Role of xenobiotic metabolism in cancer: involvement of transcriptional and miRNA regulation of P450s

Abstract

Cytochrome P450 enzymes (P450s) are important targets in cancer, due to their role in xenobiotic metabolism. Since P450s are the “bridges” between the environment and our body, their function can be linked in many ways to carcinogenesis: they activate dietary and environmental components to ultimate carcinogens (i), the cancer tissue maintains its drug resistance with altered expression of P450s (ii), P450s metabolize (sometimes activate) drugs used for cancer treatment (iii) and they are potential targets for anticancer therapy (iiii). These highly polymorphic enzymes are regulated at multiple molecular levels. Regulation is as important as genetic difference in the existing individual variability in P450 activity. In this review, examples of the transcriptional (DNA methylation, histone modification, modulation by xenosensors) and post-transcriptional (miRNA) regulation will be presented and thereby introduce potential molecular targets at which the metabolism of anticancer drugs, the elimination of cancerogenes or the progress of carcinogenesis could be affected.

Introduction

The human body is exposed to a wide range of external chemicals; both purposely (e.g., medicines) and accidentally (e.g., environmental contaminants) and these foreign molecules (xenobiotics) are metabolized by enzymes called cytochrome P450s (P450). P450s are heme-thiolate enzymes that participate in the biotransformation of xenobiotics and production of many important endogenous compounds including steroid hormones, prostaglandins, and leukotrienes [1, 2]. Their expression is believed to be highly regulated; some P450s are expressed only in specific tissues and at times in specific cells within the tissue. Similarly, the expression pattern of a number of P450s is different at each developmental stage and different in females and males. Paradoxically, these enzymes catalyze the formation of reactive intermediates of thousands of chemicals that can damage DNA, as well as lipids and proteins. P450 expression can also affect the production of proliferation-promoting molecules derived from arachidonic acid, and alters various downstream signal-transduction pathways. Reactive intermediates, activated carcinogens, and arachidonic acid derivatives can be precursors to malignancy and cause chemical cancer [3]. In a developed cancer, these enzymes can determine the outcome of anticancer therapy and altered expression of P450s can support cancer progression and cause drug resistance [4, 5].

Since P450s are the “bridges” between the environment and our body, their function can be linked in many ways to carcinogenesis: they activate xenobiotics to ultimate carcinogens but at the same time they metabolize (and in some cases activate) drugs used for cancer treatment (Table 1). In some tumors, the cancer tissue maintains its drug resistance with altered expression of P450s and this explains why they are potential targets for anticancer therapy. Mostly, dose P450s could be linked to chemical cancer, which are involved in xenobiotic metabolism (CYP1-4 family), and their regulation is discussed in the following sections.

Table 1.

Role of xenobiotic metabolism in cancer

Result of xenobiotic metabolism by P450s	Changes in P450 activity
	Promotes carcinogenesis	Promotes anticancer effect
Carcinogen deactivation	No	Yes
Precarcinogen activation	Yes	No
Anticancer drug deactivation	Yes	No
Anticancer prodrug activation	No	Yes

Until the last decade, it was thought that genetic polymorphism of cancer-related genes is responsible for tumor development. New findings of epigenetics and signal transduction suggest that during carcinogenesis, these factors (e.g., chromatin conformation, regulatory mechanisms) are as important as the genetic background.

There are many published reviews discussing the epigenetics of P450s and their role in cancer [3, 6, 7] and there are many introducing the function of nuclear receptors in this disease [8–10].

In the present manuscript, both regulation types—transcriptional and miRNA regulation mechanisms—were described from an aspect of xenobiotic metabolizing P450s and their role in cancer. In the past it was thought that mainly genetic polymorphisms were due to the variation of P450 activities and some genotypes increase the risk of cancer. With this review we would like to highlight the importance of regulatory mechanisms in cancer, which harmonize the genetically determined P450 activity with the environmental effects and could be beneficially altered by anticancer drugs in the future.

Molecular aspects of p450 regulation

Transcriptional regulation

Cancer is a complex disease where genetics, lifestyle, and environment play important roles in dictating susceptibility to the disease. Environmental factors are transmitted to the cell by different regulatory mechanisms. Although the major regulation of P450s through xenosensors, nuclear receptors have been well studied. We provide an overview of new results in the field related to regulation by DNA methylation and histone modulation, since they are topics of considerable current interest, which may describe the large variation in expression seen for several important P450s in cancer.

DNA methylation

In mammals, the majority of CpG pairs are chemically modified by the covalent attachment of a methyl group to the C₅ position of the cytosine ring. DNA methylation occurs predominantly at CpG sites in the mammalian genome [11] by the DNA methyltransferase (DNMT) enzymes [12]. Methylation of DNA is regarded as a means of regulating gene expression through two general mechanisms. First, DNA methylation of gene promoters may prevent the physical binding of some transcription factors to their DNA-binding sites [13]. Second, the transcriptional silencing capability of DNA methylation may occur via indirect mechanisms involving changes in chromatin conformation. There is extensive evidence to support a functional role for promoter-CGI methylation in transcriptional repression [14–16]. DNA methylation of CpG-rich promoters of some genes correlates with tissue-specific gene silencing [17, 18]. Tumors are often characterized by an imbalance in cytosine methylation having both hypomethylation and hypermethylation of various regions of the genome. To date, several studies show altered DNA methylation of P450s in cancer, mostly of those P450s, which are involved in the metabolism of endogenous compounds [6]. Examples of such regulation are shown in the following section.

CYP1A1

Both hypermethylation (less active CYP1A1, altered metabolism of carcinogens) and hypomethylation (more active enzyme, higher activation of precarcinogens) of CYP1A1 promotes carcinogenesis.

In prostate cells, CpG islands in CYP1A1 show segmented/selective methylation patterns; CpG sites from 1 to 36 are not methylated; this DNA region contains the CYP1A1 promoter and is responsible for correct initiation of gene transcription, CpG sites 37 to 90, which corresponds to the CYP1A1 enhancer region that mediates TCDD inducibility, exhibits cancer cell-dependent hypermethylation, and CpG sites 91 to 125 are commonly methylated, but no known regulatory function has been associated with this DNA region, possibly due to its positive methylation status [19]. In noncancerous prostate tissue, CYP1A1 enhancer methylation could not be detected, but in prostate tumors, 36% (11 of 30) of the DNA samples was methylated (Table 2).

Table 2.

CpG islands found in various P450 enzymes and their role of cancer

	CPG islands
P450	Region	Methylation status	Consequences in activity	Tissue/cell line	References
CYP1A1	Enhancer/promoter	Hypermethylated	↓	Prostate cancer	[19]
	Enhancer/promoter	Hypomethylated	↑	Lung of smokers	[20]
CYP1B1	Enhancer/promoter	Hypomethylated	↑	Prostate cancer	[25]
	Enhancer/promoter	Hypermethylated	↓	Colorectal cancer	[26]
CYP2E1	Region not described	Hypomethylated	↓	Lung tumor	[31]
CYP2W1	I. exon/I. intron	Hypermethylated	↓	Colon cancer	[35–37]
CYP3A4	Enhancer/promoter	Hypomethylated	↑	HepG2	[38]

Environmental factors such as tobacco smoke have been shown to influence the DNA methylation of CYP1A1. Smokers' DNA was hypomethylated compared to non-smokers on the upstream regions, containing functional XREs. In addition, there was an inverse correlation between methylation and the number of cigarettes smoked daily. Cessation of smoking results in the methylation of CYP1A1 promoter being increased at 1–7 days after the last cigarette [20]. Although there was no correlation between EROD activity and the percentage of methylated DNA in a sample in either smokers or nonsmokers, a decrease in methylation caused significant higher CYP1A1 activity. A high inducibility of CYP1A1 has been connected with increased susceptibility to smoking-associated lung cancer [21, 22].

CYP1B1

CYP1B1 is overexpressed in a variety of human tumor cells such as the lung, breast, liver, gastrointestinal tract, and ovarian cancer [23, 24]. CYP2B1 may be an important tumor marker because it hydroxylates estrogens and activates many procarcinogens. CYP1B1 enzyme could be methylated both on the promoter and on the enhancer of the gene. The promoter region contains the CpG sites of the core promoter region including SP1-binding sites and the enhancer region including AHR/ARNT-binding sites DRE2 and DRE3. Aberrant methylation in the CYP1B1 gene affects binding of transcription factors and enhancer molecules. In cancer, the methylation of this region is differently altered, depending on the type and original tissue of the tumor. Tokizane et al. [25] showed that increased CYP1B1 expression in clinical prostate cancer tissues is caused by hypomethylation both of the promoter and enhancer regions of the CYP1B1 gene.

The same methylation pattern as in prostate cancer was observed in other cancers, for example, colorectal cancer. Here, inhibited activity of CYP1B1 was observed due to complete hypermethylation of the promoter region [26]. Because expression of CYP1B1 is regulated by the methylation of its promoter/enhancer, this region may be a useful target for anticancer drugs and in preventive medicine (Table 2).

CYP2E1

Methylation of the CYP2E1 gene inhibits the expression of this enzyme in prenatal period [27]. In adult tissues, the methylation pattern of the CYP2E1 gene differs among various tissue types such as lung, kidney, placenta, liver, and skin, indicating that DNA methylation results in tissue-specific regulation [28, 29]. CYP2E1 metabolizes ethanol to its carcinogenic metabolite acetaldehyde and it is involved in the bioactivation of other small-molecule precarcinogens [30]. In lung tumors, lower methylation was observed and hypomethylation has been associated with underexpression of the CYP2E1 gene [31].

CYP2W1

This enzyme has been shown to metabolize arachidonic acid and benzphetamine, as well as being able to metabolically activate several procarcinogens, including polycyclic aromatic hydrocarbon dihydrodiols, aflatoxin B1, or sterigmatocystin. CYP2W1 is expressed at relatively low levels (mRNA) in the human adult non-transformed tissues, whereas the expression in colorectal cancer tissues was significantly higher (both at mRNA and protein levels) [32–34]. This suggests that the extent of CYP2W1 expression in colorectal cancers might be a prognostic marker for malignancy and survival (Edler et al. 2009). CYP2W1 gene expression appears to be governed by gene methylation. The CYP2W1 gene was shown to contain one functional CpG island in the exon 1-intron 1 region, which was methylated in cell lines lacking CYP2W1 expression, but unmethylated in cells expressing CYP2W1 [35–37].

CYP3A

A different DNA methylation pattern was found between primary hepatocytes and hepatocyte cell lines. HepG2 cells exhibit many cellular features of normal human hepatocytes, but also display characteristics resembling those of a cancerous or fetal hepatocyte. CYP3A expression in untreated HepG2 cells is fairly low, suggesting that their expression is reduced in these partially dedifferentiated cells. Dannenberg and coworkers were interested in determining whether CYP3A genes are regulated by DNA methylation in HepG2 cells. Their microarray experiments showed that after 5-aza-dC treatment (5-aza-2′-deoxycytidine, methylation inhibitor), expression of CYP3A4, CYP3A5, and CYP3A7 was two- to fourfold higher, suggesting a regulatory role of methylation with these P450s. The mentioned increase in expression was confirmed by real-time RT–PCR only for CYP3A7 [38]. Since the CYP3A enzyme catalyzes the transformation of many drugs, understanding its regulation would open new possibilities in cancer therapy.

Histone modification

Post-translational modifications such as phosphorylation, acetylation, methylation, and ubiquitination on the N-termini of histones have been shown to play critical roles in gene regulation [39]. It is believed that the combination of modifications of the chromatin-associated histone and non-histone proteins and the interplay between these modifications create a marking system (“histone code”), which is part of the epigenetic mechanism for gene regulation [40]. The modified histones and methylated DNA sequences may interact in a synergistic manner, including methyl-CpG binding protein, nuclear receptor corepressor (NCoR), associated histone deacetylases, and histone methyl transferases, to regulate gene expression [41]. There are already several indicators of an association between histone-modifying enzymes and cancer [42]. Histone modifications are involved in the regulation of the two cancer-related P450s: CYP1A and CYP3A4.

Chromatin structure has been suggested to play an essential role in CYP1A1 transcription. In the basal state, HDAC1 is bound to the CYP1A1 promoter and is released in concert with the recruitment of p300 upon B[a]P ligand activation of the receptor. HDAC1 removal allows for several histone-modification steps associated with the AHR-mediated induction of CYP1A1 expression. Removal of HDAC1 is necessary, but it is not sufficient to activate CYP1A1 expression [43]. CYP3A4 transcription is also regulated by a histone methyltransferase enzyme called protein arginine methyltransferase 1 (PRMT1). PRMT1 is required for the transcriptional activity of PXR. It is recruited to the 5′-region of the CYP3A4 gene to methylate histone H4 as a response to the PXR agonist rifampicin [44]. CYP3A4 is also regulated with PXR and is regulated by CAR albeit it at a lower rate of expression. Assenat and coworkers reported that the synthetic glucocorticoid, dexamethasone, induces histone H4 acetylation at the proximal CAR promoter region, and indirectly affects CYP3A4 induction by regulating CAR expression [45]. Interestingly, experiments for H4 acetylation on PXR promoter were not performed.

Regulation with xenosensors

A specific group of transcription factors and receptors that are specialized to regulate genomic processes to protect the body against the innumerable chemicals found in the environment are called xenobiotic-activated receptors (XARs) or xenosensors. XARs regulate xenobiotic metabolism and disposition by controlling the expression and induction of drug-metabolizing enzymes and transporters. As the primary means of xenobiotic sensing and defense, XARs are intimately involved in drug disposition, polymorphic drug clearance, drug–drug interaction, and pathogenesis of some chemically induced diseases such as cancer. Furthermore, XARs integrate a broad range of protective mechanisms (such as antioxidative response and immune/inflammatory functions) to antagonize foreign chemicals [46]. Regulation of P450 expression has a high impact on both carcinogenesis (activation of precarcinogens, slow metabolism of toxic compounds) and on cancer therapy by anticancer drugs (narrows therapeutic index, a steep dose-toxicity curve).

The expression of P450s is primary regulated by two nuclear hormone receptor type xenosensors [8, 47–49], the constitutive androstane receptor (CAR), the pregnane X receptor (PXR), and two other type of xenosensors, namely the aryl hydrocarbon receptor (AHR) and nuclear factor (erythroid-derived 2)-like 2 (NRF2).

The prototype transcriptional circuit of an XARs for P450 induction is as follows: XARs are inactivated with associated proteins in the cytoplasm; binding with an agonist activates XARs; activated XAR translocates into the nucleus and heterodimerizes with a partner protein; and the XAR dimer binds to specific DNA sequences located in the enhancers of a battery of foreign-compound metabolizing genes. These receptors can alter the action of other nuclear receptors or transcription factors, thereby controlling the signaling pathways that regulate the homeostasis of bile acids, lipids, glucose, inflammation, vitamins, hormones, and others (Table 3).

Table 3.

Regulation of human P450s by XAR crosstalks

P450	Crosstalk	Consequences	References	Mechanisms
CYP1A	AHR and GR	↓	[113, 114]	Direct interaction of AHR and activated GR
	AHR and ER	↑	[118–120, 122]	ER coactivates AHR, ER interacts with AHR/ARNT complex
	AHR and HIF1	↓	[123, 124]	Sharing ARNT partner
	AHR and NRF2	↑	[138, 139]	Transactivating the same responsive element
CYP2B6	CAR and GR	↑	[101]	Direct interaction of CAR and GR, glucocorticoid responsive element (GRE) in CAR distal region
	CAR and FOXO	↑	[98, 99]	FOXO binds directly with CAR
	CAR and PXR	↑	[65–68, 70]	Transactivating the same responsive element
	PXR and VDR	↑	[72–74]	Transactivating the same responsive element
CYP2C9	CAR and HNF-4α	↑	[79]	Synergizing the effect of CAR
	PXR and HNF-4α	↑	[79]	Synergizing the effect of PXR
	PXR and VDR	↑	[72–74]	Transactivating the same responsive element
CYP2J2	NRF2 and c-Jun	↑	[144]	NRF2/c-Jun binds to the same responsive element as c-Jun/c-Jun
CYP2S1	AHR and HIF1	↑	[127]	AHR and HIF1 binds to the same responsive element
CYP3A4	PXR and CAR	↑	[65–68, 70]	Binding to the same responsive element
	PXR and VDR	↑	[72–74]	Transactivating the same responsive element
	PXR and GR	↑	[79]	Cofactor, facilitate the binding of PXR
	PXR and HNF4 α	↓	[79, 80]	Binding the same coactivators

Xenosensors are also able to crosstalk with other signalling pathways. The consequences of crosstalks are that the expression of a given battery of target genes that is expected to be regulated by a given signalling pathway in fact are dependent on the function of other signalling pathways as well. Given the multitude of biological partners with which xenosensors might interact, xenobiotic metabolism and its influence on carcinogenesis appear to be dependent on a very complex network of regulatory pathways. Some of the cancer-related crosstalks are listed in the following section with each xenosensor.

PXR

Pregnane X receptor is one of the most frequent target receptors for xenobiotics and therefore its role in the regulation and control of drug metabolism is important to consider in relationship to drug-drug interactions. PXRs have been shown to be activated by various xenobiotics (e.g., rifampicin, clotrimazole, hyperforin), natural and synthetic steroids (e.g., 5ß-pregnane-3,20-dione, pregnenolone 16α-carbonitrile, dexamethasone, dehydroepiandrosterone), and bile acids (e.g., lithocholic acid and 6-keto lithocholic acid) [50]. After binding with the xenobiotic compound, PXR translocates to the nucleus and heterodimerizes with retinoid X receptor (RXR). The heterodimeric complex can bind to several responsive element types, such as direct repeats (DR-3, DR-4, and DR-5) and everted repeats (ER-6, ER-8) [51–53]. The modulation of basal activity and induction of transcriptional events are mediated by recruitment of coregulators: activators [SRC-1, SRC-2, SRC-3 (steroid receptor coactivator-1, 2 or 3), TUF2 (transcriptional intermediary factor 2), GRIP1 (glucocorticoid receptor interacting protein 1), CREBBP (CREB binding protein), AIB1 (amplified in breast cancer 1], or corepressors [NCoR (nuclear receptor corepressor), SMRT (silencing mediator for retinoid and thyroid receptor)] [54–58]. The signaling pathway is even more complex if the crosstalk mechanisms with other receptors are taken into consideration. Major interactions are summarized in Table 3 and described briefly below.

It has been observed that the expression of PXR in prostate, ovarian, and colon cancer cells can modulate tumor cell metabolism and sensitivity to several cytotoxins. For instance, PXR ligands such as rifampicin and hyperforin (the active constituent of the herbal antidepressant St. John’s Wort) significantly enhance both the hepatic elimination of irinotecan in patients, and the intratumoral glucuronosylation and inactivation of the drug. Cyclophosphamide is widely used to treat a variety of cancers and it is activated mostly by CYP2B6 and CYP3A4 [59]. Treatment of hepatocytes with mentioned PXR inducers markedly increased hydroxylation of cyclophosphamide and its isomer ifosfamide [60]. Tamoxifen is mainly metabolized by CYP3A4, and at the same time, induces this enzyme [61], and with this, accelerates its own clearance as a result of autoinduction [62]. PXR and CYP3A4 is also activated by the microtubule stabilizing agent paclitaxel, but not with its structurally related molecule docetaxel. The mechanism behind the two structurally related drugs is as follows: paclitaxel stimulates the displacement of SMRT cofactor on the PXR/RXR complex while docetaxel does not [63]. In contrast to paclitaxel, cyclophosphamide, or tamoxifen, ecteinascidin (ET)-743 anticancer has been shown to inhibit the transcriptional activation of CYP3A4 by direct antagonizing PXR [64].

PXR and CAR

Because PXR-responsive elements are recognized and transactivated by CAR and vice versa, PXR and CAR can activate the overlapping series of genes. In addition, these receptors compete for a common partner, RXRalpha; for common coactivators, such as SRC-1 and PGC-1alpha and for the same ligands [65–68], but there are differences in the degree to which specific genes are activated by either CAR or PXR agonists, which undoubtedly contribute to the distinct pharmacologies of xenobiotics. Retinoids that are used clinically to treat acute promyelocytic leukemia, skin cancer, Kaposi’s sarcoma, and cutaneous T-cell lymphoma were shown to activate CYP3A4 mainly via CAR and not PXR. These findings suggest that retinoids may have complex and variable effects on xenobiotic responses in these patients [69].

PXR and VDR

VDR mediates the effect of 1α, 25-dihydroxyvitamin D3, retinoids and carotenoids to genes that are involved in mineralization, epidermal development, etc. After binding the ligand, VDR/RXR form a heterodimer and then bind to and transactivate the vitamin D responsive elements (VDREs) that are present in the regulatory region of target genes [70]. Wang’s experiments prove that certain retinoids and carotenoids transactivate the PXR/RXR-mediated pathway and upregulate CYP3A4 gene expression in a human hepatoma cell line [71]. VDR binds and activates other PXR/CAR-target genes such as CYP3A4, CYP2C9, and CYP2B6 [72–74]. Because vitamin D is a common component of food products and it is also produced in the skin, it is possible that its activating influence on P450s may contribute to some of the interindividual variations of these enzymes. Induction of CYP3A4 by VDR ligands could have importance in cancer prevention, since a higher level of CYP3A4 gives better protection in carcinogen deactivation or in cancer therapy, and faster activation of anticancer prodrugs [75].

PXR and GR

Dexamethasone was shown to induce CYP3A4 transcription in primary human hepatocytes [76], suggesting a functional cross talk between PXR and GR (glucocorticoid receptor). The cross talk potentially regulates metabolism of steroid hormone and sterol homeostasis. Induction of CYP2B6 by PXR is also augmented by dexamethasone, suggesting that GR regulates PXR expression. Besides modulating PXR expression, activated GR (but not the receptor alone) acts as a cofactor to facilitate the binding of PXR to CYP2B6 [77]. Based on these findings, active GR can serve as an enhancer in the induction of the CYP2B6 gene and this could be useful in cancer therapy. Ketoconazole and miconazole, which were identified as GR antagonists [78], can block the effect of GR, and treatment with these imidazole derivatives might improve the pharmacokinetic properties of some CYP2B6 dependent, anticancer drugs (for example paclitaxel and tamoxifen).

PXR and HNF-4α

PXR/HNF-4α crosstalk is characterized as an enhancer as well as regulator of constitutive expression of P450s. CYP2C9 has many anticancer substrates (e.g., cyclophosphamide, ifosfamide, or tamoxifen) and it is regulated by both CAR and PXR. Additionally, two proximal HNF-4α-binding sites functionally control the transcriptional activation of CYP2C9. HNF-4α synergizes with PXR or CAR to enhance promoter activity of CYP2C9 and HNF-4α sites are essential for maximal induction of CYP2C9 promoter [79]. Recent studies for CYP3A4 indicate that a distant enhancer module containing a PXR response element (F-ER6) is a recognized binding site for HNF-4α [80]. This element supports constitutive expression of CYP3A4. The applications of drugs that target these interactions with PXR will continue to be a focus of research in cancer prevention in the future.

CAR

In addition to the pregnane X receptor (PXR, NR1I2), the constitutive androstane receptor (CAR, NR1I3) is the other nuclear receptor that plays a role in the transcriptional activation of P450 genes after exposure to anticancer drugs (e.g., tamoxifen, cyclophosphamide, ifosfamide). CAR is constitutively active without ligand, and many xenobiotics (phenobarbital and phenytoin) act primarily by causing its nuclear translocation rather than serving as ligands [81, 82].

Induction of many P450s, like the CYP2B6, CYP2C9, CYP2C8, and CYP2C19 is mediated with the nuclear receptor CAR. Phenobarbital-type CYP2B6 inducers activate LKB1 (serine/threonine kinase 11), which can phosphorylate AMPK in human hepatocytes and LMH cells [83, 84]. Activation of cytosolic CAR by AMPK results in its dissociation from chaperone partners, such as cytoplasmic CAR retention protein (CCRP) and HSP90. Translocation of CAR to the nucleus, presumably dependent on the activity of the protein phosphatase PP2A, is followed by association with the retinoid X receptor (RXR) and binding to the PBREM (phenobarbital responsive enhancer module). Transcriptional activation occurs upon CAR binding to the PBREM, which contains two nuclear receptor DR4 sites (NR1 and NR2). CAR coactivators identified to date that facilitate transactivation include GRIP1/TIF2, peroxisome proliferator-activated receptor-γ coactivator (PGC-1γ), SRC-1, Sp1, activating signal cointegrator 2 (ASC-2) and more recently, structural maintenance of chromosomes 1-like 1 (SMC-1) [85–90]. Modulating CAR activity could be useful to adjust metabolism of some cancer-related drugs.

It was reported that CYP bioactivates anti-cancer prodrug ifosfamide [9] in breast cancers and that the expression of CYPs including CYP2B6 was lower in the tumor tissue than in the adjacent normal tissue [91, 92]. Coadministration of phenytoin (CAR activator) in an anticancer therapy has been reported to decrease the level of the prodrug cyclophosphamide and increase the plasma levels of its cytotoxic metabolite 4-hydroxycyclophosphamide through the hepatic induction of CYP2B6 and CYP3A4. The problem is, that at the same time, induced CAR increases cancer cell resistance to 4-hydroxycyclophosphamide by increasing the detoxification rate of this compound.

CAR and PXR could serve as carcinogenesis promoters; it has been proposed that they directly affect tumor growth by controlling the expression of genes involved in motility, apoptosis, and cell–cycle progression in cancer cells [93–95]. CYP2B6 mRNA was also diminished in hepatocellular carcinoma with venous invasion but not in hepatocellular carcinoma without venous invasion [96]. Also, testosterone metabolizer CYP2B6 was found to decrease in prostate cancer. Decreased expression of CYP2B6 significantly correlated with faster cancer progression and poor prognosis in human prostate cancer. These findings suggest that CYP2B6 expression may be decreased in hormonal cancers, where the hormone is closely related to substrates of CYP2B6.

CAR and FOXO1

Forkhead box O (FOXO) transcription factors play an important role in modulating metabolic functions. When nutrient and insulin levels are low, FOXO1 promotes expression of gluconeogenic enzymes and its level is also higher in diabetic patients [97]. It is known that diabetes elevates the activity of hepatic drug metabolism in humans [98]. During the last decade, many scientific groups wanted to resolve the molecular connection between insulin regulation and drug metabolism. As a result, information on potential crosstalk between FOXO1 and xenobiotic metabolism was provided by Kodama and coworkers, who showed that FOXO1 binds to CAR and activates its transcriptional activity [99].

Increasing the level of P450s such as CYP2B6 or CYP3A4 in diabetes, increases production of sex hormones, leading to high plasma-free estrogen concentrations, which in turn activate the estrogen receptor (ER). Activation of these pathways can lead to proliferation, invasiveness, angiogenesis, and decreased apoptosis and will increase the chances of breast cancer in diabetic patients [100].

CAR and GR

Although submicromolar concentrations of dexamethasone (DEX) are known to activate GR, it does not appear to induce CYP2B6 expression at the mRNA level [101] in primary hepatocytes. GR plays an indirect role in CYP2B6 regulation by inducing the expression of CAR itself. In huh7 cell transfection experiments, activated GR increased the constitutive activation of a CYP2B6-PBREM reporter construct by CAR alone, in the absence of inducers. In the presence of ligand activated GR, only PB treatment caused a further twofold CAR-mediated CYP2B6-PBREM activation, compared to control cells. These studies show that GR is involved synergistically in the xenobiotic-responsive regulation of human CYP2B6 by CAR [102]. Increasing CAR levels with GR agonists, such as imidazole derivatives would increase the level of CAR-dependent drug metabolism, which could be beneficial in certain cancer diseases.

CAR and HNF-4α. See PXR and HNF-4

CAR and VDR

1α,25-(OH)₂D₃ induces the expression of the CYP2B6, CYP2C9, and CYP3A4 in primary human hepatocytes. The induction is mediated by VDR receptor, which binds to the same transactivating responsive elements (ER6, DR3, and DR4) shown to be targeted by PXR (see PXR/VDR cross talk) or CAR [103]. Since VDR activation increases CAR target P450s and with this its metabolic capacity, it could be established that VDR activators can serve as protectors from toxic compounds, which are inactivated by these enzymes, and on the other hand, vitamin D coadministration can increase the level of enzymes involved in anticancer drug activation.

CAR and PXR (see chapter PXR)

AHR

The induction of CYP1 family is mediated mainly through a specific cytosolic receptor, the aryl hydrocarbon receptor (AHR) [104]. Although AHR has long been recognized as a ligand-induced transcription factor, which is responsible for the xenobiotic activating pathway of several phase I and phase II metabolizing enzymes, recent evidence suggests that the AHR is involved in various cell signaling pathways critical to cell cycle regulation and normal homeostasis. Dysregulation of these pathways is implicated in tumor progression [105]. AHR not only mediates tumor promotion but also plays a role in tumor progression. It is also known that activation of the AHR may lead to deregulation of cell–cell contacts, thereby inducing unbalanced proliferation, dedifferentiation, and enhanced motility [106].

AHR exists as part of a cytosolic protein complex, which consists of two Hsp90 heat-shock proteins; a Hsp-90-interacting cochaperone p23 and an immunophillin-like protein (XAP2). In the presence of an exogenous ligand, like polycyclic aromatic hydrocarbons, anticancer drugs, e.g., docetaxel, erlotinib, tamoxifen, or dacarbazine), the receptor complex translocates to the nucleus, where it heterodimerizes with another protein, the aryl hydrocarbon nuclear translocator (ARNT). This heterodimer binds to consensus regulatory sequences termed AHREs (Aryl hydrocarbon responsive elements), XREs (Xenobiotic responsive elements) or DREs (Dioxin responsive elements), located in the promoter region of CYP1A1 and CYP1A2 and initiates their transcription [107]. The transcription of CYP1A1 is inhibited by the AHR-related factor aryl hydrocarbon receptor repressor (AHRR), which localizes in the nucleus in the form of a dimeric protein along with ARNT [108]. The AHRR/ARNT heterodimer acts as a repressor both by stopping transcription initiated at the XREs and by competing with AHR for heterodimer formation with ARNT. All AHR, ARNT, and AHRR proteins are members of the bHLH (basic helix-loop-helix) PAS (Per-ARNT-Sim) family of proteins. The bHLH motif is shared by other transcription factors such as MYC and MYOD and is the protein part essential for DNA binding of the AHR complex [109]. Heterodimerization of AHR/ARNT is facilitated by interactions between bHLP and PAS domains. Further interactions of the AHR/ARNT heterodimer with transcription factors such as Sp1 and NF-1 are essential to enhance the expression of the CYP1A1 gene. The half-life of AHR depends on the regulated proteosomal degradation of AHR; AHR degradation is mediated by ADPF (AHR degradation promoting factor), which has been proposed to serve as an E3 ubiquitin ligase [110].

AHR and GR

AHR has been shown to interact with the glucocorticoid receptor (GR) both in vitro and in vivo; GR decreases AHR-mediated expressions by interacting with XRE-binded AHR [111]. Decreased expression of P450s means prolonged half-life of some anticancer drugs or slower activation of procarcinogens. Recent evidence from studies in HepG2 cells and primary cultures of human hepatocytes has shown that dexamethasone reduces both basal and inducible CYP1A1 EROD activity. Furthermore, dexamethasone was shown to have direct effects on the modulation of TCDD-induced transcriptional activation as well as the proteosomal degradation of AHR in HepG2 cells. Induction of CYP1A1 protein by 3-methylcholantrene (3-MC) was also down-regulated by dexamethasone although it was not observed at the mRNA level [112]. These findings show that dexamethasone controls CYP1A1 expression in human hepatocytes and HepG2 cells through interactive regulatory crosstalk between GR and AHR receptors. The cross-reaction occurs only when both the AHR and GR are activated [113, 114]. In extrahepatic tissues, gefitinib and erlotinib antineoplastic drugs are metabolized by CYP1A1 and CYP1A2. Coadministration of the mentioned anti-GR imidazole-derivatives would prolong the drug exposure in the tumor [115].

AHR and ER

Crosstalk of AHR and ARNT with the estrogen receptor α (ERα) has also been established in a number of different systems [116, 117] and could be important in estrogen-related cancers. TCDD does not bind to ERα, but it does inhibit ERα signaling. More importantly, ERα plays a significant role in modulating AHR activity; treatment of TCDD and E2 results in an increased induction of CYP1A1, compared to TCDD treatment alone. ERα has a direct interaction with the CYP1A1 promoter, suggesting that it acts as a coregulator of AHR-mediated transcriptional activation [118]. In human bronchial epithelial cells, ERα increased the basal mRNA levels of CYP1B1 and the inducible protein levels of CYP1A1, thus regulating the expression of these genes at both the transcriptional and translational level, respectively [119]. A long time increase in CYP1 activity will lead to elevated concentration of free estrogen in the plasma, which in turn activates the ERα. Constant activation of ERα will promote abnormal cell division and tumor growth. With this, AHR-ER crosstalk increases the chances for hormonal cancer. The interaction of ERβ with AHR and ARNT has also been demonstrated after 3-MC exposure [120].

ER- and AHR-signaling pathways have been demonstrated to share several coactivator proteins, such as SRC-1 and receptor-interacting protein 140 (RIP140) [121] and it is also known that AHR induces the proteasomal downregulation of ER, which means that there are other cross points where these two receptors can interact and with this regulate CYP1A1 activity [122].

AHR and HIF1α

Like AHR, HIF1α protein is a member of the PAS family and it also interacts with ARNT [123]. The fact that these proteins share the same dimerization partner suggests an interaction between these nuclear receptors.

During angiogenesis and tumor growth, HIF-1alpha dimerizes with ARNT, inducing expression of many genes, including vascular endothelial growth factor (VEGF).

In normal tissue, AHR sequesters ARNT, decreasing its interaction with HIF-1alpha and with that diminishing VEGF production. In many cancer tissues, increased VEGF is responsible for tumor growth and tumor vascularization. Stimulation of the AHR pathway with AHR inducers would enhance the sequestering effects of the AHR through interaction with ARNT and would inhibit carcinogenesis [124].

AHR/HIFα cross talk is important in the regulation of the human CYP2S1 enzyme. The function of CYP2S1 is still unknown; very few studies report that this enzyme can process naphthalene type xenobiotics [125, 126]. This enzyme is regulated primarily by AHR, but a crosstalk between AHR and HIF-1α was also discovered after dioxin and hypoxia exposure, respectively [127]. Selective expression of CYP2S1 in hypoxic tumors results from this crosstalk. The AHR/HIFα heterodimer can bind to the promoter containing three hypoxia response elements that respond to the hypoxia sensor hypoxia-inducible factor 1 [128]. Because the presence of CYP2S1 in tumors was associated with poor prognosis [129, 130] it could be used as a marker for hypoxic tumor diagnosis.

NRF2

NF-E2-related factor 2 (NRF2) is a member of the Cap‘n’Collar family of basic region-leucine zipper (bZIP) transcription factors and is related to the erythroid transcription factor NF-E2 [157]. Multiple chemical inducers have been shown to activate through this element, e.g., butylated hydroxytoluene (BHT), oltipraz, sulforaphane, isothiocyanates (abundant in cruciferous vegetables), metal salts, and Michael reaction acceptors [131, 132].

Beyond the classical response of catalyzing the detoxification of carcinogens and other xenobiotics through conjugation and trapping processes, the NRF2 protein is also involved in chemoresistance by increasing glutation levels in cancer cells. In particular, induction of NRF2 causes the overexpression of glutathione S-transferases (GSTs), the enzymes that catalyze the conjugation of reduced glutathione to electrophilic compounds [133], as well as efflux pumps may reduce the reactivity of various anticancer drugs [134].

NRF2 is localized in the cytosol and binds to protein KEAP-1 (Kelch-like ECH-associated protein 1). Exposure to a number of stressors and inducing agents leads to dissociation of one or both of the NRF2-interacting motifs from KEAP-1, thereby rescuing NRF2 from proteasomal degradation and allowing for import into the nucleus. Once inside the nucleus, NRF2 dimerizes with small MAF proteins leading to the transactivation of several hundred cytoprotective genes, each of which contains one or more antioxidant response elements (AREs) in their promoters. Interactions with additional proteins serve to either amplify or attenuate the transcriptional response [135, 136]. The NRF2/MAF complex regulates P450s such as CYP1A1 or CYP2A5 [137].

NRF2 and AHR

It is well recognized that both AHR and NRF2 signaling regulates the expression of genes affecting the metabolism of xenobiotics, and both of them are involved in cancer formation. Miao and coworkers demonstrated that NRF2 gene transcription is directly modulated by AHR activation, where the receptor directly binds to the NRF2 promoter. Moreover, silencing of AHR expression with siRNA obviated induction of NRF2 mRNA by TCDD [138]. In this way, a comprehensive set of responses to xenobiotic challenges by AHR and NRF2 can be mounted. A functional collaboration between the AHR and NRF2 pathways can also be important in cancer. Talalay and colleagues defined two types of activators of NRF2 signaling: monofunctional and bifunctional [139]. Monofunctional inducers only affect NRF2 signaling. Bifunctional inducers such as ßnaphthoflavone may interact with the AHR directly to activate AHR-regulated genes, such as CYP1A1, CYP1A2, and CYP1B1, and then undergo transformation by these enzymes to reactive intermediates that then trigger NRF2 signaling [140, 141]. The discovery of functional cooperation between AHR and NRF2 has significant biological implications. Historically, the AHR has been associated with carcinogenesis, whereas NRF2 is associated with cytoprotection against degenerative diseases. The future challenge is to determine whether crosstalk between these two transcription factors can be exploited to therapeutic advantage or to improve chemopreventive strategies [142].

NRF2 and c-jun

The interplay between members of the activator protein-1 (AP-1) complex of leucine zipper (bZIP) transcription factors, such as c-jun/c-jun, and c-fos/c-jun, has been found to regulate basal CYP2J2 expression in human liver-derived cells [143, 144]. Recent findings of Lee and coworkers now establish that heterodimers formed between NRF2 and c-Jun upregulate P450s, such as CYP2J2. In their experiments, −105/−88-base pair region of the CYP2J2 gene 5′-flank as an atypical bZIP binding sequence was responsive to c-Jun/NRF2 dimers. Since CYP2J2 is the only activator of the non-sedating H1 antihistamine, ebastine, and it is also involved in the oxidation of epoxyeicosatrienoic acid (EET), discovering CYP2J2 regulation will enable the therapeutic exploitation of some of the beneficial actions of EET isomers in human tissues. EETs regulate numerous homeostatic processes, including cytoprotective and proliferative responses against injurious stresses [145] and it is also known that CYP epoxygenase 2J2 plays a role in promotion of the neoplastic cellular phenotype and in the pathogenesis of a variety of human cancers. Recognition of regulatory effect of NRF2 and c-jun on CYP2J2 in carcinoma cells could be important in potential antitumor therapy [146].

Post-transcriptional regulation

Although there are other post-transcriptional mechanisms than regulation by miRNA (alternative splicing, nuclear degradation, processing, nuclear export), not much is known about their role in carcinogenesis and we will not discuss them in this review.

miRNA regulation

miRNAs are a large family of endogenous, small regulatory RNAs that are generated by a two-step process from long primary miRNAs (pri-miRNAs) [147]. They are processed by a complex comprised of the RNase III enzyme DROSHA and an RNA-binding domain possessing protein DGCR8 (DiGeorge syndrome critical region gene 8) to 60–70 nt precursor miRNA (pre-miRNA) intermediates. Subsequently, these hairpin-shaped pre-miRNAs are transported to the cytoplasm, where they are cleaved by DICER to generate 20- to 22-nucleotide duplexes bearing two nucleotide single-stranded 3′ extensions [148]. miRNAs control the expression of a gene by targeting the 3 ‘UTR of mRNAs as a miRNA/RISC complex (RISC-RNA Induced Silencing Complex), which result ultimately in the degradation of the mRNA [149]. Human cancers commonly exhibit an altered expression profile of miRNAs with oncogenic (miR-21, miR-106a, and miR-155) or tumor-suppressive (let-7, miR-15a/16, miR-34a, and miR-143/145) activity. P450s are also regulated by miRNAs; the miRNA/RISC complex directly represses P450 protein translation, by binding to sequences in the 3′ untranslated region of P450 mRNAs or indirectly, by binding of the MRE sequences in xenosensor mRNA (Fig. 1).

Fig. 1.

Direct and indirect regulation of P450 expression by miRNA. In the cytoplasm, mature miRNA associates with a protein complex called RNA Induced Silencing Complex (RISC). The miRNA/RISC complex represses P450 protein translation directly by binding to sequences in the 3′ untranslated region of P450 mRNAs or indirectly by binding of the MRE sequences in xenosensor mRNA

Post-transcriptional regulation by miRNA could be responsible for a portion of the significant amount of unexplained interindividual variability in P450 enzyme expression and activity. Since xenobiotic-converting P450s play a role in carcinogenesis, P450-related cancer phenotypes can be modified by targeting expression of miRNAs.

Here we summarize the recent knowledge of those miRNAs that could have importance in P450s regulation during carcinogenesis.

CYP1 family

Human CYP1B1, which is highly expressed in estrogen target tissues, catalyzes the metabolic activation of various procarcinogens and the 4-hydroxylation of 17-beta-estradiol. Tsuchiya and coworkers found an abundant amount of CYP1B1 protein in cancerous tissue and they identified a near-perfect matching sequence with miR-27b in the 3′-untranslated region of human CYP1B1 (Table 4). Human CYP1B1 is post-transcriptionally regulated by miR-27b [150]. Another brain-specific miRNA, miR-124, also downregulates CYP1B1 directly and modulate all AHR target genes by binding to both AHR and AHRR, but its cancer relations have not yet been investigated [151].

Table 4.

Regulation of P450s and XARs by validated miRNA molecules

miRNA	P450	miRNA response element (5′-MRE-3′)	Tissue/cell line	References
hsa-miR-27b	CYP1B1	3′UTR (+4358 to +4381) CAGAACUUAGCCUUUACCUGUGAA	Breast cancer	[150]
	CYP3A4	3′UTR (+612 to +589) GGUGAAAGUUAAUCCACUGUGAC	HEK 293	[155]
	VDR	3′UTR (+1754 to +1782) UUUAUGGGGGGAGAACUUACAUUGUGAA	HEK 293	[155]
hsa-miR-148a	PXR	3′UTR (+3359 to +3386) GCCACAGACUCUUACGUGGAGAGUGCACUGACCU	HepG2, Caco-2d LS180	[156]
hsa-miR-378	CYP2E1	3′UTR (+1559 to +1580) UCAAAUUGUUUGAGGUCAGGAU	HEK293	[153]

CYP2A

NNK (4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone), another potent precarcinogen that can be found in tobacco products and smoke, is metabolized by CYP1A2, CYP2A6, and CYP3A4 in the liver and with CYP2A13 in the lung. NNK metabolites then form alkylating adducts with DNA, leading to genetic mutations. NNK induces tumors in multiple organs. The analogue rat enzyme for CYP2A13 is CYP2A3. Treating rats chronically with NNK, miR-34b, miR-101, miR-126, and miR-199 had lowered expression levels very early in the lungs of male F344 rats. Lowered miR-126 contributes to the increased production of CYP2A3, further activating NNK in a positive feedback loop and increasing the growth of the tumor [152].

CYP2E1

Mohri and coworkers recently found that miR-378 is involved in the post-transcriptional regulation of CYP2E1. The overexpression of miR-378 significantly decreased CYP2E1 protein levels and enzyme activity in the cells expressing CYP2E1, including 3′-UTR, but not in the cells expressing CYP2E1 without 3′-UTR, indicating that the 3′-UTR plays a role in the miR-378-dependent repression [153]. Chronically induced CYP2E1 with ethanol or other CYP2E1 inducers is a high-risk factor for esophageal and gastrointestinal cancers, which gives importance to investigate transcriptional and post-transcriptional CYP2E1 regulatory mechanisms, as basic targets in anticancer therapy.

CYP3A4

Epigenetic mechanisms provide new insight into the unsolved mechanism of the large interindividual variability of CYP3A4 expressions. Since CYP3A4 is involved in the metabolism of many anticancer drugs, from which many have a low therapeutic window (e.g., doxorubicine, ifosfamide, erlotinib), determining its metabolic capacity is very important. Lamba et al. reported that variability in hepatic CYP3A4 cannot be explained just by common CYP3A4 coding variants [154], suggesting the role of other mechanisms, such as regulation with miRNAs or inherited modifications in the miRNA gene itself. Until now, one miRNA, miR-27b, has been described to regulate CYP3A4 expression directly binding to the miRNA response element (MRE) within the 3’UTR region of CYP3A4 mRNA [155].

Some miRNAs, such as miR-148a, which is selectively and abundantly expressed in the liver, regulates other liver specific genes, for e.g., the human PXR receptor. miR-148a binds to the 3′-UTR region of PXR mRNA, thereby decreasing synthesis of PXR protein. Since CYP3A4 is a target for PXR, miR-148a indirectly modulates the inducible and/or constitutive levels of CYP3A4 expression [156]. Another example of indirect modulation would be the VDR receptor. VDR also regulates CYP3A4 (see cross talk VDR/PXR or VDR/CAR) and VDR could be down-regulated with miR-27b [153].

Conclusions

In this review, various examples of P450 regulation mechanisms were presented, which all contribute to the amount of finally translated P450 mRNA.

The P450s responsible for the activation or inactivation of precarcinogens and anticancer drugs are polymorphic. Considerable research has been directed to elucidate to what extent genetic polymorphism in the corresponding genes could affect susceptibility for environmentally induced cancer and for cancer therapy (for e.g., in a recent study, sex and polymorphisms in FoxA2, HNF4α, FoxA3, PXR, ABCB1, and the CYP3A4 promoter together explained 24.6% of the variation in hepatic CYP3A4 expression). The remaining 75.4% of variations depends on individual regulatory patterns (transcriptional, post-transcriptional or post-translational regulation) of CYP3A4 expression.

Understanding the molecular regulation of P450s with these receptors and enzymes, deducing new endogenous ligands for the nuclear receptors, and identification of novel miRNAs will be the next challenges to establish new markers of carcinogenesis and new therapeutical, cancer-related concepts.

Abbreviations

ADPF

AHR degradation promoting factor

AHR

Aromatic hydrocarbon receptor

AHRR

Aromatic hydrocarbon receptor repressor

ARNT

Aromatic hydrocarbon receptor nuclear translocator

ARE

Antioxidant response element

ASC2

Activating signal cointegrator 2

B[a]P

Benzo[a]pyrene

CAR

Constitutive androstane receptor

CREBBP

CREB-binding protein

DNMT

DNA methyltransferase

ER

Estrogen receptor

FOXO

Forkhead box O

GR

Glucocorticoid receptor

GRIP1

Glucocorticoid receptor interacting protein 1

HDAC1

Histone deacetylase-1

HIF-1

Hypoxia induced factor

HNF-4α

Hepatocyte nuclear factor

KEAP-1

Kelch-like ECH-associated protein 1

3-MC

3-Methylcholantrene

NcoR

Nuclear receptor corepressor

NF-κb

Nuclear factor kappa-light-chain-enhancer of activated B cells

NRF2

NF-E2-related factor 2

PRMT1

Arginine methyltransferase 1

PXR

Pregnane X receptor

RXR

Retinoid X receptor

SMC-1

Structural maintenance of chromosomes 1-like 1

SRC-1

Steroid receptor coactivator-1

SMRT

Silencing mediator for retinoid and thyroid receptor

TUF2

Transcriptional intermediary factor 2

VDR

Vitamin D receptor

XAP2

Immunophillin like X protein XAP2

XAR

Xenobiotic activated receptors