Medical University (Approval number: 2022ky152) in accordance with the Declaration of Helsinki. Animal care and experiment procedures are approved by the Animal Ethics Committee of Yangzhou University (Approval number. 202111020).

Informed consent: All patients signed an informed consent form and approved the use of their tissues in the study.

3. Results

3.1. ANO6 (TMEM16F) (ANO6) was low-expressed in the stromal tumor tissues of patients with GISTs

Stromal tumors and adjacent normal tissues were obtained from 15 patients with GISTs. The levels of ANO6 (TMEM16F) were analyzed using RT-qPCR and western blotting. As presented in Figure 1a and b, the levels of ANO6 (TMEM16F) were remarkably lower in the stromal tumor tissues of patients with GIST than in the adjacent normal tissues, indicating a regulatory role of ANO6 (TMEM16F) in GIST.

Figure 1.

Figure 1

Expression of ANO6 (TMEM16F) in stromal tumor tissues and adjacent normal tissues of patients with GIST. Relative levels of ANO6 (TMEM16F) in stromal tumor tissues and adjacent normal tissues from patients with GISTs were evaluated by (a) western blot assay and (b) RT-qPCR. **P < 0.01.

3.2. ANO6 (TMEM16F) was downregulated in the IM‑resistant GIST‑T1 IR cell line

Moreover, we detected ANO6 (TMEM16F) expression in GIST-T1 IR and GIST-T1 cells. The RT-qPCR and western blotting results suggested that the level of ANO6 (TMEM16F) was lower in GIST-T1 IR cells than in GIST-T1 cells (Figure 2a and b). Our data indicate that ANO6 (TMEM16F) is involved in the regulation of IM-resistant GIST-T1 IR cell line.

Figure 2.

Figure 2

Expression of ANO6 (TMEM16F) in GIST-T1 and GIST-T1 IR cells. The relative levels of ANO6 (TMEM16F) in GIST-T1 and GIST-T1 IR cells were evaluated by (a) RT-qPCR and (b) western blotting, respectively. **P < 0.01.

3.3. Upregulation of ANO6 (TMEM16F) inhibited GIST-T1 cell proliferation and induced cell apoptosis

To further illustrate the mechanism of ANO6 (TMEM16F) (ANO6) in GIST, we transfected GIST-T1 cells with a control-plasmid and ANO6-plasmid. Results from RT-qPCR and western blot assays suggested that ANO6 (TMEM16F) was upregulated in ANO6-plasmid transfected GIST-T1 cells compared to the control plasmid group (Figure 3a and b). In addition, the results of MTT and flow cytometry assays revealed that the upregulation of ANO6 (TMEM16F) inhibited the proliferation of GIST-T1 cells (Figure 3c) and increased the number of apoptotic GIST-T1 cells (Figure 3d and e). We also determined the levels of apoptosis-related proteins, including Bax and Bcl-2, by RT-qPCR and western blotting. The ANO6-plasmid increased Bax expression (Figure 3f and g) and reduced Bcl-2 expression (Figure 3f and h). Our data revealed that ANO6 (TMEM16F) was involved in GIST progression by regulating GIST-T1 cell proliferation and apoptosis.

Figure 3.

Figure 3

Effects of ANO6 (TMEM16F) on GIST-T1 cell proliferation and apoptosis. GIST-T1 cells were transfected with the control-plasmid and the ANO6-plasmid. (a) and (b) RT-qPCR and western blot analysis of ANO6 (TMEM16F) levels in the control-plasmid and ANO6-plasmid groups. (c) The growth of GIST-T1 cells was assessed by MTT. (d) Apoptosis was determined by flow cytometry. (e) Quantification of apoptotic GIST-T1 cells. (f) Western blotting analysis of Bax and Bcl-2 expression. (g) and (h) Bax and Bcl-2 mRNA levels were determined using RT-qPCR. **P < 0.01.

3.4. Overexpression of ANO6 (TMEM16F) suppressed GIST-T1 IR cell proliferation and promoted cell apoptosis

We also investigated the roles of the ANO6-plasmid in GIST-T1 IR cell proliferation and apoptosis. We found that the ANO6-plasmid upregulated ANO6 (TMEM16F) expression in GIST-T1 IR cells, compared to the control-plasmid group (Figure 4a and b). Moreover, the ANO6-plasmid led to suppressed GIST-T1 IR cell proliferation (Figure 4c) and enhanced apoptosis (Figure 4d and e). Furthermore, RT-qPCR and western blotting assays revealed that the ANO6-plasmid increased Bax expression (Figure 4f and g) and reduced Bcl-2 expression (Figure 4f and h) in GIST-T1 IR cells, indicating that ANO6 (TMEM16F) is a vital regulator of GIST progression.

Figure 4.

Figure 4

Effects of ANO6 (TMEM16F) on GIST-T1 IR cell proliferation and apoptosis. Control-plasmid and ANO6-plasmid were transfected into GIST-T1 IR cells. (a) and (b) ANO6 (TMEM16F) levels were determined by RT-qPCR and western blot analysis. (c) GIST-T1 IR cell viability was assessed by MTT. (d) Apoptosis was determined by flow cytometry. (e) Quantification of apoptotic GIST-T1 IR cells. (f) Western blotting analysis of Bax and Bcl-2 expression. (g) and (h) Bax and Bcl-2 mRNA levels were determined using RT-qPCR. **P < 0.01.

3.5. ANO6-plasmid promotes pyroptosis in GIST-T1 and GIST-T1 IR cells

Mechanistically, we explored the effects of ANO6 on GIST-T1 and GIST-T1 IR cell pyroptosis. As shown in Figure 5a and b, the ANO6-plasmid induced GIST-T1 and GIST-T1 IR cells. Furthermore, the effector molecules of pyroptosis, including GSDMD-N and cleaved caspase 1, were determined by western blotting. We observed that GSDMD-N and cleaved caspase 1 density in the ANO6-plasmid group was remarkably increased relative to the control-plasmid group (Figure 5c). ELISA for IL-18 and IL-1β expression levels were also evaluated. Results from Figure 5d and e revealed that the ANO6-plasmid increased IL-18 and IL-1β expressions, as opposed to the control-plasmid. These results suggested that the ANO6-plasmid increased pyroptosis-related markers, indicating a promotional effect on pyroptosis.

Figure 5.

Figure 5

Effects of ANO6 (TMEM16F) on GIST-T1 and GIST-T1 IR cell pyroptosis. (a) and (b) Pyroptosis of GIST-T1 and GIST-T1 IR cells was confirmed by flow cytometry. (c) Western blot analysis of GSDMD-N and cleaved-caspase 1 expression. (d) and (e) The levels of IL-18 and IL-1β were assessed using ELISA assay. **P < 0.01.

3.6. ANO6 (TMEM16F) induced ferroptosis by regulating SLC7A11 and SLC3A2 in GIST-T1 cells

Ferroptosis is an iron-dependent process that is different from necrosis and apoptosis. An increasing number of studies have suggested that ferroptosis is a critical modality in cancer-related deaths [25]. We explored the effects of the ANO6-plasmid on ferroptosis in GIST-T1 cells. We found that the upregulation of ANO6 (TMEM16F) enhanced lipid ROS levels (Figure 6a) and increased the intracellular concentrations of total iron (Figure 6b) and Fe2+ (Figure 6c) in GIST-T1 cells. In addition, we determined the markers of ferroptosis, including Ptgs2 and Chac1. Our data revealed that Ptgs2 and Chac1 were upregulated in ANO6-plasmid transfected GIST-T1 cells (Figure 6d and e). Further mechanistic experiments indicated that the ANO6-plasmid reduced Cys, GSH, and GPX4 levels as opposed to the control-plasmid group (Figure 6f–h), indicating that ANO6 (TMEM16F) inhibits GIST growth and induces ferroptosis in GIST-T1 cells.

Figure 6.

Figure 6

Effects of ANO6 (TMEM16F) on GIST-T1 cell ferroptosis. GIST-T1 cells were transfected with the control-plasmid and the ANO6-plasmid. (a) Generation of lipid ROS in GIST-T1 cells was detected by flow cytometry. Total iron (b) and ferrous iron (c) levels were evaluated in GIST-T1 cells after treatment with the control-plasmid or the ANO6-plasmid. (d) and (e) Levels of Ptgs2 and Chac1 were detected by RT-qPCR. Determination of Cys (f), GSH (g), and GPX4 (h) levels in GIST-T1 cells. (i) Detection of SLC7A11 and SLC3A2 expression in the control, control-plasmid, and ANO6-plasmid groups. (j) and (k) mRNA levels of SLC7A11 and SLC3A2 were assessed using RT-qPCR. **P < 0.01 vs control-plasmid.

Previous reports have revealed that ferroptosis is linked to multiple diseases and results from iron-dependent lipid peroxidation after inactivation of SLC7A11 and SLC3A2 [26]. Next, we evaluated whether ANO6 (TMEM16F) affected SLC7A11 and SLC3A2 expression in GIST-T1 cells. As shown in Figure 6I-K, SLC7A11 and SLC3A2 were downregulated in ANO6-plasmid transfected cells. Our data indicate that ANO6 (TMEM16F)-induced ferroptosis is mediated by SLC7A11 and SLC3A2.

3.7. ANO6 (TMEM16F) stimulated ferroptosis by regulating SLC7A11 and SLC3A2 in GIST-T1 IR cells

Furthermore, we investigated the roles of the ANO6-plasmid in the ferroptosis of GIST-T1 IR cells. Our data revealed that the ANO6-plasmid increased lipid ROS (Figure 7a), iron (Figure 7b), and Fe2+ levels (Figure 7c) in GIST-T1 IR cells. Furthermore, qRT-PCR analysis suggested that Ptgs2 and Chac1 expression was enhanced after ANO6-plasmid transfection (Figure 7d and e). Moreover, we detected ferroptosis-related gene expression in ANO6-plasmid transfected GIST-T1 IR cells, and our data demonstrated that the upregulation of ANO6 inhibited Cys, GSH, and GPX4 levels (Figure 7f–h), as well as SLC7A11 and SLC3A2 expression (Figure 7i–k), compared to the control-plasmid group. Our data revealed that ANO6 (TMEM16F) suppresses GIST growth and induces ferroptosis by regulating SLC7A11 and SLC3A2.

Figure 7.

Figure 7

Effects of ANO6 (TMEM16F) on GIST-T1 IR cell ferroptosis. GIST-T1 IR cells were transfected with the control-plasmid and the ANO6-plasmid. (a) The generation of lipid ROS was detected using flow cytometry. Total iron (b) and ferrous iron (c) were evaluated in GIST-T1 IR cells after treatment with the control-plasmid or the ANO6-plasmid. (d) and (e) Levels of Ptgs2 and Chac1 were detected by RT-qPCR. Determination of Cys (f), GSH (g), and GPX4) (h) levels in GIST-T1 IR cells. (i) Detection of SLC7A11 and SLC3A2 expression in the control, control-plasmid, and ANO6-plasmid groups. (j) and (k) mRNA levels of SLC7A11 and SLC3A2 were assessed using RT-qPCR. **P < 0.01 vs control-plasmid.

3.8. ANO6-plasmid inhibited GIST growth in vivo

We performed in vivo experiments to analyze the regulatory role of ANO6 (TMEM16F) in GIST progression. The xenograft tumor models were treated with the ANO6-plasmid, and Figure 8a shows a representative diagram of the xenografts. Furthermore, we calculated tumor volumes and weights of the xenografts. We found that tumor volumes and weights were reduced in nude mice inoculated with GIST-T1 cells after ANO6-plasmid treatment (Figure 8b and c). In summary, our data suggested that the ANO6-plasmid blocked GIST growth.

Figure 8.

Figure 8

Effects of ANO6 (TMEM16F) on the growth of xenograft in vivo. (a) Gross appearance of tumor. (b) and (c) Average tumor volume and body weight changes in each group were calculated. **P < 0.01 vs control-plasmid.

3.9. ANO6 (TMEM16F) regulated SLC7A11 and SLC3A2 expression in GIST in vivo

We assessed the effect of ANO6 (TMEM16F) on SLC7A11 and SLC3A2 expression in GIST in vivo. Immunohistochemistry suggested that the ANO6-plasmid prominently increased ANO6 (TMEM16F) expression (Figure 9a) and obviously reduced SLC7A11 and SLC3A2 expression (Figure 9a) compared to the control-plasmid group. Similar results were obtained using RT-qPCR (Figure 9b–d). These findings demonstrate that ANO6 (TMEM16F) inhibits GIST growth by regulating SLC7A11 and SLC3A2 expression.

Figure 9.

Figure 9

Effects of ANO6 (TMEM16F) on SLC7A11 and SLC3A2 expression in GIST in vivo. (a) The expression of ANO6 (TMEM16F), SLC7A11, and SLC3A2 in GIST tissues was determined using IHC assays. (b)–(d) mRNA expression of ANO6 (TMEM16F), SLC7A11, and SLC3A2 in GISTs tissues was determined by RT-qPCR. **P < 0.01 vs control-plasmid.

3.10. ANO6 (TMEM16F) induced cell apoptosis in GIST in vivo

To further illustrate the mechanism by which ANO6 (TMEM16F) inhibited tumor growth in vivo, we determined the number of apoptotic cells in GIST. As shown in Figure 10, TUNEL staining suggested that the ANO6-plasmid significantly increased TUNEL-positive GIST-T1 cells compared to control-plasmid transfected cells, suggesting that ANO6 (TMEM16F) plays a pro-apoptotic role in GIST.

Figure 10.

Figure 10

Effects of ANO6 (TMEM16F) on GIST cell apoptosis in vivo. TUNEL images of tumor samples and quantitative analysis of apoptosis rates. **P < 0.01 vs control-plasmid.

3.11. ANO6 (TMEM16F) inhibited GIST growth by inducing ferroptosis in vivo

Finally, we evaluated the effect of ANO6 (TMEM16F) on the ferroptosis of GIST in vivo. Our data demonstrated that the ANO6-plasmid remarkably enhanced lipid ROS levels (Figure 11a), intracellular concentrations of total iron (Figure 11b), and Fe2+ levels (Figure 11c). RT-qPCR analysis revealed that the ANO6-plasmid enhanced Ptgs2 and Chac1 expression levels as opposed to the control-plasmid group (Figure 11d and e). In addition, reduced Cys, GSH, and GPX4 expression levels were observed in ANO6-plasmid treated xenograft tumor models (Figure 11f–h). Our findings revealed that ANO6 (TMEM16F) inhibited GIST growth and induced ferroptosis by regulating SLC7A11 and SLC3A2 expression.

Figure 11.

Figure 11

Effects of ANO6 (TMEM16F) on GIST cell ferroptosis in vivo. (a) Lipid ROS stimulation was detected using an ROS fluorescence assay kit. Total iron (b) and ferrous iron (c) were analyzed after treatment with the control-plasmid or the ANO6-plasmid. (d) and (e) RT-qPCR analysis of Ptgs2 and Chac1 mRNA levels. Detection of Cys (f), GSH (g), and GPX4 (h) in GISTs. **P < 0.01 vs control-plasmid.

4. Discussion

This study indicated that ANO6 (TMEM16F) is abnormally low expressed in GIST, which can inhibit the growth of GIST in vitro and in vivo, inducing cell pyroptosis and ferroptosis. It is a potential therapeutic target for GIST.

GISTs are a type of mesenchymal tumors that originate from the precursors of gastrointestinal connective histiocytes and often occur in middle-aged and elderly individuals [27]. IM has been used as a first-line treatment for patients with GIST with metastatic recurrence or unresectability [28,29]. Although many patients benefit from IM, some exhibit drug resistance within 18–24 months of treatment, leading to disease progression and even death [30]. However, GISTs have a high recurrence rate and poor survival rate, and there is currently no effective method for treating advanced metastatic diseases. Drug resistance remains unclear. Therefore, there is an urgent need to identify novel therapeutic targets against GIST. According to reports, TMEM16A/ANO1 and TMEM16F/ANO6 are regulated by intracellular Ca2+ and plasma membrane phospholipids, while TMEM16F/ANO6 is a phospholipid scramjet enzyme that also generates Cl current [31]. In addition, activation of ANO6 (TMEM16F) contributes to various forms of regulatory cell death in diseases. Cui et al. suggested that ANO6 (TMEM16F) may be a new therapeutic target for Alzheimer’s disease [32]. Research has confirmed the important regulatory role of ANO6 (TMEM16F) in cell growth and migration [19]. However, the expression and role of ANO6 (TMEM16F) in GIST and GIST-T1 IR cells remain unclear.

First, we determined the ANO6 (TMEM16F) expression levels in stromal tumor tissues and adjacent normal tissues. Our data revealed that ANO6 (TMEM16F) was expressed at low levels in stromal tumor tissues from patients with GISTs compared to those in adjacent normal tissues, indicating that ANO6 (TMEM16F) is related to the progression of GIST. Further mechanistic experiments suggested that the ANO6-plasmid upregulated ANO6 (TMEM16F) levels compared with the control-plasmid group. Moreover, the ANO6-plasmid inhibited the proliferation of GIST-T1 and GIST-T1 IR cells and increased the number of apoptotic cells. Zhao et al. reported that ligustrazine suppresses neuronal apoptosis via the Bax/Bcl-2 and caspase-3 pathways in PC-12 cells and rats with vascular dementia [33]. Wei et al. suggested that borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax [34]. Therefore, we determined the effects of the ANO6-plasmid on Bax and Bcl-2. Our data revealed that the ANO6-plasmid increased Bax expression and reduced Bcl-2 expression, indicating that ANO6 (TMEM16F) is involved in GIST progression by regulating GIST-T1 and GIST-T1 IR cell proliferation and apoptosis. Pyroptosis is another form of programmed inflammatory cell death associated with various pathologies [3537]. We further determined the effects of the ANO6-plasmid on GIST-T1 and GIST-T1 IR cells. Our data revealed that the ANO6-plasmid enhances pyroptosis, as confirmed by increased GSDMD-N, cleaved-caspase 1, IL-18, and IL-1β expressions.

Further in vivo experiments confirmed the regulatory role of ANO6 (TMEM16F) in GIST progression, as evidenced by the reduction in tumor volume and weights after ANO6-plasmid treatment. Moreover, TUNEL staining suggested that the ANO6-plasmid significantly increased TUNEL-positive GIST-T1 cells compared to control-plasmid transected cells, further indicating the pro-apoptotic role of ANO6 (TMEM16F) in GIST. Ferroptosis is a new type of non-apoptotic programmed cell death caused by the loss of GPX4 activity and subsequent accumulation of lipid-based ROS and is considered an effective target for cancer treatment [38]. Balachander and Paramasivam identified ferroptosis as an emerging therapeutic target in oral cancer [39]. Delvaux et al. demonstrated that ferroptosis induction and YAP inhibition are new therapeutic targets for GISTs [40]. A previous study found that iron is an important executor of ferroptosis. Intracellular iron levels are regulated by iron regulatory transporters, and Fe2+ is particularly important in iron deficiency anemia [41]. Therefore, we explored the effect of ANO6 (TMEM16F) on ferroptosis in GIST-T1 cells, in vivo models, and GIST-T1 IR cells. We found that the ANO6-plasmid increased the stimulation of lipid ROS and increased the intracellular concentrations of total iron and Fe2+ in GIST-T1 cells, GIST-T1 IR cells, and tissues. We also determined the expression of ferroptosis markers including Ptgs2 and Chac1. Our data revealed that Ptgs2 and Chac1 were upregulated in ANO6-plasmid transfected cells and tissues compared to the control-plasmid group. The Cys/glutamate reverse transport system Xc plays an important role in ferroptosis [42]. GSH is one of the most abundant free radical scavengers in cells and one of the most effective regulatory factors of iron deficiency [43]. GPX4 is a central mediator of cancer cell death and is associated with the production of lipid ROS for ferroptosis. Yang et al. revealed the involvement of the GSH-GPX4 pathway in ferroptosis of the retinal pigment epithelium ferroptosis [44]. Moreover, Yang et al. suggested that Maresin1 protects against ferroptosis-induced liver injury through ROS inhibition and Nrf2/HO-1/GPX4 activation [45]. Therefore, we examined the ferroptosis-related pathway regulatory factors, including Cys, GSH, and GPX4. Our findings indicated that the ANO6-plasmid reduced Cys, GSH, and GPX4 levels compared to the control-plasmid group.

The Cys/glutamate acid reverse transport system, Xc-, consists of two subunits, SLC7A11 and SLC3A2, which are closely associated with ferroptosis. SLC7A11 transports Cys into cells, promotes GSH synthesis, and accelerates the inhibition of GPX4 on ferroptosis. Yang et al. have suggested that STAT6 inhibits ferroptosis and alleviates acute lung injury by regulating the P53/SLC7A11 pathway [26]. In addition, Wu et al. revealed that SLC3A2 inhibits ferroptosis in laryngeal carcinoma via the mTOR pathway [46]. RT-qPCR and western blotting were used to determine the expression levels of SLC7A11 and SLC3A2 in ANO6-plasmid transfected GIST-T1 cells. The results suggested that the ANO6-plasmid obviously reduced the expression of SLC7A11 and SLC3A2 compared to the control-plasmid group. In addition, several studies have shown that pharmacological inhibition of SLC7A11 plays a vital role in both in vitro and in vivo models. Based on these findings, we clarified the latent regulatory mechanism of the ANO6-plasmid, SLC7A11, and SLC3A2. Immunohistochemistry assays suggested that the ANO6-plasmid prominently increased ANO6 (TMEM16F) expression and reduced SLC7A11 and SLC3A2 expression, demonstrating that ANO6 (TMEM16F) inhibited GIST growth by regulating SLC7A11 and SLC3A2.

There were also some limitations of this study. First, the specific molecular mechanisms by which ANO6 (TMEM16F) regulates the biological behavior of GIST cells (involved signaling pathways) still require further analysis and exploration. In addition, the correlation between the expression of ANO6 (TMEM16F) and pathological parameters in patients with GIST needs to be elucidated. In the future, we will conduct in-depth research on these issues.

5. Conclusion

Taken together, our findings provide strong evidence for the mechanisms by which ANO6 (TMEM16F) induces ferroptosis by regulating SLC7A11 and SLC3A2 expression in GIST. This report provides new insights into the treatment of GIST.

Abbreviations

Cys

cystine

ELISA

enzyme-linked immunosorbent assay

GIST

gastrointestinal stromal tumors

GPX4

glutathione peroxidase 4

GSH

glutathione

IM

imatinib

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

PBS

phosphate-buffered saline

ROS

reactive oxygen species

RT-qPCR

reverse transcription-quantitative polymerase chain reaction

TUNEL

terminal deoxynucleotidyl transferase dUTP nick-end labeling

Acknowledgements

Not applicable.

Footnotes

Funding information: No funding was received.

Author contributions: Hao Wang contributed to conceptualization data curation, investigation, methodology, project administration, writing – original draft, and writing – review & editing. Wei Zhao contributed to data curation, resources, and supervision. Daorong Wang and Jin Chen contributed to conceptualization, supervision, and writing – review & editing. All authors read and approved the final manuscript.

Conflict of interest: The authors declare that they have no competing interests.

Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Contributor Information

Daorong Wang, Email: wdaorong666@sina.com.

Jin Chen, Email: jchen@njmu.edu.cn.

References

  • [1].Nishida T, Gotouda N, Takahashi T, Cao H. Clinical importance of tumor rupture in gastrointestinal stromal tumor. J Dig Dis. 2023. 10.1111/1751-2980.13190. [DOI] [PubMed]
  • [2].Schaefer IM, DeMatteo RP, Serrano C. The GIST of advances in treatment of advanced gastrointestinal stromal tumor. Am Soc Clin Oncol Educ Book. 2022;42:1–15. [DOI] [PMC free article] [PubMed]
  • [3].Mikuni M, Wakuta M, Masaki T, Hirose Y, Takasu H, Kawano H, et al. Surgical resection of intraorbital metastasis of a gastrointestinal stromal tumor resistant to chemotherapy. Am J Ophthalmol Case Rep. 2022;25:101353. [DOI] [PMC free article] [PubMed]
  • [4].Knowlton CA, Brady LW, Heintzelman RC. Radiotherapy in the treatment of gastrointestinal stromal tumor. Rare Tumors. 2011;3:e35. [DOI] [PMC free article] [PubMed]
  • [5].Kwak HV, Tardy KJ, Allbee A, Stashek K, DeMatteo RP. Surgical management of germline gastrointestinal stromal tumor. Ann Surg Oncol. 2023;30:4966–74. [DOI] [PMC free article] [PubMed]
  • [6].Liu Y, Wang Y, Yang Y, Weng L, Wu Q, Zhang J, et al. Emerging phagocytosis checkpoints in cancer immunotherapy. Signal Transduct Target Ther. 2023;8:104. [DOI] [PMC free article] [PubMed]
  • [7].Liu Y, Lu S, Sun Y, Wang F, Yu S, Chen X, et al. Deciphering the role of QPCTL in glioma progression and cancer immunotherapy. Front Immunol. 2023;14:1166377. [DOI] [PMC free article] [PubMed]
  • [8].Arshad J, Costa PA, Barreto-Coelho P, Valdes BN, Trent JC. Immunotherapy strategies for gastrointestinal stromal tumor. Cancers. 2021;13:3525. [DOI] [PMC free article] [PubMed]
  • [9].Yeh CN, Yen CC, Chen YY, Cheng CT, Huang SC, Chang TW, et al. Identification of aurora kinase A as an unfavorable prognostic factor and potential treatment target for metastatic gastrointestinal stromal tumors. Oncotarget. 2014;5:4071–86. [DOI] [PMC free article] [PubMed]
  • [10].Zhao L, Zhou X, Xie F, Zhang L, Yan H, Huang J, et al. Ferroptosis in cancer and cancer immunotherapy. Cancer Commun. 2022;42:88–116. [DOI] [PMC free article] [PubMed]
  • [11].Yan HF, Zou T, Tuo QZ, Xu S, Li H, Belaidi AA, et al. Ferroptosis: mechanisms and links with diseases. Signal Transduct Target Ther. 2021;6:49. [DOI] [PMC free article] [PubMed]
  • [12].Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol. 2021;22:266–82. [DOI] [PMC free article] [PubMed]
  • [13].Zhou J, Zhang L, Yan J, Hou A, Sui W, Sun M. Curcumin induces ferroptosis in A549 CD133(+) Cells through the GSH-GPX4 and FSP1-CoQ10-NAPH Pathways. Discov Med. 2023;35:251–63. [DOI] [PubMed]
  • [14].Li FJ, Long HZ, Zhou ZW, Luo HY, Xu SG, Gao LC. System X(c) (-)/GSH/GPX4 axis: An important antioxidant system for the ferroptosis in drug-resistant solid tumor therapy. Front Pharmacol. 2022;13:910292. [DOI] [PMC free article] [PubMed]
  • [15].Li Q, Peng F, Yan X, Chen Y, Zhou J, Wu S, et al. Inhibition of SLC7A11-GPX4 signal pathway is involved in aconitine-induced ferroptosis in vivo and in vitro. J Ethnopharmacol. 2023;303:116029. [DOI] [PubMed]
  • [16].Wei X, Xie F, Zhou X, Wu Y, Yan H, Liu T, et al. Role of pyroptosis in inflammation and cancer. Cell Mol Immunol. 2022;19:971–92. [DOI] [PMC free article] [PubMed]
  • [17].Hsu SK, Li CY, Lin IL, Syue WJ, Chen YF, Cheng KC, et al. Inflammation-related pyroptosis, a novel programmed cell death pathway, and its crosstalk with immune therapy in cancer treatment. Theranostics. 2021;11:8813–35. [DOI] [PMC free article] [PubMed]
  • [18].Lin H, Roh J, Woo JH, Kim SJ, Nam JH. TMEM16F/ANO6, a Ca(2+)-activated anion channel, is negatively regulated by the actin cytoskeleton and intracellular MgATP. Biochem Biophys Res Commun. 2018;503:2348–54. [DOI] [PubMed]
  • [19].Jacobsen KS, Zeeberg K, Sauter DR, Poulsen KA, Hoffmann EK, Schwab A. The role of TMEM16A (ANO1) and ANO6 (TMEM16F) (ANO6) in cell migration. Pflugers Arch. 2013;465:1753–62. [DOI] [PMC free article] [PubMed]
  • [20].Zhao J, Gao QY. ANO6 (TMEM16F) inhibition limits pain-associated behavior and improves motor function by promoting microglia M2 polarization in mice. Biochem Biophys Res Commun. 2019;517:603–10. [DOI] [PubMed]
  • [21].Bricogne C, Fine M, Pereira PM, Sung J, Tijani M, Wang Y, et al. ANO6 (TMEM16F) activation by Ca(2 +) triggers plasma membrane expansion and directs PD-1 trafficking. Sci Rep. 2019;9:619. [DOI] [PMC free article] [PubMed]
  • [22].Lin H, Roh J, Woo JH, Kim SJ, Nam JH. TMEM16F/ANO6, a Ca(2 +)-activated anion channel, is negatively regulated by the actin cytoskeleton and intracellular MgATP. Biochem Biophys Res Commun. 2018;503:2348–54. [DOI] [PubMed]
  • [23].Ousingsawat J, Schreiber R, Kunzelmann K. TMEM16F/anoctamin 6 in ferroptotic cell death. Cancers (Basel). 2019;11:625. [DOI] [PMC free article] [PubMed]
  • [24].Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–8. [DOI] [PubMed]
  • [25].Li D, Wang Y, Dong C, Chen T, Dong A, Ren J, et al. CST1 inhibits ferroptosis and promotes gastric cancer metastasis by regulating GPX4 protein stability via OTUB1. Oncogene. 2023;42:83–98. [DOI] [PMC free article] [PubMed]
  • [26].Yang Y, Ma Y, Li Q, Ling Y, Zhou Y, Chu K, et al. STAT6 inhibits ferroptosis and alleviates acute lung injury via regulating P53/SLC7A11 pathway. Cell Death Dis. 2022;13:530. [DOI] [PMC free article] [PubMed]
  • [27].Long ZW, Wu JH, Cai-Hong, Wang YN, Zhou Y. MiR-374b promotes proliferation and inhibits apoptosis of human GIST cells by inhibiting PTEN through activation of the PI3K/Akt Pathway. Mol Cells. 2018;41:532–44. [DOI] [PMC free article] [PubMed]
  • [28].Garcia DMX. Nilotinib, imatinib, and GIST therapy. Lancet Oncol. 2015;16:483–4. [DOI] [PubMed]
  • [29].Eriksson M, Joensuu H. Adjuvant imatinib for GIST: duration likely matters. Ann Oncol. 2021;32:434–6. [DOI] [PubMed]
  • [30].Zhou Y, Chen J, Weng X, Lin G, Huang Z, Shui H. Establishment of a GIST-T1 gastrointestinal stromal tumour cell line resistant to imatinib mesylate. Oncol Lett. 2018;15:7589–94. [DOI] [PMC free article] [PubMed]
  • [31].Schreiber R, Ousingsawat J, Wanitchakool P, Sirianant L, Benedetto R, Reiss K, et al. Regulation of TMEM16A/ANO1 and TMEM16F/ANO6 ion currents and phospholipid scrambling by Ca(2+) and plasma membrane lipid. J Physiol. 2018;596:217–29. [DOI] [PMC free article] [PubMed]
  • [32].Cui ZQ, Hu XY, Yang T, Guan JW, Gu Y, Li HY, et al. ANO6 (TMEM16F) may be a new therapeutic target for Alzheimer’s disease. Neural Regen Res. 2023;18:643–51. [DOI] [PMC free article] [PubMed]
  • [33].Zhao T, Fu Y, Sun H, Liu X. Ligustrazine suppresses neuron apoptosis via the Bax/Bcl-2 and caspase-3 pathway in PC12 cells and in rats with vascular dementia. IUBMB Life. 2018;70:60–70. [DOI] [PubMed]
  • [34].Wei Y, Yuan FJ, Zhou WB, Wu L, Chen L, Wang JJ, et al. Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax. Genet Mol Res. 2016;15(2). 10.4238/gmr.15028300. [DOI] [PubMed]
  • [35].Wu C, Chen H, Zhuang R, Zhang H, Wang Y, Hu X, et al. Betulinic acid inhibits pyroptosis in spinal cord injury by augmenting autophagy via the AMPK-mTOR-TFEB signaling pathway. Int J Biol Sci. 2021;17:1138–52. [DOI] [PMC free article] [PubMed]
  • [36].Yan H, Luo B, Wu X, Guan F, Yu X, Zhao L, et al. Cisplatin induces pyroptosis via activation of MEG3/NLRP3/caspase-1/GSDMD pathway in triple-negative breast cancer. Int J Biol Sci. 2021;17:2606–21. [DOI] [PMC free article] [PubMed]
  • [37].Zhuang Y, Wang L, Ji C, Sun Y, Shao F. Construction of a novel pyrotosis-related prognostic model of esophageal square cell carcinoma and determination of the anti-tumor effect of WFDC12. Funct Integr Genomics. 2023;23:177. [DOI] [PubMed]
  • [38].Yang S, Wong KH, Hua P, He C, Yu H, Shao D, et al. ROS-responsive fluorinated polyethyleneimine vector to co-deliver shMTHFD2 and shGPX4 plasmids induces ferroptosis and apoptosis for cancer therapy. Acta Biomater. 2022;140:492–505. [DOI] [PubMed]
  • [39].Balachander K, Paramasivam A. Ferroptosis: An emerging therapeutic target for oral cancer. Oral Oncol. 2022;131:105970. [DOI] [PubMed]
  • [40].Delvaux M, Hagué P, Craciun L, Wozniak A, Demetter P, Schöffski P, et al. Ferroptosis induction and YAP inhibition as new therapeutic targets in gastrointestinal stromal tumors (GISTs). Cancers (Basel). 2022;14:5050. [DOI] [PMC free article] [PubMed]
  • [41].Fang X, Ardehali H, Min J, Wang F. The molecular and metabolic landscape of iron and ferroptosis in cardiovascular disease. Nat Rev Cardiol. 2023;20:7–23. [DOI] [PMC free article] [PubMed]
  • [42].Jyotsana N, Ta KT, DelGiorno KE. The role of cystine/glutamate antiporter SLC7A11/xCT in the pathophysiology of cancer. Front Oncol. 2022;12:858462. [DOI] [PMC free article] [PubMed]
  • [43].Liu T, Sun L, Zhang Y, Wang Y, Zheng J. Imbalanced GSH/ROS and sequential cell death. J Biochem Mol Toxicol. 2022;36:e22942. [DOI] [PubMed]
  • [44].Yang M, Tsui MG, Tsang JKW, Goit RK, Yao KM, So KF, et al. Involvement of FSP1-CoQ(10)-NADH and GSH-GPx-4 pathways in retinal pigment epithelium ferroptosis. Cell Death Dis. 2022;13:468. [DOI] [PMC free article] [PubMed]
  • [45].Yang W, Wang Y, Zhang C, Huang Y, Yu J, Shi L, et al. Maresin1 protect against ferroptosis-induced liver injury through ROS inhibition and Nrf2/HO-1/GPX4 activation. Front Pharmacol. 2022;13:865689. [DOI] [PMC free article] [PubMed]
  • [46].Wu F, Xiong G, Chen Z, Lei C, Liu Q, Bai Y. SLC3A2 inhibits ferroptosis in laryngeal carcinoma via mTOR pathway. Hereditas. 2022;159:6. [DOI] [PMC free article] [PubMed]

Articles from Open Medicine are provided here courtesy of De Gruyter

RESOURCES