Phase-specific outcmes of arginine or branched-chain amino acids supplementation in low crude protein diets on performance, nutrient digestibility, and expression of tissue protein synthesis and degradation in broiler chickens infected with mixed Eimeria spp.

Abstract

A 35-d study investigated the impact of dietary supplementation with Arginine (Arg) or branched-chain amino acids (BCAA) of broilers receiving low-protein diets whilst infected with mixed Eimeria species. All birds were given the same starter (d0–10) and finisher (d28–35) diets. The 4 grower diets used were a positive control (PC) with adequate protein (18.5%), a low protein diet (NC;16.5% CP), or the NC supplemented with Arg or BCAA. Supplemental AA was added at 50% above the recommended levels. The treatments were in a 4 × 2 factorial arrangement, with 4 diets, with or without Eimeria inoculation on d14. Birds and feed were weighed after inoculation in phases: prepatent (d14–17), acute (d18–21), recovery (d22–28), and compensatory (d29–35). Ileal digesta, jejunum, and breast tissue were collected on d21, 28, and 35. There was no diet × Eimeria inoculation on growth performance at any phase. Infected birds weighed less and consumed less feed (P < 0.05) in all phases. In the prepatent and acute phases, birds on the Arg diets had higher weight gain (P < 0.05) and lower FCR, similar to PC, when compared to NC and BCAA-fed ones. Infection reduced AA digestibility on d21 and 28 (Met and Cys). However, birds that received supplemental AA had higher digestibility (P < 0.05) of their respective supplemented AA on d 21 only. Infected birds had lower (P < 0.05) BO + AT and higher PEPT1 expression on d21. There was a diet × Eimeria interaction (P = 0.004) on gene expression at d28; 4EBP1 genes were significantly downwardly expressed (P < 0.05) in birds fed Arg diet, irrespective of infection. Infected birds exhibited an upward expression (P < 0.05) of Eef2 on d21 and d28 but experienced a downward expression on d35. Supplemental Arg and BCAA had variable effects on growth performance, apparent ileal AA digestibility, and genes of protein synthesis and degradation, but the effect of Arg on promoting weight gain, irrespective of the Eimeria challenge, was more consistent.

INTRODUCTION

Coccidiosis is a widespread enteric disease caused by protozoan parasites belonging to the Eimeria genus. Eimeria infections lead to reduced availability of dietary amino acids (AA) for broiler growth, primarily due to pathogen-induced anorexia and disruptions in amino acid digestion and absorption (Taylor et al., 2022). This, in turn, results in poor growth and elevated mortality rates (Teng et al., 2020; Sharma et al., 2022). All these translate into significant annual economic losses for the global poultry industry (Chapman, 2014; Blake et al., 2020). Pathogen infections tend to divert resources away from their host organisms (Coop and Kyriazakis, 1999). In response to infection, hosts often initiate resource-intensive processes such as heightened mucin production and increased turnover of enterocytes (Fernando and McCraw, 1973; Collier et al., 2008). Additionally, hosts activate their immune systems and allocate resources towards repairing the damage caused by the pathogens (Sandberg et al., 2007).

Numerous strategies have been investigated to address the challenges of coccidia infection by the broiler industry, including the utilization of anticoccidial drugs. However, this approach has raised concerns about its potential contribution to antimicrobial resistance (AMR) through similar mechanisms of action, cross-resistance, co-selection, environmental contamination, and transmission to humans. Therefore, responsible use of these drugs, along with measures to mitigate the risk of AMR, is essential for sustainable agriculture and public health. (Chapman et al., 2005; Abbas et al., 2011). Vaccination is an alternative strategy to combat coccidiosis, but its efficiency is compromised by the intricate administration procedures and the substantial cost per bird (Mesa-Pineda et al., 2021). On the other hand, incorporating AA supplements into broiler diets offers potential advantages for reducing the impact of coccidiosis, owing to the functional attributes of these AA. Kyriazakis (2014) proposed a nutritional approach to coccidiosis management involving the manipulation of dietary composition, specifically focusing on AA supplementation, particularly those with beneficial effects on intestinal development, immune function, and gut health. For example, plasma Arg concentration is decreased in a dose-dependent manner following Eimeria infection, possibly due to its use as a substrate for nitric oxide synthesis (Allen and Fetterer, 2000; Rochell et al., 2016). However, others have observed that feeding low-protein diets (400 vs. 230 g/kg) may have a beneficial effect on the intestinal health of broilers by limiting the amount of unabsorbed AA in the intestine that can support the proliferation of pathogenic bacteria such as Clostridium perfringens (Drew et al., 2004; Wilkie et al., 2005).

Arginine (Arg) is an essential AA for broiler chickens and has been demonstrated to positively impact various aspects, including muscle protein synthesis, reducing oxidative stress, enhancing immunity, and mitigating disruptions in the intestinal mucosa (Wu et al., 2004). Arg serves as a fundamental precursor for numerous critical molecules, such as glutamate, glutamine, creatine, nitric oxide, proline, and polyamines (Ball and Urschel, 2007; Khajali & Wideman, 2010). Consequently, research has shown that the supplementation of Arg leads to improvements in the overall antioxidant capacity of the body. It enhances vital antioxidant systems in quails and broiler breeders, including glutathione and superoxide dismutase (Atakisi et al., 2009; Duan et al., 2015). Furthermore, nitric oxide, a molecule derived from Arg, has been observed to serve as an immune modulator and regulator of metabolism. It accomplishes this by increasing hormone-sensitive lipase activity and downregulating genes associated with lipogenesis and gluconeogenesis (Morris, 2007; Khajali & Wideman, 2010). Additionally, nitric oxide exerts a direct toxic effect on protozoan parasites such as coccidia (Alvarez et al., 2011). Recent findings (Castro et al., 2020 Teng et al., 2021) and the companion article (Liu et al., 2023) have highlighted the significant impact of dietary Arg supplementation in broilers, especially when fed a low-protein diet. The 0.75% supplementation of Arg was shown to substantially reduce gut permeability, indicating that Arg supplementation can serve as a valuable nutritional strategy for enhancing gut health, particularly in the presence of coccidiosis conditions.

Branched-chain amino acids (BCAA), namely Leucine (Leu), Ileucine (Ile), and Valine (Val), serve as precursors for energy production, protein synthesis, and signaling molecules. Consequently, their presence can potentially support and improve gut health, as discussed by Calder et al. (1999). Among the BCAA, Leu stands out for its unique ability to trigger protein synthesis via the mammalian target of the rapamycin (mTOR) pathway in the skeletal muscle cells (Atherton et al., 2010). Conversely, Val and Ile are recognized as the fourth and fifth limiting AA in corn-soybean meal (SBM) diets due to their specific roles in enhancing the overall health of broiler chickens (Kidd et al., 2021). Notably, when it comes to the growth performance of broiler chickens, a dietary deficiency of BCAAs yields the most pronounced detrimental effects on growth performance in comparison to other AA deficiencies (Konashi et al., 2000). Furthermore, research by Zhang et al. (2013) has shown that the supplementation of BCAAs to low-protein diets can lead to an upregulation of key nutrient transporters.

Consequently, reducing the amount of protein reaching the hindgut can be beneficial because it translates to fewer substrates from which putrefactive bacteria in the gastrointestinal tract would generate harmful substances, such as amines or phenols, that may impair growth (Qaisrani et al., 2015; Kaldhusdal et al., 2016). Given the important roles of Arg and BCAA as functional AA, this study aimed to investigate their effects when supplemented above the breeder-recommended levels in diets of broilers receiving marginally low-protein diets (20 g/kg CP reduction) and infected with mixed Eimeria spp. We hypothesized that reducing dietary protein whilst supplementing with Arg and BCAA could help birds susceptible to coccidiosis infection in terms of growth responses and muscle protein synthesis in broilers challenged with Eimeria spp.

MATERIALS AND METHODS

All the animal experiment procedures used in the current study were approved by the Institutional Animal Care and Use Committee of the University of Georgia. The AUP number is A2021 12-012.

Animals, Diets, Eimeria Challenge, and Experimental Design

One thousand two hundred and eighty Cobb 500 (by-products of female line) male broiler chicks were obtained at hatch (d 0) and received the same starter (d 0–10) and finisher diets (d 28–35). From d10 to 28, four experimental grower diets were fed to the birds: an adequate protein (PC) with 18.5% crude protein that met Cobb 500 nutrient recommendations (Cobb-Vantress, 2018); low protein (NC) with 16.5% CP, or NC supplemented with either Arg or BCAA as shown in Table 1. All the low-crude protein diets had supplemental Gly and Ser as sources of non-specific N and the same ratios of the non-supplemented AA to lysine. As there were no published recommended levels for Gly and Ser, the Gly-equivalent value used in the low-protein diets was based on the Gly-equivalent level of the PC diet. All supplemental AA was added at 50% above the requirement, but the ratio of individual BCAA was kept the same in all diets. A total of 8 treatments in a randomized complete block design; 4 × 2 factorial arrangement (4 diets, each with or without a mixed Eimeria infection at d14) were used; each treatment had 8 replicate pens with 20 birds each. Treatments were randomly allocated within each block, and blocks were randomly allocated spatially in the house. Feed and water were provided ad libitum during the study. Temperature and light schedules followed the Cobb 500 management guide (Cobb-Vantress, 2018).

Table 1.

Ingredients and calculated composition (%) of the experimental diets.

Items	Starter	Grower (d 9–28)				Finisher
	(d 0–9)	PC1	NC	NCARG	NCBCAA	(d 28–35)
Corn	53.6	61	71.6	71.1	70.8	65.3
Soybean meal	36.3	30.3	19.3	19.4	19.4	23.5
Soybean oil	4.40	4.89	3.36	3.31	2.75	4.6
Corn starch	3.00					3.45
Cellulose filler						0.62
L-Lysine	0.02	0.25	0.58	0.58	0.58	0.13
DL-Methionine	0.12	0.29	0.39	0.39	0.39	0.13
L-Threonine	0.03	0.11	0.25	0.25	0.25	0.07
Tryptophan			0.04	0.04	0.04
Glycine			0.14	0.15	0.15
Phenylamine			0.08	0.08	0.08
Arginine		0.05	0.32	0.83	0.32
Leucine					0.59
Isoleucine			0.15	0.15	0.51
Valine		0.01	0.19	0.19	0.60
Dicalcium phosphate	1.00	1.67	1.73	1.73	1.73	0.75
Limestone	0.9	0.38	0.42	0.42	0.42	0.81
Salt	0.28	0.23	0.12	0.12	0.12	0.30
Sodium bicarbonate	0.20	0.27	0.50	0.50	0.50	0.20
Potassium carbonate			0.30	0.31	0.31
Vitamin premix2	0.10	0.10	0.10	0.10	0.10	0.10
Trace mineral premix3	0.08	0.08	0.08	0.08	0.08	0.08
Phytase4	0.01	0.03	0.03	0.03	0.03	0.03
Titanium dioxide		0.30	0.30	0.30	0.30
Total	100	100	100	100	100	100
Calculated nutrients, standardized digestible amino acid (%), and energy
Protein5	22.0 (22.1)	20.3 (20.5)	17.5 (17.4)	17.5 (18.9)	17.5 (18.3)	17.1 (17.9)
ME, kcal/kg	3038	3089	3115	3111	3116	3169
Ca	0.72	0.68	0.68	0.68	0.68	0.59
Available P	0.30	0.41	0.40	0.40	0.40	0.24
Lysine5	1.24 (1.27)	1.26 (1.32)	1.22 (1.28)	1.21 (1.33)	1.21 (1.28)	0.97 (1.07)
Methionine5	0.46 (0.43)	0.60 (0.57)	0.65 (0.60)	0.65 (0.63)	0.65 (0.62)	0.41 (0.41)
Threonine5	0.87 (0.88)	0.86 (0.86)	0.82 (0.83)	0.82 (0.88)	0.82 (0.85)	0.70 (0.75)
Arginine5	1.49 (1.42)	1.36 (1.32)	1.26 (1.23)	1.75 (1.71)	1.26 (1.26)	1.08 (1.12)
Leucine5	1.88 (1.82)	1.73 (1.69)	1.43 (1.41)	1.43 (1.47)	2.01 (1.91)	1.52 (1.54)
Isoleucine5	0.96 (0.95)	0.85 (0.86)	0.79 (0.78)	0.78 (0.83)	1.14 (1.10)	0.71 (0.74)
Valine5	1.05 (1.02)	0.95 (0.94)	0.92 (0.89)	0.92 (0.93)	1.32 (1.26)	0.80 (0.81)

¹PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with arginine at 50% above requirement; NCBCAA, negative control supplemented with BCAA at 50% above requirement.

²Vitamin Premix: Supplemented per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; D-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; D-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1,892 g; α tocopheryl acetate, 11 mg; ethoxyquin, 125 mg.

³Mineral Premix: Supplemented as per kg of diet: manganese (MnSO₄.H₂O), 60 mg; iron (FeSO₄.7H₂O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO₄.5H₂O), 5 mg; iodine (ethylene diaminedihydroiodide), 0.15 mg; selenium (NaSeO₃), 0.3 mg.

⁴For starter diet Quantum Blue phytase was included at 0.10g/kg; For grower and finisher diets phytase provided by Adisseo was included at 0.03g/kg. The matrix values used for Ca and nonphytate phosphorus were 1.75 and 1.5 g/kg, respectively, according to manufacturer's specification.

⁵Calculated vs. analyzed CP and AA. Analyzed values are in parenthesis.

Infection protocol

On d14 (d0 postinoculation; pi), the birds were orally gavaged with either a solution containing 12,500 sporulated oocysts of E. maxima, 12,500 sporulated oocysts of E. tenella, and 62,500 sporulated oocysts of E. acervulina suspended in 1 mL of distilled water (infected group, IG) or were orally gavaged with 1 mL of distilled water (uninfected group, NIG) (Teng et al., 2021). The challenge dose was selected based on a previous study to ensure a mild infection (Teng et al., 2020). The Eimeria sporulated oocysts used were field strain oocysts from North Carolina, and the cloning procedure was previously described (Aggrey et al., 2019; Schneiders et al., 2019; Schneiders et al., 2020). All the birds were housed in the same room, but the challenged and unchallenged birds were physically separated by being on different sides of the house. Cross-contamination was minimized as much as possible by ensuring no cross-traffic from the challenged to the unchallenged birds. The unchallenged birds were first attended to during routine husbandry and sampling.

Measurements

Growth Performance

The growth performance response was partitioned into phases relative to the day of inoculation (prepatent, acute, recovery, and compensatory growth): prepatent (d0–3pi), acute (d4–7pi), recovery (d8–14pi), and compensatory phase (29–35d); the periods were defined as per Taylor et al. (2022). The end of prepatent, acute, recovery, and compensatory phases, when birds were weighed, corresponded to 4, 7, 14, and 21 d postinnoculation (dpi). The body weight gain and FCR were calculated for each of the phases. Mortality was monitored and recorded daily during the experiment to calculate mortality-adjusted growth performance indices.

Apparent Ileal Amino Acid Digestibility

At 7- and 14-d pi (marking the conclusion of the acute and recovery phases, respectively), 5 birds per pen were randomly selected and euthanized via cervical dislocation. The contents from the distal portion of the ileum, spanning from Meckel's diverticulum to the ileo-cecal-colonic junction, were obtained by flushing with distilled water into plastic containers. After collection, the ileal contents from birds within the same pen were combined and subsequently frozen at -20°C and then freeze-dried for later analysis.

Chemical Analysis

Diet samples were ground through a 0.5 mm sieve (Retsch ZM 200, Retsch GmbH and Co., KG., Germany). Except stated otherwise, all chemical analyses were done using AOAC methods (AOAC, 2006). Diet samples were analyzed for dry matter using a drying oven (VWR International Radnor, PA, AOAC method 934.01). The nitrogen content of the sample was analyzed using the combustion method (Method 968.06) using a LECO FP 828-MC nitrogen analyzer. Samples for AA analysis were hydrolyzed for 24 h in 6 N hydrochloric acid at 110°C under an atmosphere of N. For Met and Cys, performic acid oxidation was carried out before acid hydrolysis. The AA in the hydrolysate was determined by HPLC after post-column derivatization [Method 982.30E (a, b, c)].

Reverse Transcription and Real-Time PCR Analysis

At the end of the acute and recovery phases, 10 cm of mid-jejunal tissue were harvested and snap-frozen in liquid nitrogen for the subsequent analysis for peptide and AA transporters. Additionally, at the end of the acute, recovery, and compensatory phases, one bird was randomly selected from each pen, and 10 g of pectoralis major tissue at the center region was excised and snap-frozen in liquid nitrogen for analysis for markers of protein synthesis and degradation.

Following tissue collection, samples were homogenized using a MiniBeadBeater-16 (BioSpec Products Inc, Bartlesville, OK), and RNA extraction was carried out with QIAzol Lysis Reagents (Qiagen, Germantown, MD) according to the manufacturer's protocol. The concentration of RNA was determined using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, MA). Subsequently, the total RNA was diluted to a concentration of 200 ng/μL and underwent reverse transcription to generate cDNA, utilizing the High Capacity cDNA Synthesis Kits (Applied BioSystems, Life Technologies, based in Waltham, CA). The resulting cDNA samples were further diluted at a ratio of 1:5 for subsequent real-time PCR analysis, conducted on the Step One thermocycler (Applied Biosystems, located in Foster City, CA). The cDNA was mixed with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA) and reverse and forward primers for real-time PCR analysis. Samples were run in duplicates, and the 2^−ΔΔCt method was used to determine target gene expressions compared to housekeeping genes (Livak and Schmittgen, 2001). The primer sequences for the tested genes as well as the housekeeping genes are provided in Table 2, and outliers were removed from the data.

Table 2.

List of primers used for real-time PCR.

Gene symbol	Accession number	Forward primer	Reverse primer
GAPDHa	NM_204305.1	CCTCTCTGGCAAAGTCCAAG	GGTCACGCTCCTGGAAGATA
Protein degradation genes
MSTN	NM_001001461.1	AGTGGCTCTGGATGGCAGTAGTC	TCTGTCTCCACGTACAAGCATTGC
MYF5	NM_001030363.1	GCGGAAGGCAGCCACTATGAG	CGATGTACCTGATGGCGTTCCTC
MYOG	NM_204184.1	AGCAGGAGCGTGAGCAGAGG	CGATGGAGGAGAGCGAGTGGAG
MYF6	NM_001030746.1	CTGCTGCACAGGCTGGATCAG	AGGCCGACGACTCCACCATG
FBXO9	NM_001006414.1	CTATAGAGCGTGGCACCAAGTGG	TGTGGATCTTCAGGCGTTGTAAGC
Protein synthesis genes
Mtor	XM_417614	TTGGGTTTGCTTTCTGTGGCTGTC	ACAGACTTCTGCCTCTTGTGAGCA
S6K1	NM_001030721	TTTGCCTCCCTACCTCACACAAGA	AAGAACGGGTGAGCCTGAACTTCT
4EBP1	XM_424384	ATGGAGTGCCGTAATTCTCCGGTT	ACTCCTCCACAATTGGGCTGGTAA
eEF2	NM_205368	AGCCAATCCAAAGGACCATCCTCA	ACTGATCAACACCAACCAGACCGA
IGF-1	NM_001004384	AAAGCCACCTAAATCTGCACGCTC	AGTACCCTGCAGATGGCACATCA
Nutrient transporters
b 0AT(SLC6A19)	XM_419056.6	GGTGAAAGTCAATGAAGAACTG	GCACACCAGCGATGATTA
b0+AT(SLC7A9)	NM_001199133.1	TTATCACCGCACCTGAAC	AGCATCTGAAGGTGCATAG
EAAT3(SLC1A1)	XM_424930.6	GTGATTGTTCTGAGCGCTGT	ATCCCAGTACCAAAGGCATC
PEPT1(SLC15A1)	NM_204365.1	CTGGAGCATCCAAACTCA	CTTCAACCTCATTTGGATCAG

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MSTN, myostatin; MYF5, myogenic regulatory factor 5; MYOG, myogenin; MYF6, myogenic regulatory factor 6; FBX09, F-box proteins 9; mTOR, mechanistic target of rapamycin; S6K1, S6 kinase 1; 4EBP1, 4E-binding protein-1; eEF2, eukaryotic elongation factor 2; IGF-1, insulin-like growth factor-1. B0AT, Na+-dependent amino acid transporter, B0+AT, Na+-independent amino acid transporter, EAAT Excitatory amino acid transporter, PEPT1, Peptide transporter 1.

^aHousekeeping gene.

Calculations and Statistical Analysis

The apparent ileal digestibility (AID) of crude protein (CP) and AA in the experimental diets was calculated using the equation: AID = $\left\{1-\left(\frac{I\mathrm{D}\times A\mathrm{I}}{A\mathrm{D}\times I\mathrm{I}}\right)\right\}$× 100; where $I\mathrm{D}$= Titanium content in the assay diet (% DM), $A\mathrm{I}$= AA or CP content in ileal digesta (% DM), $A\mathrm{D}$ = AA or CP content in the assay diet (% DM), $I\mathrm{I}$ = Titanium concentration in ileal digesta (% DM).

All data were analyzed using a 2-way ANOVA in a 4 × 2 arrangement (diets × infection status) using the MIXED procedure of SAS 9.4. For the growth performance, ANCOVA was performed with the body weight at the start of each phase as covariates to account for a priori differences in performance (Sakkas et al., 2018; Taylor et al., 2022). Tukey's HSD test was used to separate significantly different means, set at P < 0.05.

RESULTS

Growth Performance at Prepatent, Acute, Recovery, and Compensatory Growth Phases

There was no significant diet × Eimeria infection interaction during the prepatent phase (0–3 dpi). Additionally, there was no difference in growth performance (feed intake, weight gain, and FCR) between infected and uninfected birds. The NC and BCAA-fed birds had significantly (P < 0.05) reduced weight gain compared with the Arg or PC-fed birds (Table 3).

Table 3.

Effects of low-protein diets supplemented with arginine or branched-chain amino acids on feed intake, weight gain, end body weight, and FCR of broiler chickens infected, or not, with a mixed Eimeria spp, during prepatent and acute phases.

Items		Treatments	Prepatent				Acute
			AFI, g	AWG,g	EBW, g	FCR	AFI, g	AWG, g	EBW, g	FCR
Diet × Infection
	Uninfected	PC	389	318	757	1.23	339	251	1008	1.36
		NC	362	285	703	1.28	325	217	917	1.50
		NCArg	379	301	741	1.26	337	249	992	1.36
		NCBCAA	372	289	701	1.30	333	231	930	1.45
	Infected	PC	376	309	748	1.22	268	189	940	1.42
		NC	369	292	709	1.27	248	163	872	1.52
		NCArg	373	301	732	1.25	246	171	903	1.46
		NCBCAA	372	291	719	1.28	250	170	890	1.48
Infection
		Uninfected	376	298	725	1.26	334	237	962	1.41
		Infected	373	298	727	1.26	253	173	901	1.46
Diet
		PC	383	314a	752a	1.22	304	220a	974a	1.39b
		NC	366	288b	706b	1.27	286	190b	895b	1.51a
		NCArg	376	301ab	736ab	1.26	292	210a	947a	1.41b
		NCBCAA	372	290b	710b	1.29	292	201ab	910b	1.46ab
Source			Pooled SEM
Diet			6.68	7.26	6.26	0.02	8.46	6.93	7.06	0.03
Infection			2.58	0.69	1.20	0.01	52.26	45.26	42.0	0.03
Diet × Infection			7.31	7.36	27.4	0.02	8.77	7.43	37.3	0.03
Source			Probabilities
Diet			0.145	0.003	0.004	0.092	0.236	<0.001	<0.001	0.002
Infection			0.598	0.981	0.881	0.632	<0.001	<0.001	<0.001	0.022
Diet × infection			0.555	0.700	0.667	0.078	0.695	0.402	0.283	0.998

^abcMeans within a group in the same column, but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

AFI, average feed intake; AWG, average weight gain; EBW, end body weight; FCR, feed conversion ratio. Prepatent, 0-3dpi; acute, 4-7dpi; dpi, days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

There was no significant diet × Eimeria infection interaction during the infection's acute phase (4–7dpi). The infected birds had a decrease (P < 0.05) in feed intake, weight gain, and end-body weight but increased FCR. The birds fed NC or NCBCAA diets showed (P < 0.05) reduced weight gain and d14 body weight with significantly increased FCR when compared with the NCArg or PC groups (Table 3).

There was a significant diet × Eimeria infection interaction (P < 0.05) on the body weight at the end of the recovery phase (8–14dpi); infected birds with NC diets had the lowest d28 body weight, whereas uninfected birds with PC or Arg-fed diets had the highest d28 body weight (Table 4). The infected birds had a significant (P < 0.05) decrease in weight gain and d28 body weight with increased FCR compared with the uninfected birds. In addition, the birds fed NC diets showed a significant (P < 0.05) decrease in d28 body weight compared to the PC or NCArg-fed groups.

Table 4.

Effects of low-protein diets supplemented with arginine or branched-chain amino acids on feed intake, weight gain, end body weight, and FCR in broiler chickens infected with a mixed Eimeria spp, at recovery (14 dpi) and compensatory growth (21 dpi) phases.

Items			Treatments	Recovery				Compensatory growth
				AFI, g	AWG, g	EBW, g	FCR	AFI, g	AWG, g	EBW, g	FCR
Diet × Infection
	Uninfected		PC	1038	800	1810a	1.30	1348	796	2605	1.70
			NC	961	750	1675b	1.29	1298	865	2540	1.51
			NCArg	1044	805	1801a	1.30	1348	807	2607	1.68
			NCBCAA	1000	741	1676b	1.35	1298	802	2475	1.64
	Infected		PC	1041	658	1597bc	1.58	1327	801	2390	1.66
			NC	1022	625	1501c	1.64	1294	759	2259	1.73
			NCArg	993	620	1524bc	1.61	1251	746	2267	1.68
			NCBCAA	1002	638	1531bc	1.57	1235	710	2243	1.75
Infection
			Uninfected	1011	774	1740	1.31	1323	817	2557	1.63
			Infected	1014	635	1538	1.60	1277	754	2290	1.71
Diet
			PC	1039	729	1704a	1.44	1338a	799	2497a	1.68
			NC	991	688	1588c	1.47	1296ab	812	2399b	1.62
			NCArg	1018	712	1662ab	1.45	1299ab	777	2437ab	1.68
			NCBCAA	1001	690	1603bc	1.46	1267b	756	2359b	1.69
Source				Pooled SEM
Diet				22.2	19.4	11.5	0.05	23.2	25.3	17.2	0.05
Infection				2.69	89.7	75.6	0.26	39.4	62.1	14.2	0.07
Diet × Infection				27.9	17.6	65.1	0.04	22.9	24.9	10.5	0.06
Source				Probabilities
Diet				0.339	0.065	<0.001	0.951	0.028	0.126	0.072	0.584
Infection				0.854	<0.001	<0.001	<0.001	0.006	0.001	<0.001	0.061
Diet × Infection				0.276	0.133	0.035	0.544	0.178	0.129	0.269	0.551

^abcMeans within a group in the same column, but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

AFI- average feed intake, AWG – average weight gain, EBW – end body weight, FCR – feed conversion ratio. recovery – 7-14dpi; compensatory growth – 14-21dpi, dpi – days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

No significant diet × Eimeria infection interaction occurred during the compensatory growth phase (15–21 dpi). The infected birds showed a significant (P < 0.05) decrease in feed intake, weight gain, and d35 body weight compared with the uninfected birds. The birds fed NC and NCBCAA diets significantly (P < 0.05) reduced feed intake, weight gain, and d35 body weight compared with birds fed PC or Arg diets (Table 4).

Apparent Ileal Amino Acid Digestibility

Acute phase (d21 or 7 dpi). There was no significant diet × Eimeria infection on AA digestibility during this phase. The infected birds had reduced (P < 0.05) apparent ileal digestibility (AID) for all AA on d21, except for Cys (Table 5, Table 6). Birds fed the PC diets had higher (P < 0.05) AID for His, Phe, Ala, Asp, Cys, Glu, Pro, Ser, and Tyr on d21 compared to birds on low-protein diets. Birds receiving NCArg or NCBCAA diets had greater (P < 0.05) AID for the respective supplemented AA. However, the AID for Met, Lys, Thr, and Gly were not different among the treatments.

Table 5.

Effects of low-protein diets supplemented with arginine or branched-chain amino acid on indispensable amino acid digestibility in broiler chickens infected with a mixed Eimeria spp, at the end of the acute phase.

Items		Treatments	DMD	N	Arg	His	Ile	Leu	Lys	Met	Phe	Thr	Val
Diet × Infection
	Uninfected	PC	75.3	81.3	90.4	84.1	81.8	84.1	87.5	92.2	85.0	77.9	81.2
		NC	75.9	78.7	90.0	81.0	81.6	82.2	87.5	92.9	83.8	78.0	81.5
		NCArg	74.8	78.4	91.8	80.6	81.5	82.0	87.0	92.6	83.6	78.0	81.1
		NCBCAA	74.0	79.1	90.5	81.1	87.0	86.9	87.8	93.2	84.1	78.7	86.9
	Infected	PC	70.5	76.6	89.5	82.8	79.7	81.7	85.4	90.3	82.7	76.6	78.9
		NC	71.3	71.6	89.4	78.3	78.7	79.6	84.4	90.2	81.2	75.0	78.1
		NCArg	71.1	72.5	91.7	79.0	79.1	79.0	84.9	90.3	81.2	76.5	78.4
		NCBCAA	72.0	71.9	89.5	78.3	84.7	84.9	84.1	90.6	81.6	75.5	84.3
Infection
		Uninfected	75.0	79.4	90.7	81.7	83.0	83.8	87.5	92.7	84.1	78.2	82.7
		Infected	71.2	73.1	90.0	79.6	80.6	81.3	84.7	90.4	81.7	75.9	79.9
Diet
		PC	72.9	79.0a	90.0b	83.5a	80.8b	82.9ab	86.5	91.3	83.8a	77.3	80.1b
		NC	73.6	75.1b	89.7b	79.7b	80.2b	80.9b	86.0	91.6	82.5b	76.5	79.8b
		NCArg	73.0	75.5b	91.7a	79.8b	80.3b	80.5b	85.9	91.4	82.4b	77.3	79.7b
		NCBCAA	73.0	75.5b	90.0b	79.7b	85.9a	85.9a	86.0	91.9	82.9b	77.1	85.6a
Source			Pooled SEM
Diet			0.71	0.43	0.21	0.36	0.33	0.32	0.30	0.22	0.31	0.39	0.35
Infection			0.63	0.28	0.16	0.25	0.24	0.24	0.20	0.15	0.24	0.26	0.24
Diet × Infection			1.19	0.54	0.31	0.49	0.45	0.45	0.40	0.29	0.46	0.51	0.46
Source			Probabilities
Diet			0.835	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	0.572	0.534	0.037	0.240	< 0.001
Infection			< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	<0.001
Diet× Infection			0.668	0.098	0.512	0.314	0.862	0.713	0.159	0.520	0.993	0.157	0.751

^abcMeans within a group in the same column, but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

N - nitrogen, DM - dry matter; Prepatent – 0-3dpi; acute – 4-7dpi; recovery – 7-14dpi; compensatory growth – 14-21dpi, dpi – days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Table 6.

Effects of low-protein diets supplemented with Arg or branched chain amino acid on dispensable AA digestibility in broiler chickens infected with a mixed Eimeria spp at the end of the acute phase (7 dpi).

Items		Treatments	Ala	Asp	Cys	Gly	Glu	Pro	Ser	Tyr
Diet × Infection
	Uninfected	PC	82.8	81.5	70.8	77.9	88.4	81.0	81.8	83.1
		NC	80.7	78.2	66.3	77.6	86.1	78.5	78.2	80.5
		NCArg	80.3	78.1	64.5	77.9	86.3	78.1	77.7	79.5
		NCBCAA	80.4	78.9	66.0	78.2	86.7	77.9	78.8	79.8
	Infected	PC	79.3	80.6	71.4	78.1	87.1	80.7	80.9	82.2
		NC	75.0	75.6	65.5	76.3	84.6	77.2	76.1	78.1
		NCArg	74.9	76.6	66.2	77.9	84.5	77.3	76.7	77.9
		NCBCAA	74.8	75.6	65.1	76.5	84.6	77.3	76.3	77.8
Infection
		Uninfected	81.0	79.2	66.9	77.9	86.9	78.9	79.1	80.7
		Infected	76.0	77.1	67.1	77.2	85.2	78.1	77.5	79.0
Diet
		PC	81.0a	81.1a	71.1a	78.0	87.7a	80.8a	81.4a	82.6a
		NC	77.8b	76.9b	65.9b	76.9	85.4b	77.8b	77.2b	79.3b
		NCArg	77.6b	77.3b	65.3b	77.9	85.4b	77.7b	77.2b	78.7b
		NCBCAA	77.6b	77.2b	65.5b	77.4	85.7b	77.6b	77.5b	78.8b
Source			Pooled SEM
Diet			0.41	0.39	0.57	0.36	0.23	0.32	0.39	0.36
Infection			0.27	0.26	0.40	0.24	0.18	0.23	0.27	0.26
Diet × infection			0.53	0.52	0.76	0.47	0.35	0.45	0.55	0.50
Source			Probabilities
Diet			< 0.001	< 0.001	< 0.001	0.059	< 0.001	< 0.001	< 0.001	< 0.001
Infection			< 0.001	0.738	0.044	< 0.001	0.029	< 0.001	< 0.001	<0.001
Diet× Infection			0.168	0.122	0.335	0.143	0.624	0.742	0.407	0.537

^abMeans within a group in the same column, but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

Prepatent – 0-3dpi; acute – 4-7dpi; recovery – 7-14dpi; compensatory growth – 14-21dpi, dpi – days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Recovery phase (d28 or 14 dpi). This phase had no significant diet × Eimeria infection interactions on AA digestibility. The infected birds had reduced (P < 0.05) AID for Met and Cys compared to the uninfected group (Table 7, Table 8). Birds receiving the PC diets had higher (P < 0.05) AID for DM, N, Arg, Ile, Leu, Phe, Cys, Gly, Glu, and Ser compared to the birds on low-protein diets. Notably, birds fed NCArg diet had greater (P < 0.05) AID for His, Asp, and Pro compared to the NC group. Conversely, birds on BCAA-supplemented diets had higher (P < 0.05) AID for Val and Tyr compared to the PC group. However, there were no diet effects on AID of all AA, except Met and Cys.

Table 7.

Effects of low-protein diets supplemented with arginine or branched-chain amino acid on dry matter, nitrogen, and indispensable amino acids digestibility in broiler chickens infected with a mixed Eimeria spp. at the end of the recovery phase (14 dpi).

Items		Treatments	DMD	N	Arg	His	Ile	Leu	Lys	Met	Phe	Thr	Val
Diet × Infection
	Uninfected	PC	75.8	81.5	91.9	87.2	85.7	86.3	89.1	93.6	86.9	80.5	83.7
		NC	78.1	77.7	91.7	84.3	85.2	84.8	89.3	94.1	85.7	79.8	83.7
		NCArg	75.9	80.6	94.1	85.1	86.6	85.7	90.1	94.8	86.9	82.1	84.8
		NCBCAA	77.0	78.0	91.5	84.3	89.6	88.6	89.0	94.3	85.8	81.0	88.4
	Infected	PC	73.8	81.7	92.4	87.2	86.3	86.5	89.3	93.6	87.1	80.9	84.2
		NC	77.7	77.6	91.9	84.0	85.6	84.8	89.0	94.0	85.7	79.9	83.5
		NCArg	73.6	79.3	94.2	84.5	86.0	85.0	89.2	93.9	86.4	80.8	83.7
		NCBCAA	75.7	76.2	90.6	82.7	88.5	87.2	88.3	93.2	84.2	79.8	87.3
Infection
		Uninfected	76.7	79.4	92.3	85.2	86.8	86.4	89.4	94.2	86.3	80.8	85.1
		Infected	75.2	78.7	92.2	84.6	86.6	85.9	89.0	93.7	85.9	80.3	84.7
Diet
		PC	74.8c	81.6a	85.1a	92.2b	84.4a	75.2a	89.5	82.1	87.2a	86.0	86.4ab
		NC	77.9a	77.6b	83.3ab	91.8b	80.7b	69.7b	87.6	80.8	84.2ab	85.4	84.8b
		NCArg	74.7c	80.0ab	83.6ab	94.1a	82.4ab	70.9ab	88.5	82.4	84.8ab	86.3	85.4b
		NCBCAA	76.4b	77.1b	81.7b	91.0b	80.7b	69.1b	86.9	80.9	83.5b	89.1	87.9a
Source			Pooled SEM
Diet			1.04	0.66	0.24	0.47	0.51	0.51	0.41	0.33	0.51	0.65	0.52
Infection			0.56	0.35	0.13	0.21	0.27	0.27	0.22	0.18	0.27	0.34	0.28
Diet × infection			1.04	0.66	0.24	0.47	0.51	0.51	0.41	0.34	0.51	0.65	0.52
Source			Probabilities
Diet			0.008	< 0.001	< 0.001	< 0.001	< 0.001	< 0.001	0.108	0.109	0.029	0.073	< 0.001
Infection			0.063	0.144	0.743	0.093	0.630	0.219	0.188	0.040	0.241	0.300	0.234
Diet× Infection			0.814	0.458	0.056	0.448	0.402	0.520	0.627	0.396	0.339	0.483	0.452

^abcMeans within a group in the same column, but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

dpi – days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Table 8.

Effects of low-protein diets supplemented with Arg or BCAA on dispensable AA digestibility in broiler chickens infected with a mixed Eimeria spp at the end of the recovery phase (14 dpi).

Items		Treatments	Ala	Asp	Cys	Gly	Glu	Pro	Ser	Tyr
Diet × infection
	Uninfected	PC	85.0	84.3	75.7	81.8	89.4	84.6	84.2	85.4
		NC	83.5	80.8	69.9	80.6	87.7	81.7	80.1	82.3
		NCArg	84.4	82.7	71.9	82.4	88.7	82.7	82.0	83.3
		NCBCAA	82.7	81.5	70.7	81.2	87.6	82.1	81.0	82.5
	Infected	PC	85.1	84.5	74.6	82.3	89.6	84.9	84.4	85.5
		NC	83.1	80.7	69.5	81.1	87.6	82.1	80.4	82.5
		NCArg	82.8	82.2	70.0	82.3	88.4	82.4	81.2	82.7
		NCBCAA	80.7	79.8	67.4	80.6	86.1	80.4	79.4	81.0
Infection
	Uninfected		83.9	82.3	72.1	81.5	88.3	82.8	81.8	83.4
	Infected		82.9	81.8	70.4	81.6	87.9	82.5	81.3	82.9
Diet
		PC	89.2	93.6b	87.0a	84.7a	84.3a	80.7ab	85.4a	83.9b
		NC	89.2	94.0a	85.7b	81.9b	80.5b	79.9b	82.4b	83.6b
		NCArg	89.7	94.3a	86.6a	82.6ab	81.6ab	81.4a	83.0b	84.2b
		NCBCAA	88.6	93.8b	85.0b	81.2b	80.2b	80.4ab	81.7c	87.9a
Source			Pooled SEM
Diet			0.57	0.43	0.52	0.36	0.34	0.39	0.46	0.39
Infection			0.39	0.29	0.35	0.25	0.23	0.25	0.31	0.27
Diet × infection			0.75	0.55	0.68	0.47	0.43	0.48	0.61	0.52
Source			Probabilities
Diet			0.241	< 0.001	< 0.001	0.003	0.003	0.001	< 0.001	0.001
Infection			0.079	0.226	0.001	0.846	0.212	0.397	0.204	0.216
Diet× Infection			0.510	0.394	0.230	0.601	0.285	0.148	0.470	0.398

^abcMeans within a group in the same column but with different superscripts are significantly different (P 0.05); n is 8 replicate pens with 20 birds per replicate.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

dpi – days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Peptide and Amino Acid Transporters

Acute phase (d21 or 7 dpi). There was no significant diet × Eimeria interaction during this phase. Eimeria-infected birds had lower expression of Na+-independent AA transporter (BO+AT) and higher expression of peptide transporter 1 (PepT1) (P < 0.05) in comparison to their uninfected counterparts. The additional supplementation of Arg or BCAA had no effect on the AA and peptide transporters analyzed (Table 9).

Table 9.

Effects of low-protein diets supplemented with Arg or BCAA on peptide and amino acids transporters gene in broiler chickens infected with a mixed Eimeria spp at the end of the acute and recovery phases (14 dpi).

Items		Treatments	D7 postinfection				D14 postinfection
			BO+AT	BOAT	EAAT	PepT1	BO+AT	BOAT	EAAT	PepT1
Diet × infection
	Uninfected	PC	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00b
		NC	1.35	1.74	0.82	1.49	1.32	1.17	1.34	1.30a
		NCArg	1.02	1.13	0.72	0.90	0.89	0.90	1.06	0.57d
		NCBCAA	1.56	1.81	1.53	1.71	0.49	0.68	0.86	0.71cd
	Infected	PC	0.32	0.87	0.58	1.27	0.97	1.10	1.11	0.93bc
		NC	1.10	1.86	0.87	1.33	1.03	0.91	1.00	0.82c
		NCArg	1.11	2.08	1.29	2.07	0.77	0.95	0.87	1.07b
		NCBCAA	0.73	2.63	1.13	2.55	1.00	0.99	0.66	1.20a
Infection
	Uninfected		1.23	1.42	1.02	1.28	0.93	0.94	1.06	0.89
	Infected		0.82	1.86	0.97	1.81	0.94	0.99	0.91	1.01
Diet
		PC	0.66	0.94	0.79	1.14	0.98	1.05	1.05	0.96
		NC	1.23	1.80	0.84	1.41	1.17	1.04	1.17	1.06
		NCArg	1.07	1.60	1.00	1.49	0.83	0.92	0.96	0.82
		NCBCAA	1.14	2.22	1.33	2.13	0.75	0.83	0.75	0.96
Source			Pooled SEM
Diet			0.22	0.46	0.20	0.44	0.12	0.14	0.12	0.09
Infection			0.26	0.31	0.04	0.34	0.01	0.03	0.05	0.07
Diet × infection			0.41	0.52	0.14	0.38	0.14	0.12	0.10	0.28
Source			Probabilities
Diet			0.139	0.288	0.715	0.568	0.112	0.849	0.269	0.354
Infection			0.023	0.154	0.763	0.029	0.858	0.583	0.149	0.381
Diet× infection			0.294	0.552	0.155	0.134	0.086	0.158	0.494	0.007

^abcMeans within a group in the same column but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate.

B0AT, Na+-dependent amino acid transporter; B0+AT, Na+-independent amino acid transporter; EAAT, excitatory amino acid transporter; PepT1, peptide transporter 1.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

dpi – days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Recovery phase (d28 or 14 dpi). There was significant (P < 0.01) diet × Eimeria interaction on PepT1 expression, with uninfected birds fed NC diet and infected birds fed NCBCAA having the highest levels of PepT1 (Table 9). Birds that received supplemental Arg or BCAA had lower expression of PepT1 compared with the NC diet in the uninfected group, but the opposite was the case in the infected group.

mRNA Expression of Protein Synthesis and Degradation Genes in the Pectoralis Major

Acute phase (d21 or 7 dpi). A diet × Eimeria interaction (P < 0.05) was observed at this phase for the expression of protein degradation genes (myogenic regulatory factor 5 and myogenin). The expression of these genes was significantly increased (P < 0.05) in birds fed NC or NCBCAA diets in the infected birds (Table 10). Eimeria-infected birds had an upward expression (P < 0.05) of eukaryotic elongation factor 2 (Eef2) and a downward expression (P < 0.05) of S6 kinase 1(S6K1). The additional supplementation of Arg or BCAA did not yield any significant (P > 0.05) effects on the expression of both synthesis and degradation genes during this phase (Table 10).

Table 10.

Effects of low-protein diets supplemented with arginine or branched-chain amino acids on protein synthesis and degradation genes in broiler chickens infected with a mixed Eimeria spp at the end of the acute phase (7 dpi).

Items		Treatments		Protein synthesis genes				Degradation genes
Diet × infection			4EBP1	Eef-2	MTOR	IGF-1	S6K1	FBX09	MYF5	MYF6	MYOG	MSTN-1
	Uninfected	PC	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00b	1.00
		NC	0.66	0.67	0.79	0.47	0.65	0.67	0.64	0.40	0.40d	0.40
		NCArg	0.77	0.90	0.83	0.75	0.63	1.09	0.46	0.44	0.71c	0.71
		NCBCAA	0.50	0.64	0.59	0.45	0.28	0.59	0.77	0.62	0.76c	0.76
	Infected	PC	0.66	1.44	0.45	0.88	0.35	0.80	0.47	0.62	0.87bc	0.87
		NC	1.10	1.09	0.77	0.86	0.43	1.20	0.61	0.66	1.20a	1.20
		NCArg	0.74	1.08	0.63	0.63	0.45	0.77	0.72	0.54	0.58cd	0.58
		NCBCAA	0.80	1.37	0.64	0.47	0.35	0.68	0.80	0.37	1.07b	1.07
Infection
	Uninfected		0.84	0.79	0.80	0.66	0.64	0.82	0.81	0.60	0.71	0.71
	Infected		0.73	1.20	0.60	0.67	0.39	0.83	0.65	0.52	0.94	0.94
Diet
		PC	0.82	1.22	0.71	0.91	0.67	0.85	0.69	0.80	0.64	0.92
		NC	0.88	0.85	0.78	0.68	0.54	0.94	0.70	0.55	0.78	0.85
		NCArg	0.75	0.96	0.71	0.66	0.51	0.90	0.59	0.46	0.62	0.65
		NCBCAA	0.61	0.95	0.59	0.42	0.33	0.61	0.94	0.44	0.56	0.89
Source			Pooled SEM
Diet			0.12	0.18	0.11	0.16	0.10	0.12	0.12	0.16	0.12	0.17
Infection			0.08	0.12	0.08	0.11	0.06	0.09	0.11	0.12	0.10	0.12
Diet × infection			0.18	0.23	0.15	0.22	0.14	0.17	0.22	0.22	0.19	0.28
Source			Probabilities
Diet			0.412	0.513	0.738	0.271	0.103	0.314	0.513	0.386	0.656	0.647
Infection			0.429	0.031	0.105	0.954	0.011	0.068	0.236	0.657	0.198	0.196
Diet× Infection			0.122	0.765	0.335	0.481	0.065	0.089	0.050	0.446	0.001	0.132

^abcMeans within a group in the same column but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate. MSTN, myostatin; MYF5, myogenic regulatory factor 5; MYOG, myogenin; MYF6, myogenic regulatory factor 6; FBX09, F-box proteins 9; mTOR, mechanistic target of rapamycin; S6K1, S6 kinase 1; 4EBP1, 4E-binding protein-1; eEF2, eukaryotic elongation factor 2; IGF-1, insulin-like growth factor-1.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

dpi, days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Recovery phase (d28 or 14 dpi). There was a diet × Eimeria interaction (P < 0.05) for the protein synthesis gene (4E-binding protein 1, 4EBP1), which was downwardly expression (P < 0.05) in Arg-fed birds, in both infected and uninfected birds, as well as in infected NC birds (Table 11). Infected birds had higher expression (P < 0.05) of Eef-2, F-box proteins 9 (FBX09), mechanistic target of rapamycin (MTOR), and myogenic regulatory factor 5 (MYF5). Birds fed the PC and NCBCAA diets had upward expression (P < 0.05) of 4EBP1, myostatin 1 (MSTN1), and MTOR compared to birds in the NC or NCArg treatments.

Table 11.

Effects of low crude protein diets supplemented with arginine or branched-chain amino acids on protein synthesis and degradation genes in broiler chickens infected with Eimeria spp at the end of the recovery phase (14 dpi).

Items		Treatments	Protein synthesis genes					Degradation genes
Diet × Infection			4EBP1	Eef-2	MTOR	IGF-1	S6K1	FBX09	MYF5	MYF6	MYOG	MSTN-1
	Uninfected	PC	1.00c	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00
		NC	1.26b	1.26	0.76	1.11	0.92	1.21	1.15	0.91	1.21	1.03
		NCArg	0.95d	1.40	0.85	0.98	0.92	0.96	0.96	0.91	1.03	0.94
		NCBCAA	1.20b	1.62	1.19	1.17	0.99	1.38	0.99	1.02	0.98	1.12
	Infected	PC	1.47a	1.69	1.82	1.44	1.04	1.41	1.38	1.23	1.13	1.44
		NC	0.95d	1.55	1.26	1.24	0.94	1.67	1.46	0.95	0.77	0.87
		NCArg	0.92d	1.88	1.43	1.06	1.12	1.43	1.14	0.91	0.92	0.82
		NCBCAA	1.09c	1.69	1.58	0.94	1.05	1.27	1.25	1.21	0.94	1.16
Infection
	Uninfected		1.10	1.32	0.95	1.07	0.96	1.14	1.02	0.96	1.05	1.02
	Infected		1.11	1.70	1.52	1.17	1.04	1.44	1.30	1.07	0.94	1.07
Diet
		PC	1.23a	1.35	1.40a	1.22	1.02	1.20	1.19	1.11	1.06	1.22a
		NC	1.10ab	1.40	1.01b	1.17	0.93	1.44	1.30	0.93	0.99	0.95ab
		NCArg	0.93b	1.64	1.13b	1.02	1.02	1.20	1.05	0.91	0.97	0.88b
		NCBCAA	1.15ab	1.65	1.38a	0.96	1.02	1.32	1.12	1.12	0.96	1.14a
Source			Pooled SEM
Diet			0.15	0.18	0.16	0.14	0.05	0.12	0.12	0.09	0.07	0.17
Infection			0.01	0.26	0.30	0.06	0.05	0.14	0.14	0.08	0.06	0.04
Diet × infection			0.10	0.15	0.17	0.08	0.11	0.18	0.15	0.18	0.16	0.10
Source			Probabilities
Diet			0.049	0.840	0.009	0.529	0.617	0.247	0.415	0.346	0.978	0.023
Infection			0.945	0.020	0.001	0.198	0.274	0.010	0.021	0.385	0.436	0.612
Diet × infection			0.004	0.582	0.518	0.062	0.801	0.230	0.945	0.909	0.583	0.114

^abcMeans within a group in the same column but with different superscripts are significantly different (P ≤ 0.05); n is 8 replicate pens with 20 birds per replicate. MSTN, myostatin; MYF5, myogenic regulatory factor 5; MYOG, myogenin; MYF6, myogenic regulatory factor 6; FBX09, F-box proteins 9; mTOR, mechanistic target of rapamycin; S6K1, S6 kinase 1; 4EBP1, 4E-binding protein-1; eEF2, eukaryotic elongation factor 2; IGF-1, insulin-like growth factor-1.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

dpi, days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

Compensatory growth phase (d35 or 21 dpi). There was no significant diet × Eimeria interaction on protein synthesis and degradation genes during this phase (Table 12). Eimeria-infected birds had downward expression (P < 0.05) of both protein synthesis and degradation genes. The additional supplementation of Arg or BCAA had no effect on the protein synthesis and degradation genes analyzed in the samples collected on d35.

Table 12.

Effects of low-protein diets supplemented with arginine or branched-chain amino acids on protein synthesis and degradation genes in broiler chickens infected with Eimeria spp at the end of the compensatory phase (14 dpi).

Items		Treatments	Protein synthesis genes					Degradation genes
Diet × infection			4EBP1	Eef2	MTOR	IGF1	S6K1	FBX09	MYF5	MYF6	MYOG	MSTN1
	Uninfected	PC	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00
		NC	1.02	1.17	1.27	1.05	1.24	1.20	1.18	1.18	1.40	1.18
		NCArg	0.94	1.12	0.92	0.81	0.70	0.91	0.99	1.03	1.30	1.03
		NCBCAA	1.03	0.91	1.06	1.11	0.94	0.89	1.05	0.99	1.20	1.09
	Infected	PC	0.89	0.79	1.14	0.79	1.21	1.01	0.91	0.86	1.19	0.74
		NC	1.00	0.85	1.17	0.75	0.87	1.04	0.70	0.89	1.02	0.91
		NCArg	0.65	1.04	1.09	0.69	0.80	0.96	0.74	1.15	1.00	0.78
		NCBCAA	0.60	0.72	0.96	0.51	0.82	0.81	0.64	0.74	0.75	0.70
Infection
	Uninfected		1.00	1.05	1.06	0.99	0.97	1.00	1.06	1.05	1.22	1.08
	Infected		0.78	0.85	1.09	0.68	0.93	0.95	0.75	0.91	0.99	0.78
Diet
		PC	0.95	0.90	1.07	0.90	1.10	1.00	0.95	0.93	1.09	0.87
		NC	1.01	1.01	1.22	0.90	1.06	1.12	0.94	1.03	1.21	1.04
		NCArg	0.80	1.08	1.00	0.75	0.75	0.93	0.85	1.09	1.15	0.91
		NCBCAA	0.81	0.81	1.01	0.81	0.88	0.85	0.84	0.85	0.97	0.90
Source			Pooled SEM
Diet			0.14	0.13	0.11	0.09	0.14	0.15	0.07	0.14	0.08	0.10
Infection			0.18	0.12	0.02	0.20	0.03	0.03	0.20	0.09	0.17	0.22
Diet × infection			0.09	0.15	0.22	0.18	0.19	0.14	0.25	0.19	0.20	0.20
Source			Probabilities
Diet			0.398	0.061	0.093	0.582	0.143	0.187	0.957	0.110	0.369	0.408
Infection			0.015	0.019	0.661	0.001	0.605	0.502	0.001	0.102	0.025	0.005
Diet × infection			0.344	0.802	0.299	0.216	0.093	0.736	0.347	0.307	0.126	0.959

n is 8 replicate pens with 20 birds per replicate. MSTN, myostatin; MYF5, myogenic regulatory factor 5; MYOG, myogenin; MYF6, myogenic regulatory factor 6; FBX09, F-box proteins 9; mTOR, mechanistic target of rapamycin; S6K1, S6 kinase 1; 4EBP1, 4E-binding protein-1; eEF2, eukaryotic elongation factor 2; IGF-1, insulin-like growth factor-1.

PC, positive control with 18.5% crude protein content; NC, negative control with 16.5% crude protein content; NCArg, negative control supplemented with Arg at 50% above requirement; NCBCAA, negative control supplemented with branched-chain amino acids (BCAA) at 50% above requirement.

dpi, days post-innoculation. The birds in the infection group were inoculated with mixed Eimeria oocysts on d 14 of age.

DISCUSSION

This experiment aimed to study the effects of supplemental functional AA (Arg or BCAA) supplemented above the breeder-recommended levels in diets for broilers receiving marginally low-protein diets and infected with mixed Eimeria spp. The companion article (Liu et al., 2023) presents data on the immune response of the broiler chickens used in the current study. Understanding the interplay between diet composition and regulation of feed intake in animals infected with pathogens provides a suitable approach to tackling the negative effect of coccidiosis (Kyriazakis, 2010). We hypothesized that supplementing 50% additional Arg and BCAA above the recommended level in low-protein diets could partially help alleviate the negative effect of coccidiosis infection. This is because the functional role of Arg and BCAA in improving performance and nutrient utilization could attenuate the effect of, and enhance recovery from, an Eimeria infection. In addition, reducing the amount of protein reaching the hindgut can be beneficial because it translates to fewer substrates for putrefactive bacteria to proliferate in the gastrointestinal tract, which could generate harmful substances, such as amines or phenols, that may impair growth (Qaisrani et al., 2015; Kaldhusdal et al., 2016). We separated the phases of infection to dissect the effects of diet composition on feed intake and overcome possible discrepancies arising from grouping together the effects of infection on feed intake over variable periods of time (Lehman et al., 2009; Cloft et al., 2019a; Hilliar et al., 2020; Teng et al., 2021).

Growth Performance Response in Prepatent, Acute, Recovery, and Compensatory Growth Phases

In the prepatent phase, the additional supplementation of Arg may contribute to the improved weight gain observed, unlike the NC-fed birds, which did not receive additional AA supplementation, thereby impacting their growth. Infection with mixed Eimeria had significant effects on growth during the acute phase (4–7 dpi). In this phase, both feed intake and weight gain were reduced in infected birds, similar to the findings of Castro et al. (2020). This reduction in growth performance is linked to damage to the gastrointestinal mucosa of the duodenum and jejunum and impaired intestinal nutrient digestion and absorption. These effects are common during the intestinal lifecycle of the parasite in the enterocytes (Adams et al., 1996; Persia et al., 2006; Amerah and Ravindran, 2015; Rochell et al., 2016) at 7 dpi. Additional supplementation of Arg above the requirement in the low-protein diets resulted in higher BWG and a lower FCR during the acute phase of infection when compared to birds on other low-protein diets (NC and BCAA). The improvement in growth can be attributed to the role of Arg as a secretagogue for insulin, growth hormone, and insulin-like growth factor-1. These factors stimulate protein synthesis, reduce protein degradation, and increase overall muscle deposition and growth (Houston and O’Neill, 1991; Bolea et al., 1997; Tomas et al., 1998; Conlon and Kita, 2002; Collier et al., 2005).

The lack of a significant diet effect on growth performance during the recovery phase suggests that none of the diets produced a more robust growth-enhancing effect than the others during this period. During this phase, the infected groups still lagged behind in weight gain of their uninfected counterparts, although with a much narrower difference compared with during the acute phase of infection. The difference in weight gain was smaller between the 2 groups during the recovery phase than the acute phase due to an improvement in feed intake in the infected birds during the recovery phase.

However, during the compensatory growth phase, birds in the infected group exhibited lower weight gain and feed intake, and the latter may have stymied the extent of growth compensation during this phase. It should be noted that all the birds received only one diet during the compensatory growth phase; hence, any treatment effect resulted from the diets they received in the preceding 21d. The ability of infected birds to exhibit compensatory growth may be influenced by factors such as the post-recovery environment and food composition (Kyriazakis & Emmans, 1992; Kyriazakis & Houdijk, 2007). It is important to note that not all dietary interventions had the same impact. For example, lower feed intake during the compensatory growth phase was observed in birds previously fed the BCAA diet, suggesting that the composition of the diet can influence compensatory growth differently. Eimeria infection affects weight gain and feed intake differently at different infection phases, ultimately influencing compensatory growth. Factors such as diet composition and environmental conditions play a role in these growth patterns. Supplementing diets with additional Arg showed promising potential in enhancing growth during the acute phase, irrespective of whether the birds were infected or not.

Amino Acid Digestibility at the End of the Acute and Recovery Phases From Mixed Eimeria Challenge

At the end of the acute phase (7 dpi), the infected group had reduced digestibility when compared to the uninfected groups. The impact of Eimeria infections on AA digestibility may vary, depending on factors such as the severity of the infection, the specific Eimeria species involved, and the age of the birds (Chapman et al., 2005). The mixed Eimeria species used in this study could be attributed to the decline in AID observed. Additional supplementation of AA in low-protein diets did not significantly affect the digestibility of the 3 most limiting AA in broiler diets (Met, Lys, and Thr) and Gly in the current experiment during the acute phase. This is likely because the supplementation of free AA, which is more readily absorbed than those in intact proteins, plays a significant role in the digestibility of those AAs, indicating they are in adequate supply in the diets. In contrast, there was a dietary effect on some dispensable AA during the acute phase. A reduction in AID Ala, Asp, Cys, Glu, Pro, Ser, and Tyr was observed with low-protein diets, irrespective of supplemental AA. The observation could be attributed to birds preferentially enhancing absorption of those AAs especially needed to cope with the disease more robustly. Studies have shown that low-protein diets can affect the digestibility of some dispensable AA in chickens. For example, Li et al. (2019) found that as dietary protein levels decreased, the digestibility of Glu (essential for various physiological functions) was significantly reduced. However, in the current study, the standardized digestible AA level was maintained in all the diets, irrespective of the protein content (Kim et al., 2022). It is possible that the depressed growth performance observed is at least partly related to the reduced AA digestibility.

During the recovery phase, the previously infected birds had decreased digestibility of the sulfur AA only. Cys can be synthesized irreversibly from the Met and plays a crucial role in the synthesis of the antioxidant glutathione, which is involved in electron transfer reactions (Piste, 2013). Additionally, dietary supplementation of Cys has been shown to reduce plasma homocysteine concentrations (Xie et al., 2004). Cysteine is an integral component of proteins and significantly regulates the body's homeostasis and performance (Brosnan and Brosnan, 2006; Bunchasak, 2009). The significant role of Cys sheds light on the underlying mechanisms and the potential impact of nutrition on a bird's ability to cope with pathogens (resilience) and maintain performance during infection (tolerance). This is achieved by reducing stress and redirecting resources towards tissue repair and recovery.

The reduction in Cys digestibility observed in previously infected birds could be attributed to the birds trying to maintain homeostasis so as to get back to their “baseline” physiological state. In addition, a reduction in Gly digestibility was observed among the diets, especially in the low-protein diets, irrespective of AA supplementation during the recovery phase. It is well-established that increased Gly supplementation is required when feeding broilers with low-protein diets. This is primarily due to the role of Gly supplementation in reducing the degradation of Thr to Gly by decreasing the activity of threonine aldolase and threonine dehydrogenase in the livers of birds (Bernardino et al., 2011). Therefore, the decrease in Gly levels may be attributed to birds channeling the available Thr in their diets to enhance mucin production, thereby maintaining intestinal integrity and promoting a swift recovery during and after the Eimeria infection (Teng et al., 2021).

Jejunal mRNA Expression of Peptide and Amino Acid Transporter Effects

During the acute phase, the infected birds had a decrease in the expression of B0+AT but upward expression of the PepT1 gene. The transporter B0+AT is responsible for exchanging extracellular cationic AA and Cys with intracellular neutral AA, serving for the net inward movement of the former. This transporter exhibits a high-affinity transport mechanism for L-Cys and cationic AA and a lower affinity for neutral AA (Fotiadis et al., 2013). The decreased expression of B0+AT at the acute phase in this study suggests a reduced absorption of cationic AA like Arg and Lys as a consequence of E. maxima infection. Because of their roles in immune response, the limited availability of cationic AA may compromise the immune response and the growth performance of chickens (Paris & Wong, 2013; Castro et al., 2020). In addition, a reduction in B0+AT expression during the acute phase has been observed to promote the apoptosis of enterocytes, hastening cell turnover (Su et al., 2015).

PepT1 is the main transporter of di- and tripeptides derived from the hydrolysis of dietary proteins, directly impacting overall poultry growth and performance (Fei et al., 2006). The upward expression of PepT1 at the end of the acute phase is likely associated with the birds transitioning to the recovery period and may reflect a heightened demand for AA to enhance recovery. On the other hand, the Eimeria infection can significantly affect the expression and functionality of PepT1, especially during the acute phase characterized by the damaged intestinal mucosa. This modulation in PepT1 expression could be a response to the inflammatory environment induced by the parasite and may impact nutrient uptake. The alterations in PepT1 expression and functionality induced by Eimeria infection can have significant implications for nutrient absorption in the host. Reduced PepT1 activity may lead to impaired uptake of peptides, resulting in decreased availability of AA and other nutrients required for growth, immune function, and overall health. This downward PepT1 expression could impair the absorption of dipeptides and tripeptides, potentially resulting in reduced AA availability for the birds (Teng et al., 2020). Regarding other AA transporters such as EAAT, boAT, and CAT1, the infection or dietary treatments did not significantly impact their expression. EAAT, known for its specificity towards the absorption of acidic AA (Glu and Asp), is located at the brush border membrane of enterocytes (Kanai et al., 2013; Teng et al., 2021).

However, it is worth noting that there were no discernible effects of the diets or infection on the AA transporters analyzed at the end of the recovery phase (d28). This observation may be attributed to the use of supplemental AA, which inherently has greater availability, thus allowing for simple diffusion or paracellular movements to support nutrient absorption. On the other hand, specific AA can exert influence over the expression and functionality of PepT1. For example, Arg supplementation may enhance PepT1 expression during the recovery phase, potentially contributing to improved absorption of dipeptides and tripeptides (Teng et al., 2020). The resurgence in PepT1 aligns with the damaged intestinal mucosa's healing process but may depend on the severity of the Eimeria infection (Teng et al., 2020). The recovery of PepT1 expression is important in reestablishing optimal nutrient absorption, as also evidenced in AA digestibility. Notably, the digestibility of the indispensable AA was not affected during the recovery phase, reflecting a more efficient use of feed contributing to the recovery of the birds.

mRNA Expression of Protein Synthesis and Degradation Genes of the Pectoralis Major

The mRNA levels of genes involved in both protein synthesis and degradation were assessed in the pectoralis major at the end of the acute, recovery, and compensatory growth phases. Given that protein accretion hinges on the equilibrium of protein synthesis and degradation and that AA plays a pivotal role in mediating these processes, our aim was to explore how supplemental functional AA influences these processes.

Acute phase.Gharib-Naseri et al. (2019) showed that Eimeria spp. infection substantially reduces muscle protein synthesis rates during acute coccidiosis infection. This study indicated that coccidiosis might disrupt muscle protein synthesis, primarily due to the inflammation and oxidative stress provoked by the parasite or a reduction in intake of AA. Furthermore, coccidiosis can indirectly affect protein synthesis by impairing nutrient absorption in the intestine. The harm inflicted on the intestinal epithelium by Eimeria species results in diminished nutrient utilization, including essential AA necessary for protein synthesis.

These nutrient deficiencies can hinder muscle protein synthesis in infected birds, which is shown by the lower expression of S6K1 in the pectoralis major of the infected birds during the acute phase. S6K1 is pivotal for translation initiation, phosphorylated by mTOR, and promotes protein synthesis (Lynch et al., 2002). The mixed Eimeria infection likely inhibited S6K1 expression through the mTOR pathway, consistent with findings by Everaert et al. (2010), producing lower weight gain in the infected birds.

Additionally, there is an interaction effect involving the MYOG gene, a critical player in protein degradation and muscle homeostasis. MYOG regulates myocyte fusion, determining the number and size of muscle fibers (Ganassi et al., 2018). In our study, MYOG was upwardly expressed in birds infected with Eimeria and fed the NC and BCAA diets but not those fed Arg diets (infected and uninfected). This observation is likely linked to the lower weight gain observed in the NC and BCAA groups compared to the Arg group. The functional role of Arg in mitigating stress in broilers by enhancing antioxidant systems has been reported previously (Atakisi et al., 2009; Duan et al., 2015).

Recovery phase. The increased expression of MTOR and Eef mRNA during the recovery phase in previously infected birds implies that these birds were allocating nutrient resources toward protein accretion. The birds fed the Arg diet had lower mRNA expression of 4EBP1, MSTNI, and MTOR when compared to their NC counterparts. This may be attributed to the potential of Arg to mitigate the impact of Eimeria in broiler chickens, thus potentially producing its effects during the recovery phase.

Furthermore, the diet × Eimeria infection was observed for the 4EBP1 gene, signifying those birds in the NC and BCAA groups downwardly expressed the protein synthesis gene. This observation also aligns with the growth performance data results, particularly regarding weight gain during the recovery phase in which the NC and BCAA groups had reduced weight gain in the infected birds compared to the Arg group.

Environmental stressors, such as Eimeria infection, can instigate heightened muscle proteolysis (Milan et al., 2015), often accompanying muscle disorders characterized by severe proteolytic processes (Baldi et al., 2018). The F-box protein family assumes a critical role in ubiquitin-mediated protein degradation (Milan et al., 2015), and the protein FBXO9 is a commonly recognized marker for accelerated proteolysis and atrophy processes (Cohen et al., 2015). During the recovery phase, infected birds had increased expression of ubiquitin degradation genes, including FBXO9. The ubiquitin-proteasome system influences drip loss by regulating myofibril degradation (Milan et al., 2015), and the increased expression of the ubiquitination gene UBE3B can intensify damage to sarcoplasmic and myofibrillar proteins (Huynh et al., 2013).

In the infected birds, the higher expression of MYF5, a transcriptional activator that prompts fibroblast differentiation into myoblasts (Yamamoto et al., 2018), suggests that birds previously infected with Eimeria during the recovery phase may hinder muscle development by suppressing the expression of myogenic genes. MSTN, a negative regulator of muscle growth and development, with it signaling inhibition leading to increased muscle mass (Shin et al., 2015), had lower levels in birds fed the Arg diet, possibly contributing to increased protein synthesis.

Compensatory Growth Phase. In the compensatory growth phase, birds in the infected group had decreased expression of protein synthesis genes, including 4EBP1, Eef-2, and IGF-1. Decreased IGF-1 gene expression is reported during feed deprivation (Kita et al., 2005), which is usually accompanied by reduced weight. The reduced weight gain in the infected birds in this study may be linked to the reduced expression of IGF-1 in the pectoralis major, providing an explanation for the persistent negative carryover effect of previous infection during the compensatory phase.

Conversely, MSTN1, MYF5, and MYOG were downwardly expressed in the infected group during this phase. MYOG is a crucial factor for maintaining muscle homeostasis and regulates myocyte fusion by influencing the number and size of muscle fibers (Ganassi et al., 2018). Additionally, the reduced expression of MYOG in the infected group suggests that the rate of degradation may be slower than that of synthesis during this phase, promoting accelerated muscle development. This observation is further supported by the growth performance and digestibility data in the current experiment, wherein the body weight on d35 was comparable to that of the low-protein counterparts. Improved feed intake and consistent digestibility results indicate ongoing recovery among the previously infected birds.

CONCLUSIONS

Under the conditions of this study, supplemental Arg or BCAA in the low crude protein diet partly reversed the depressed weight gain in the Eimeria-challenged birds especially during the acute and recovery phases. Because the supplemental AA were only used during the infection and recovery phases, their effect during the compensatory growth phase could not be ascertained and was possibly masked by supplying all the birds the same diet during this phase. Given the complexity of multiple layers of factors that bear on the response of broiler chickens to supplemental AA in low crude protein diets, further research that examine the optimum level and combination of supplemental AA in such diets under Eimeria-challenged scenarios are relevant. The current experiment utilized a 7-d compensatory growth phase during which all the birds received one diet with recommended CP and AA levels. A longer compensatory growth phase with similar diets as used in the current experiment, or with low-crude protein diets with supplemental AA may further aid in understanding the impact of functional AA in low crude protein diets.