Skip to main content
Veterinary World logoLink to Veterinary World
. 2024 Apr 7;17(4):756–762. doi: 10.14202/vetworld.2024.756-762

Molecular prevalence of Toxoplasma gondii and Trypanosoma evansi in recently calved female cattle from Phayao, Thailand

Khuruwan Klinbumrung 1, Khanuengnij Prakhammin 2, Ornampai Japa 1,3,
PMCID: PMC11111709  PMID: 38798300

Abstract

Background and Aim:

Toxoplasma gondii and Trypanosoma evansi, the zoonotic protozoa responsible for toxoplasmosis and trypanosomiasis, are significant threats to the productivity and financial stability of livestock farming. T. gondii can be transmitted horizontally through ingestion of fecal oocysts and T. evansi through arthropod vectors. In addition, both species can be transmitted from mother to fetus through the placenta. This study aimed to assess the molecular prevalence of T. gondii and T. evansi transplacental-transmitted protozoans and to identify the epidemiological risk factors in recently calved female cattle across Phayao, Thailand.

Materials and Methods:

We collected 106 bovine placentas from beef and dairy cow full-term pregnancies in Phayao, Thailand. T. gondii and T. evansi DNA were detected using targeted B1 gene and expression site-associated gene (ESAG) species-specific polymerase chain reaction (PCR), respectively.

Results:

Forty-three placentas were positive for T. gondii B1 PCR, whereas only one was positive for T. evansi ESAG PCR, resulting in an overall prevalence of transplacental-transmitted protozoan infection of 41.5% (44/106). The prevalence of T. gondii and T. evansi was 40.6% (43/106) and 0.9% (1/106), respectively. No significant correlation was found between T. gondii infection and various risk factors, including locality, age, and cattle type.

Conclusion:

The prevalence of transplacental-transmitted protozoan T. gondii infection was high among female cattle in Phayao, Thailand, whereas the prevalence of T. evansi infection was notably lower. Although the conventional modes of transmission differ between these two parasites, the transplacental transmission of T. evansi and especially T. gondii may play a crucial role in the persistence of these protozoan species in this area.

Keywords: bovine placenta, Toxoplasma gondii, transplacental transmission, transplacental-transmitted protozoan, Trypanosoma evansi

Introduction

Toxoplasma gondii and Trypanosoma evansi are protozoa of significant zoonotic importance, impacting both animal and human health globally [1–3]. As causative agents of toxoplasmosis and trypanosomiasis in animals, they pose substantial threats to livestock farming, affecting productivity and farmers’ financial stability [4–6].

T. gondii is an intracellular protozoan with a broad host range that encompasses warm-blooded animals, including humans [7, 8]. It is one of the most successful and widely distributed parasitic protozoans [8]. During the lifecycle of T. gondii, felids, particularly domestic cats, are definitive hosts and play a crucial role in spreading the disease by excreting a substantial number of T. gondii oocysts in feces [4, 8]. The clinical manifestations of toxoplasmosis can vary among animal hosts, including fever, lymphadenopathy, eye inflammation, and central nervous system disruption [9]. Although infections in immunocompetent animals are generally asymptomatic, the parasite may cause severe consequences [10]. For example, toxoplasmosis can result in abortion for pregnant women or animals at their first exposure [11] and life-threatening for animals with compromised immune system [10, 12, 13].

T. evansi, a hemoflagellate protozoan, is the causative agent of trypanosomiasis, commonly known as surra. This disease primarily affects domestic and wild mammals such as dogs, cats, cattle, buffaloes, horses, and camels [14]. The clinical manifestations of surra include fever, anemia, weakness, emaciation, and central nervous system disorders [15]. In severe cases, the infection may be fatal [14].

The presence of T. gondii and T. evansi can lead to serious health problems in livestock production. Bovine trypanosomiasis can present a spectrum of severity, ranging from mild to severe symptoms such as fever, anemia, weakness, weight loss, and lymph node enlargement. Severe cases may also show neurological manifestations [14, 16]. Conversely, clinical signs of toxoplasmosis in cattle are generally uncommon and often subclinical under normal conditions [4, 17]. However, during acute infection, affected cattle may exhibit mild symptoms such as fever, lethargy, and dyspnea [18]. T. gondii and T. evansi infections in pregnant cows can lead to reproductive complications, such as abortion, stillbirth, or the birth of weak or debilitated offspring [19, 20]. Although congenital cases of both diseases are rare in cattle, there is still a risk of infection resulting in reproductive failure. These infectious diseases have significant economic consequences for livestock production, resulting in significant production losses and morbidity [4, 16]. In addition, there is a risk of transmission to other animals and humans in affected areas [4], which highlights the need for robust control and prevention measures to protect animal well-being and public health.

The protozoan T. gondii is horizontally transmitted to cattle and other animals through the ingestion of shed oocysts by a cat or feline host [21, 22]. In contrast, T. evansi transmission in cattle and other large animals is mechanically transmitted by blood-sucking arthropods and biting insects, such as tabanid flies [23]. During pregnancy, immunological alterations in cattle may jeopardize their immune defenses against T. gondii and T. evansi, increasing the likelihood of vertical transmission to the fetus and leading to adverse reproductive outcomes. Vertical transmission can also occur through transplacental transmission of active parasites from infected mothers to the fetus [8, 14].

In our previous study, we presented preliminary findings indicating a notable prevalence of transplacental-transmitted protozoan Neospora caninum in female beef cattle in Phayao, Thailand [24]. Other transplacental zoonotic protozoal infections remain unconfirmed, including T. gondii and T. evansi. Therefore, the aim of this study was to assess the molecular prevalence of transplacental-transmitted protozoans T. gondii and T. evansi and to identify epidemiological risk factors in female cattle who have recently calved.

Materials and Methods

Ethical approval

The University of Phayao Animal Ethics Committee granted ethical approval for the utilization of animals in this study, with the protocol number UP-AE59-02-04-0001.

Study period and location

This study was conducted from January to December 2016 throughout the year. Bovine placenta specimens were obtained from cattle reared in nine districts of Phayao province: Muang, Mae Chai, Dok Kamtai, Chiang Kham, Chiang Muan, Pong, Phu Sang, Phu Kamyao, and Chun. All laboratory examinations were performed at the School of Medical Sciences and the Scientific Instrument and Product Standard Quality Inspection Center, University of Phayao, Phayao, Thailand.

Animals and specimen collection

One hundred and six bovine placental specimens were collected from cows within 6 h of full-term pregnancy and calving. Cotyledons from each placenta were carefully isolated and subsequently preserved at –20°C until molecular analysis. Beef and dairy cows aged between 2 and 8 years were studied, all of which were reared by small-scale farmers in nine districts of Phayao province (with <30 cows). Detailed records of the age and breed of each animal were recorded.

Extraction of placental DNA

Bovine placental DNA was extracted and purified using a QIAamp DNA preparation kit (Qiagen, Germany) according to the manufacturer’s instructions. In brief, 100 mg of cotyledon tissue was homogenized in 180 μL of ATL buffer and 20 μL of a mixture of proteinase K and RNase A, followed by incubation at 56°C for 1 h. After incubation, 200 μL of AL buffer was added and thoroughly mixed by vortexing for 15 s before adding 200 μL of absolute ethanol. The mixture was then incubated at room temperature (25°C) for 10 min, loaded into the QIAamp MinElute (Qiagen) column, and centrifuged at 12,000× g for 1 min. The spin column was washed with 500 μL of AW1 buffer and centrifuged for 1 min after centrifugation. The washing process was repeated with 500 μL of AW2 buffer. Genomic DNA was eluted using 100 μL of AE buffer and stored at –20°C until further use.

T. gondii and T. evansi DNA polymerase chain reaction (PCR) screening

PCR was performed in a reaction volume of 50 μL, using QIAGEN Taq DNA Polymerase (Qiagen, Germany). In each PCR reaction, 200 μM of each dNTP, 1.5 mM of MgCl2, 10 pmol of each species-specific primer [25, 26], and 1.25 U of Taq DNA polymerase were added to coral PCR buffer with a pH of 8.7. In addition, 2 μL of the extracted DNA template was added to the reaction mixture. Table-1 [25, 26] summarizes the primer sequences and the expected PCR amplicons.

Table-1.

The sequence of PCR primers and the expected PCR products for the molecular detection of T. gondii and T. evansi in bovine placenta.

Gene Primer Sequences (5’-3’) PCR product (bp) Reference
T. gondii (B1) B22
B23
AACGGGCGAGTAGCACCTGAGGAGA
TGGGTCTACGTCGATGGCATGACAAC
115 [25]
T. evansi (ESAG) ESAGF
ESAGR
ACATTCCAGCAGGAGTTGGAG
CACGTGAATCCTCAATTTTGT
238 [26]

T. gondii=Toxoplasma gondii, T. evansi=Trypanosoma evansi, PCR=Polymerase chain reaction, ESAG=Expression site-associated gene

For T. gondii DNA detection, the following PCR conditions were used: 5 min at 94°C for denaturation, 40 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, and 5 min of a final extension step at 72°C. For T. evansi PCR, the amplification protocol was similar to that of B1 PCR, except that the annealing temperature was 55°C. The amplification reaction was performed using a GeneAmp PCR System 9700 (Applied Biosystems, USA).

DNA from T. gondii and T. evansi was used as a positive control, whereas that from N. caninum reference isolates (Nc-1) was used as the negative control.

PCR-amplified products were analyzed through electrophoresis on a 1.5% agarose gel in tris, acetate, and EDTA buffer. Agarose gel was pre-stained with Nancy-520 (Sigma-Aldrich, UK). PCR fragments were randomly selected for sequencing among the positive samples to validate the precision and specificity of the molecular detection method. The PCR products were sequenced in the forward and reverse directions using the respective primers. DNA sequencing was performed using Macrogen Sequencing (Korea).

Sequence analyses

Sequences of positive PCR from T. gondii and T. evansi were carefully checked and manually assembled. The obtained nucleotide sequence was initially analyzed using the standard nucleotide Basic Local Alignment Search Tool, accessible through the National Center for Biotechnology Information database (http://blast.ncbi.nlm.nih.gov/).

Accession numbers for nucleotide sequence

The T. gondii B1 sequences obtained in this study were registered in the GenBank database with the following accession numbers: OR853742-OR853745. The nucleotide sequence of T. evansi expression site-associated gene used in this study was deposited in the GenBank database under the accession number OR853746.

Statistical analysis

Descriptive statistics were used to determine the prevalence of T. gondii and T. evansi infection in each location, age group, and cattle type. The prevalence of infection was determined according to the ratio of positive PCR results to the total number of placentas examined. Differences in prevalence among distinct locations, age groups, and cattle types were analyzed using the Chi-square test. Statistical significance is indicated by p < 0.05.

Results

Cattle samples

A total of 106 female cattle placentas were collected shortly after calving for the examination of T. gondii and T. evansi DNA. The distribution of samples from each district was as follows: Mae Chai (38), Dok Kamtai (19), Chiang Kham (13), Muang (12), Chiang Muan (12), Pong (6), Phu Sang (4), Phu Kamyao (1), and Chun (1). The majority of placentas (98) were obtained from beef cattle, while eight placentas originated from dairy cattle. The mean age was 4.5 years (range 2–8 years). The majority of female cattle were <5 years old.

Molecular detection of T. gondii and T. evansi transmitted placentally

T. gondii and T. evansi DNA were examined in the placentas. Of the 106 specimens examined, 43 were positive for T. gondii B1 PCR, whereas only one was positive for T. evansi. T. gondii PCR analysis successfully amplified a 115-bp fragment of the B1 gene (Figure-1), whereas T. evansi PCR screening yielded a 238-bp amplicon from a single placenta of a 4-year-old beef cow from the Mae Chai district (Figure-2). Notably, there were no mixed infections in the samples.

Figure-1.

Figure-1

Representative polymerase chain reaction detection of Toxoplasma gondii in bovine placentas from cattle in Phayao, Thailand. Lane M: 100 bp DNA ladder; lane Tg: Positive control (reference strain T. gondii); lane N: Negative control (N. caninum); lanes 1–2, 4, and 6–7: Positive T. gondii samples; lanes 3 and 5: Negative samples.

Figure-2.

Figure-2

Representative polymerase chain reaction detection of Trypanosoma evansi in bovine placenta from cattle in Phayao, Thailand. Lane M: 100 bp DNA ladder; lane Te: Positive control (reference strain T. evansi); lane N: Negative control (N. caninum); lane 4: Positive T. evansi sample; lanes 1–3 and 5–7: Negative samples.

Sequence analyses

Positive samples were randomly selected for confirmation by sequencing. The nucleotide sequences obtained by T. gondii PCR exhibited a perfect match (98.26%–100% similarity) to the T. gondii B1 sequences deposited in GenBank (LN714499.1, MZ027344.1, AF179871.1, and XM_002370240.2). Sequencing results for positive T. evansi showed 98.73% similarity with GenBank sequences (KR858289.1, KR858291.1, KR858293.1, and KR858301.1).

Molecular prevalence and risk factor analyses

Only one placental sample from Mae Chai district tested positive for T. evansi by PCR, resulting in a prevalence of 0.9%. Positive placenta belonged to a 4-year-old beef cow.

On the other hand, 43 placentas tested positive for T. gondii DNA, indicating a prevalence of 40.6%. T. gondii-positive samples were found in placentas collected from all districts, with a prevalence ranging from 31.6% to 100.0%. The highest prevalence of T. gondii was observed in placentas from Phu Kamyao (100.0%), Chun (100.0%), Pong (66.7%), Muang (63.6%), and Phu Sang (50.0%), while the lowest prevalence was noted in cattle from Dok Khamtai district (31.6%). There were no significant differences in the proportions of positive cattle among different districts (p > 0.05).

The highest infection rate was observed in cattle aged ≥5 years (50.0%), followed by those aged <5 years (42.2%) and of unknown age (24.0%) among various age groups. With regard to cattle type, three positive samples for T. gondii PCR were found among the eight dairy cows (37.5%), whereas the remaining 40 positive samples were obtained from beef cattle (40.8%, 40/98). Statistical analysis revealed no significant correlation between cattle age and cattle type with T. gondii infection (p > 0.05). Table-2 presents the molecular prevalence of transplacental-transmitted protozoan T. gondii in naturally infected female cattle, categorized by each parameter.

Table-2.

Molecular prevalence of T. gondii infection in naturally infected female cattle in Phayao according to location, age, and type of cattle.

Variables/Factors No. of animals No. of T. gondii infected animals (prevalence %) Chi-square p-value
Locality 5.1604 0.7403
 Muang 12 7 (58.3)
 Mae Chai 38 12 (31.6)
 Dok Kamtai 19 6 (31.6)
 Chiang Kham 13 6 (46.2)
 Chiang Muan 12 4 (33.3)
 Pong 6 4 (66.7)
 Phu Sang 4 2 (50.0)
 Phu Kamyao 1 1 (100.0)
 Chun 1 1 (100.0)
Age 2.5115 0.2849
 <5 years 45 19 (42.2)
 ≥5 years 36 18 (50.0)
 Unknown 25 6 (24.0)
Cattle type 0.0201 0.8874
 Beef 98 40 (40.8)
 Diary 8 3 (37.5)
 Total 106 43 (40.6)

T. gondii=Toxoplasma gondii

Discussion

This study assessed the prevalence of transplacental-transmitted T. gondii and T. evansi protozoans in cattle from Phayao, northern Thailand, by screening placental specimens for protozoan genetic material. Detection of parasite DNA in the placenta suggested migration of the protozoan through the maternal bloodstream, potentially causing fetal infection. A positive result would indicate an active infection in the pregnant cow, implying that the protozoan is likely to pass through the placenta to the developing fetus. Our results revealed that 40.6% of bovine placentas tested positive for T. gondii DNA. In comparison to T. gondii, only 0.9% were positive for T. evansi, indicating that T. gondii is likely a common and more prevalent parasite associated with vertical transmission among cattle in Phayao. The distribution of T. gondii was consistently observed across all Phayao districts, although these differences did not reach statistical significance. On the other hand, T. evansi infection was identified in only one specimen collected from Mae Chai district, corresponding to a prevalence of 0.9%.

Notably, the overall prevalence of T. gondii in our study was higher than that reported in other regions of Thailand [27–29]. For example, recent investigations in the western regions reported a T. gondii infection rate of 15.2% in beef cattle [27], whereas serological examinations in the northern provinces documented T. gondii infection rates of 9.4%–17.0% in dairy cows [29]. The high prevalence of T. gondii in pregnant cows underscores the importance of understanding and addressing the impact of T. gondii on animal health and human health.

T. gondii and N. caninum present significant concerns for the livestock industry, resulting in substantial economic losses in ruminants [8]. In this study, we investigated placental infections of both T. gondii and T. evansi. We used bovine placentas collected from the same area as in our previous study, which determined the prevalence of N. caninum transplacental-transmitted protozoan [24]. If we combine the results of this study with those earlier findings, a mixed infection of T. gondii and N. caninum in beef cattle was identified in 16.0% of cows, a rate lower than 27.2% reported by Udonsom et al. [27] in their study in three provinces of western Thailand. This difference in prevalence can be attributed to differences in assessment methodologies and specific animal populations examined. Importantly, there was no evidence of a mixed infection of T. evansi with either T. gondii or N. caninum in this study.

Cattle are generally considered to be more resistant to T. gondii infection, and the occurrence of T. gondii-induced abortion in cattle is relatively rare [4, 30, 31]. However, the severity of the disease depends on a number of factors involving both the host and the parasite. Host factors, such as host species and individual immune systems, may affect clinical manifestations and susceptibility to infection, particularly during pregnancy and lactation or in undernourished animals. Pathogen-related factors, such as infection dosage, T. gondii genotype, and route of infection, also contribute to the overall outcome [4, 31].

One significant factor is the genotype of T. gondii, which is generally classified into three genotypes (I-III), with genotype I being the most virulent [32]. In humans and animals, this genotype is associated with more severe clinical manifestations, including tissue damage, organ failure, and even death [33, 34]. It should be noted that a virulent genotype in a particular area may increase the risk of serious infections and may affect the overall epidemiology of toxoplasmosis in that region. Suwancharoen et al. [35] and Chemoh et al. [36] recently presented evidence of T. gondii genotype I in definitive cat hosts in northern and southern Thailand, respectively. These findings highlight the potential risk of T. gondii genotype I exposure to cattle and humans. Therefore, further investigation into the circulation and dynamics of T. gondii genotype among hosts, including cattle, is essential for devising effective management and control strategies.

Our preliminary findings on the prevalence of T. evansi infection in female cattle in Phayao showed a relatively low presence of the parasite in bovine placentas compared to seroprevalence rates reported in other regions of Thailand [16, 37–41]. T. evansi infection in cattle is predominantly characterized as a subclinical disease, and cattle are often considered reservoir hosts for infection by other local susceptible hosts [14]. Despite this prevailing characterization, T. evansi-induced acute trypanosomiasis in cattle has been documented in India [42] and Thailand [15]. The economic impact of T. evansi infection on herds, affecting both small- and large-scale farms, is evident and primarily manifested in reduced productivity, leading to a subsequent decline in farmers’ incomes. Pholpark et al. [43] found a correlation between T. evansi infection and significant decreases in milk production in dairy cows. In addition, cases of abortion linked to T. evansi have been documented [16, 44]. The low prevalence of T. evansi observed in this study still poses a risk, suggesting that transplacental transmission may contribute to the sustainability and persistence of this zoonotic parasite.

Conclusion

This study revealed a high prevalence of T. gondii transplacental transmission, whereas the prevalence of T. evansi transplacental transmission was notably low in Phayao, northern Thailand. Although T. gondii and T. evansi are classically transmitted through different mechanisms, the transplacental transmission of T. gondii and T. evansi appears to play a significant role in sustaining and contributing to the persistence of these protozoan species in this area. The information presented here has significant implications for future research and intervention strategies of these important zoonotic protozoa, as they could harm livestock productivity and pose a significant health risk for both animals and humans.

Authors’ Contributions

OJ: Conceived and designed the study. OJ and KK: Surveyed, collected placental samples, and performed the study. OJ and KK: Conducted molecular work and performed sequence analyses. OJ and KP: Analyzed the data. OJ, KP, and KK: Drafted and revised the manuscript. All authors have read, reviewed, and approved the final manuscript.

Acknowledgments

This study was partly funded by the Higher Education Research Promotion (HERP), Thailand (project number 2559A31962001). The authors thank Ms. Thanawadee Chaiphutorn and Ms. Wannapha Kanameung for technical assistance. We thank the Department of Protozoology in the Faculty of Tropical Medicine at Mahidol University, the Division of Pathobiology in the Faculty of Veterinary Medicine at Khon Kaen University, and the Veterinary Research and Development Center of the Upper Northeastern Region for providing reference control species of T. gondii, T. evansi, and N. caninum.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

References

  • 1.Montoya J.G, Liesenfeld O. Toxoplasmosis. Lancet. 2004;363(9425):1965–1976. doi: 10.1016/S0140-6736(04)16412-X. [DOI] [PubMed] [Google Scholar]
  • 2.Truc P, Büscher P, Cuny G, Gonzatti M.I, Jannin J, Joshi P, Juyal P, Lun Z.R, Mattioli R, Pays E, Simarro P.P, Teixeira M.M.G, Touratier L, Vincendeau P, Desquesnes M. Atypical human infections by animal trypanosomes. PLoS Negl. Trop. Dis. 2013;7(9):e2256. doi: 10.1371/journal.pntd.0002256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Van Vinh Chau N, Buu Chau L, Desquesnes M, Herder S, Phu Huong Lan N, Campbell J.I, Van Cuong N, Yimming B, Chalermwong P, Jittapalapong S, Ramon Franco J, Tri Tue N, Rabaa M.A, Carrique-Mas J, Pham Thi Thanh T, Tran Vu Thieu N, Berto A, Thi Hoa N, Van Minh Hoang N, Canh Tu N, Khac Chuyen N, Wills B, Tinh Hien T, Thwaites G.E, Yacoub S, Baker S. A clinical and epidemiological investigation of the first reported human infection with the zoonotic parasite Trypanosoma evansi in Southeast Asia. Clin. Infect. Dis. 2016;62(8):1002–1008. doi: 10.1093/cid/ciw052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Stelzer S, Basso W, Benavides Silván J, Ortega-Mora L.M, Maksimov P, Gethmann J, Conraths F.J, Schares G. Toxoplasma gondii infection and toxoplasmosis in farm animals:Risk factors and economic impact. Food Waterborne Parasitol. 2019;15:e00037. doi: 10.1016/j.fawpar.2019.e00037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Schurer J.M, Rafferty E, Schwandt M, Zeng W, Farag M, Jenkins E.J. Toxoplasmosis and toxocariasis:An assessment of human immunodeficiency virus comorbidity and health-care costs in Canada. Am. J. Trop. Med. Hyg. 2016;95(1):168–174. doi: 10.4269/ajtmh.15-0729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Torgerson P.R, Macpherson C.N. The socioeconomic burden of parasitic zoonoses:Global trends. Vet. Parasitol. 2011;182(1):79–95. doi: 10.1016/j.vetpar.2011.07.017. [DOI] [PubMed] [Google Scholar]
  • 7.Witter R, Pena H.F.J, Maia M.O, de Magalhães A.O, Morgado T.O, Colodel E.M, Barros D.A, Igarashi M, Gennari S.M, Pacheco R.C. Isolation and genotyping of Toxoplasma gondii in Midwestern Brazil revealed high genetic diversity and new genotypes. Acta Trop. 2020;212:105681. doi: 10.1016/j.actatropica.2020.105681. [DOI] [PubMed] [Google Scholar]
  • 8.Dubey J. Toxoplasmosis of Animals and Humans. 3rd ed. Boca Raton: CRC Press; 2021. p. 564. [Google Scholar]
  • 9.Liu J, Zhang B, Cui L, Zhao T, Sheng Zhang R, Liu H, Du H, Gao J, Fang S. Toxoplasmosis presenting with multiple cranial nerve palsies and cavernous sinusitis:A case report. Neurol. Asia. 2019;24(2):171–173. [Google Scholar]
  • 10.Wang Z.D, Liu H.H, Ma Z.X, Ma H.Y, Li Z.Y, Yang Z.B, Zhu X.Q, Xu B, Wei F, Liu Q. Toxoplasma gondii infection in immunocompromised patients:A systematic review and meta-analysis. Front. Microbiol. 2017;8:389. doi: 10.3389/fmicb.2017.00389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.OIE. Terrestrial Manual. Paris: OIE; 2008. Toxoplasmosis; pp. 1284–1293. [Google Scholar]
  • 12.Weiss L.M, Dubey J.P. Toxoplasmosis:A history of clinical observations. Int. J. Parasitol. 2009;39(8):895–901. doi: 10.1016/j.ijpara.2009.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Layton J, Theiopoulou D.C, Rutenberg D, Elshereye A, Zhang Y, Sinnott J, Kim K, Montoya J.G, Contopoulos-Ioannidis D.G. Clinical spectrum, radiological findings, and outcomes of severe toxoplasmosis in immunocompetent hosts:A systematic review. Pathogens. 2023;12(4):543. doi: 10.3390/pathogens12040543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Desquesnes M, Dargantes A, Lai D.H, Lun Z.R, Holzmuller P, Jittapalapong S. Trypanosoma evansi and Surra:A review and perspectives on transmission, epidemiology and control, impact, and zoonotic aspects. BioMed Res. Int. 2013;2013:321237. doi: 10.1155/2013/321237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tuntasuvan D, Sarataphan N, Nishikawa H. Cerebral trypanosomiasis in native cattle. Vet. Parasitol. 1997;73(3):357–363. doi: 10.1016/s0304-4017(97)00128-3. [DOI] [PubMed] [Google Scholar]
  • 16.Kashiwazaki Y, Pholpark M, Polsar C, Pholpark S. Haemoparasite infections in newly introduced dairy cattle in Loei Province, Thailand:Trypanosoma evansi antigen levels by ELISA referring to abortion. Vet. Parasitol. 1998;80(2):99–109. doi: 10.1016/s0304-4017(98)00197-6. [DOI] [PubMed] [Google Scholar]
  • 17.Gomes D.F.C, da Silva Krawczak F, de Oliveira C.H.S, Ferreira Júnior Á, Fernandes É.K.K, Lopes W.D.Z, da Paixão Sevá A, Gennari S.M. Toxoplasma gondii in cattle in Brazil:A review. Rev. Bras. Parasitol. Vet. 2020;29(1):e015719. doi: 10.1590/S1984-29612019106. [DOI] [PubMed] [Google Scholar]
  • 18.Balamurugan V, Kumar K.V, Alamuri A, Sengupta P.P, Govindaraj G, Shome B.R. Prevalence of Toxoplasma gondii, Leptospira spp., and Coxiella burnetii-associated antibodies in dairy cattle with reproductive disorders. Vet. World. 2022;15(12):2844–2849. doi: 10.14202/vetworld.2022.2844-2849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Indrakamhang P. Trypanosoma evansi infection in livestock in Thailand. J. Protozool. Res. 1998;8(3):153–161. [Google Scholar]
  • 20.Wiengcharoen J, Thompson R.C, Nakthong C, Rattanakorn P, Sukthana Y. Transplacental transmission in cattle:Is Toxoplasma gondii less potent than Neospora caninum? Parasitol. Res. 2011;108(5):1235–1241. doi: 10.1007/s00436-010-2172-8. [DOI] [PubMed] [Google Scholar]
  • 21.Dubey J.P, Lindsay D.S. Neosporosis, toxoplasmosis, and sarcocystosis in ruminants. Vet. Clin. North Am. Food Anim. Pract. 2006;22(3):645–671. doi: 10.1016/j.cvfa.2006.08.001. [DOI] [PubMed] [Google Scholar]
  • 22.Guo M, Dubey J.P, Hill D, Buchanan R.L, Gamble H.R, Jones J.L, Pradhan A.K. Prevalence and risk factors for Toxoplasma gondii infection in meat animals and meat products destined for human consumption. J. Food Prot. 2015;78(2):457–476. doi: 10.4315/0362-028X.JFP-14-328. [DOI] [PubMed] [Google Scholar]
  • 23.Tamarit A, Gutierrez C, Arroyo R, Jimenez V, Zagalá G, Bosch I, Sirvent J, Alberola J, Alonso I, Caballero C. Trypanosoma evansi infection in mainland Spain. Vet. Parasitol. 2010;167(1):74–76. doi: 10.1016/j.vetpar.2009.09.050. [DOI] [PubMed] [Google Scholar]
  • 24.Japa O, Nuangmek A, Prakhammin K, Flynn R.J. Prevalence of vertically transmitted Neospora caninum amongst beef cattle in Phayao, Thailand. Parasitol. Int. 2019;70:98–101. doi: 10.1016/j.parint.2019.02.008. [DOI] [PubMed] [Google Scholar]
  • 25.Bretagne S, Costa J.M, Vidaud M, Tran J, Nhieu V, Fleury-Feith J. Detection of Toxoplasma gondii by competitive DNA amplification of bronchoalveolar lavage samples. J. Infect. Dis. 1993;168(6):1585–1588. doi: 10.1093/infdis/168.6.1585. [DOI] [PubMed] [Google Scholar]
  • 26.Holland W.G, Claes F, My L.N, Thanh N.G, Tam P.T, Verloo D, Büscher P, Goddeeris B, Vercruysse J. A comparative evaluation of parasitological tests and a PCR for Trypanosoma evansi diagnosis in experimentally infected water buffaloes. Vet. Parasitol. 2001;97(1):23–33. doi: 10.1016/s0304-4017(01)00381-8. [DOI] [PubMed] [Google Scholar]
  • 27.Udonsom R, Sukthana Y, Nishikawa Y, Fereig R.M, Jirapattharasate C. Current situation of Neospora caninum and Toxoplasma gondii infection among beef cattle in Kanchanaburi, Ratchaburi and Nakhon Patom provinces, Thailand. Thai J. Vet. Med. 2018;48(3):403–409. [Google Scholar]
  • 28.Wiengcharoen J, Nakthong C, Mitchaothai J, Udonsom R, Sukthana Y. Toxoplasmosis and neosporosis among beef cattle slaughtered for food in Western Thailand. Southeast Asian J. Trop. Med. Public Health. 2012;43(5):1087–1093. [PubMed] [Google Scholar]
  • 29.Inpankaew T, Pinyopanuwut N, Chimnoi W, Kengradomkit C, Sununta C, Zhang G, Nishikawa Y, Igarashi I, Xuan X, Jittapalapong S. Serodiagnosis of Toxoplasma gondii infection in dairy cows in Thailand. Transbound. Emerg. Dis. 2010;57(1–2):42–45. doi: 10.1111/j.1865-1682.2010.01105.x. [DOI] [PubMed] [Google Scholar]
  • 30.Dubey J.P, Murata F.H A, Cerqueira-Cézar C.K, Kwok O.C.H, Yang Y.R. Public health significance of Toxoplasma gondii infections in cattle:2009-2020. J. Parasitol. 2020;106(6):772–788. doi: 10.1645/20-82. [DOI] [PubMed] [Google Scholar]
  • 31.Toompong J. Are cattle the resistant host for Toxoplasma gondii infection? KKU Vet. J. 2021;31(2):119–126. [Google Scholar]
  • 32.Howe D.K, Sibley L.D. Toxoplasma gondii comprises three clonal lineages:Correlation of parasite genotype with human disease. J. Infect. Dis. 1995;172(6):1561–1566. doi: 10.1093/infdis/172.6.1561. [DOI] [PubMed] [Google Scholar]
  • 33.Sibley L.D, Boothroyd J.C. Virulent strains of Toxoplasma gondii comprise a single clonal lineage. Nature. 1992;359(6390):82–85. doi: 10.1038/359082a0. [DOI] [PubMed] [Google Scholar]
  • 34.Sanchez S.G, Besteiro S. The pathogenicity and virulence of Toxoplasma gondii. Virulence. 2021;12(1):3095–3114. doi: 10.1080/21505594.2021.2012346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Suwancharoen C, Phuangsri C, Prakhammin K, Japa O. Molecular detection and dense granule antigen 6 genotyping of feline Toxoplasma gondii in Phayao, Thailand. Vet. World. 2022;15(9):2309–2314. doi: 10.14202/vetworld.2022.2309-2314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chemoh W, Sawangjaroen N, Nissapatorn V, Sermwittayawong N. Genotyping of Toxoplasma gondii isolated from cat feces in Songkhla, Southern Thailand. Vet. Parasitol. Reg. Stud. Reports. 2018;13:105–109. doi: 10.1016/j.vprsr.2018.04.005. [DOI] [PubMed] [Google Scholar]
  • 37.Camoin M, Kocher A, Chalermwong P, Yangtarra S, Thongtip N, Jittapalapong S, Desquesnes M. Adaptation and evaluation of an ELISA for Trypanosoma evansi infection (Surra) in elephants and its application to a serological survey in Thailand. Parasitology. 2018;145(3):371–377. doi: 10.1017/S0031182017001585. [DOI] [PubMed] [Google Scholar]
  • 38.Kocher A, Desquesnes M, Kamyingkird K, Yangtara S, Leboucher E, Rodtian P, Dargantes A, Jittapalapong S. Evaluation of an indirect-ELISA test for Trypanosoma evansi infection (Surra) in buffaloes and its application to a serological survey in Thailand. Biomed Res. Int. 2015;2015:361037. doi: 10.1155/2015/361037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Desquesnes M, Kamyingkird K, Pruvot M, Kengradomkij C, Bossard G, Sarataphan N, Jittapalapong S. Antibody-ELISA for Trypanosoma evansi:Application in a serological survey of dairy cattle, Thailand, and validation of a locally produced antigen. Prev. Vet. Med. 2009;90(3–4):233–241. doi: 10.1016/j.prevetmed.2009.04.011. [DOI] [PubMed] [Google Scholar]
  • 40.Kamyingkird K, Chalermwong P, Saechan V, Kaewnoi D, Desquesnes M, Ngasaman R. Investigation of Trypanosoma evansi infection in bullfighting cattle in Southern Thailand. Vet. World. 2020;13(8):1674–1678. doi: 10.14202/vetworld.2020.1674-1678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Panja K, Sananmuang T, Jankong T, Pornsukarom S. Prevalence and factors associated with infected Trypanosoma evansi in buffaloes of Eastern Thailand. J. Mahanakorn Vet. Med. 2019;14(2):69–79. [Google Scholar]
  • 42.Kumar H, Gupta M.P, Sidhu P.K, Mahajan V, Bal M.S, Kaur K, Ashuma V, Verma S, Singla L.D. An outbreak of acute Trypanosoma evansi infection in crossbred cattle in Punjab, India. J. Appl. Anim. Res. 2012;40(3):256–259. [Google Scholar]
  • 43.Pholpark S, Pholpark M, Polsar C, Charoenchai A, Paengpassa Y, Kashiwazaki Y. Influence of Trypanosoma evansi infection on milk yield of dairy cattle in Northeast Thailand. Prev. Vet. Med. 1999;42(1):39–44. doi: 10.1016/s0167-5877(99)00056-2. [DOI] [PubMed] [Google Scholar]
  • 44.Aregawi W.G, Agga G.E, Abdi R.D, Büscher P. Systematic review and meta-analysis on the global distribution, host range, and prevalence of Trypanosoma evansi. Parasit. Vectors. 2019;12(1):67. doi: 10.1186/s13071-019-3311-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES