Abstract
Background
Bacillus subtilis is widely used in industrial-scale riboflavin production. Previous studies have shown that targeted mutagenesis of the ribulose 5-phosphate 3-epimerase in B. subtilis can significantly enhance riboflavin production. This modification also leads to an increase in purine intermediate concentrations in the medium. Interestingly, B. subtilis exhibits remarkable efficiency in purine nucleoside synthesis, often exceeding riboflavin yields. These observations highlight the importance of the conversion steps from inosine-5’-monophosphate (IMP) to 2,5-diamino-6-ribosylamino-4(3 H)-pyrimidinone-5’-phosphate (DARPP) in riboflavin production by B. subtilis. However, research elucidating the specific impact of these reactions on riboflavin production remains limited.
Result
We expressed the genes encoding enzymes involved in these reactions (guaB, guaA, gmk, ndk, ribA) using a synthetic operon. Introduction of the plasmid carrying this synthetic operon led to a 3.09-fold increase in riboflavin production compared to the control strain. Exclusion of gmk from the synthetic operon resulted in a 36% decrease in riboflavin production, which was further reduced when guaB and guaA were not co-expressed. By integrating the synthetic operon into the genome and employing additional engineering strategies, we achieved riboflavin production levels of 2702 mg/L. Medium optimization further increased production to 3477 mg/L, with a yield of 0.0869 g riboflavin per g of sucrose.
Conclusion
The conversion steps from IMP to DARPP play a critical role in riboflavin production by B. subtilis. Our overexpression strategies have demonstrated their effectiveness in overcoming these limiting factors and enhancing riboflavin production.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12934-024-02426-w.
Background
Riboflavin, an indispensable vitamin, has wide applications in the food, feed, and pharmaceutical industries [1–3]. The two active forms of riboflavin, flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN), are crucial for diverse cellular processes, including carbohydrate, lipid, and protein metabolism [4–6]. However, humans and other animals lack the ability to de novo synthesize riboflavin, necessitating a dietary intake. In contrast, microorganisms, including specific mutants of Bacillus subtilis [7], possess de novo riboflavin biosynthesis pathways and can excrete riboflavin into the environment [8, 9].
In recent decades, the commercial production of riboflavin through fermentation has significantly flourished, surpassing chemical synthesis. This trend is partly due to the advantages offered by B. subtilis, which is characterized by rapid growth, minimal nutritional requirements, and facile product extraction from fermentation broth [10–12]. Furthermore, advancements in genetic engineering have enabled B. subtilis to emerge as a highly competitive riboflavin producer, driving industrial-scale production efforts. Recently, the riboflavin market has been valued at USD 4.23 billion and is anticipated to continue growing [13]. This growth is attributed to the versatile uses of riboflavin, which serves as a valuable component in various products ranging from feed additives to cardiac medications and anticancer drugs.
In riboflavin biosynthesis, guanosine triphosphate (GTP) and ribulose-5-phosphate (Ru5P) serve as the two committed precursors. Our previous investigation identified a mutation in ribulose 5-phosphate-3-epimerase (RPE) that contributes to riboflavin overproduction in a B. subtilis strain with deregulated rib operon [14]. This mutation reduces the carbon flux to the Embden-Meyerhof-Parnas (EMP) pathway, thereby enhancing the precursor supply for riboflavin production, an effect akin to that observed in certain transketolase-deficient B. subtilis strains [15]. The augmented supply of ribose precursor results in the accumulation of purine metabolites in the fermentation media [14].
Notably, the purine de novo biosynthesis pathway encompasses steps beyond the conversion of Ru5P and GTP to riboflavin. The pathway is governed by complex feedback inhibition mechanisms. The transcriptional regulation of the purine operon is mediated by the PurR regulator [16]. Furthermore, upon binding to guanine, the purine riboswitch forms a terminal hairpin loop, leading to the initial termination of purine operon transcription [17]. Intermediates of the purine de novo biosynthesis pathway also regulate enzyme activities [18]. Several strategies aimed at enhancing riboflavin production through purine metabolism engineering have been investigated for strain development. Shi et al. achieved a 3-fold increase in riboflavin production (826.5 mg/L) by enhancing the purine de novo synthesis pathway through a series of deregulatory approaches [19]. Sun et al. pinpointed crucial genes within the purine salvage and degradation pathway that impact riboflavin production, paving the way for more precise manipulation of purine metabolic networks [20]. Nonetheless, data on intermediate concentrations and potential regulatory mechanisms from these studies implicate the necessity of expressing downstream genes in the GTP biosynthesis pathway. Based on this observation, we hypothesize that the regulation of the pathway by intermediate products can be alleviated through the overexpression of these genes alone.
To test this hypothesis, riboflavin production strain is constructed through the expression of five genes ranging from inosine-5’-monophosphate (IMP) to 2,5-diamino-6-ribosylamino-4(3 H)-pyrimidinone-5’-phosphate (DARPP), and the production of riboflavin was subsequently tested via flask fermentation. The expression of either all or a subset of these genes resulted in enhanced riboflavin production to varying extents. The most effective engineering approach to enhancing riboflavin production proved to be the overexpression of all these genes within a synthetic operon. These results suggest that a set of genes acting as bottlenecks have been identified in the parent strain. Through additional genetic engineering efforts and optimization of the fermentation medium, the final strain achieved a riboflavin titer of up to 3477 mg/L.
Results
Construction of the plasmid pEX5 for overexpressing the genes involved in the conversion of IMP to DARPP
In Bacillus subtilis, the genes responsible for encoding enzymes in the conversion pathway from inosine monophosphate (IMP) to 3,4-dihydroxy-2-butanone 4-phosphate (DARPP) are guaB, guaA, gmk, ndk, and ribA (Fig. 1). The enzymes IMP dehydrogenase (encoded by guaB) and Guanosine monophosphate synthetase (GMP synthetase) (encoded by guaA) catalyze consecutive reactions, driving the conversion of IMP to GMP. When expressing these genes, there are two notable aspects to consider.
Fig. 1.

This overview provides a comprehensive perspective on the genes involved in the downstream segments of the pentose phosphate pathway (blue), the purine pathway (orange), the riboflavin biosynthesis pathway (yellow), and their interconnected pathways within the framework of B. subtilis. Within this intricate biochemical network, inosine monophosphate (IMP) represents the first molecule bearing an intact purine ring, and other purine nucleotide are generated from IMP. In B. subtilis, a series of critical genes assume central roles in these biochemical transformations. Specifically, guaB, responsible for encoding IMP dehydrogenase, orchestrates the conversion of IMP into XMP. Furthermore, guaA, encoding GMP synthetase, governs the conversion of XMP into GMP. gmk, the gene responsible for guanylate kinase, is instrumental in catalyzing the transition from GMP to GDP. ndk, denoting nucleoside diphosphate kinase, presides over the conversion from GDP to GTP. And as the first step from purine precursor to riboflavin biosynthesis, ribA, encoding GTP cyclohydrolase II/3,4-dihydroxy-2-butanone 4-phosphate synthase, presides over the transformation of GTP and Ru5P into DARPP and DHBP
Firstly, unlike the purine operon formed by genes involved in IMP biosynthesis, these genes are not adjacent in the genome and can be significantly distant. Table 1 presents the upstream and downstream genes adjacent to these genes in the B. subtilis genome, along with their respective functions. Specifically, guaB is located at 15,915–17,381, guaA at 692,740–694,281, gmk at 1,641,949–1,642,563, and ndk at 2,381,354–2,381,803 [21]. This suggests that during evolution, the strain did not prioritize GTP accumulation but required tight coordination between intermediate synthesis and other cellular processes. Given their scattered locations and functional significance, it is necessary to construct a synthetic operon for these genes.
Table 1.
Adjacent genes to genes in downstream genes of GTP synthesis in B. subtilis
| Genes | Location | Upstream/Downstream genes | Function |
|---|---|---|---|
| guaB | 15,915–17,381 | yaaC/dacA | Unknow/Major D-alanyl-D-alanine carboxypeptidase |
| guaA | 692,740–694,281 | yebA/pbuG | Unknow/Hypoxanthine and guanine uptake |
| gmk | 1,641,949–1,642,563 | ylzA/rpoZ | Control of biofilm formation/Omega subunit of RNA polymerase |
| ndk | 2,381,345–2,381,803 | cheR/hepT | Motility, chemotaxis/Menaquinone biosynthesis |
Secondly, the catalytic biases observed in this series of reactions merit attention. This direction of conversion is supported by the metabolic pathway data available on Metacyc [22]. Nevertheless, an excess of purine nucleotides is subject to degradation into nucleosides through the action of various 5’-nucleotidases in B. subtilis [23]. Diverting this metabolic flow toward riboflavin biosynthesis necessitates the introduction of a competitive enzyme. Guanylate kinase (encoded by gmk) and nucleoside-diphosphate kinase (encoded by ndk) are pivotal in the reactions converting GMP to GTP. Since these reactions are reversible, their overexpression may not significantly alter the metabolic flow. RibA catalyzes the initial steps of riboflavin synthesis, and these reactions are irreversible, as stated in the Metacyc database. Prior research has demonstrated that the overexpression of ribA exerts a substantial impact on riboflavin production [24]. Consequently, RibA emerges as a suitable “driver” for the consecutive reactions.
Based on the aforementioned theory, these genes were assembled into a synthetic operon (Supplementary Fig. 1). This operon was under the control of a strong promoter called Pr, which was created by deregulating and modifying the promoter of the rib operon [25]. In B. subtilis, RibA serves as a dual-function enzyme (GTP cyclohydrolase II and 3,4-dihydroxy 2-butanone 4-phosphate synthase) responsible for key steps in the production of riboflavin [24]. Given the significance of RibA, it was positioned at the beginning of the operon. The enzyme catalyzing the penultimate step, encoded by ndk, is located downstream of ribA in the operon. The arrangement of the other three genes within the operon follows the sequence of their respective catalyzed reactions. To prevent transcription attenuation, a PvegI constitutive promoter [26] was inserted upstream of guaB. The mid-copy number plasmid pHP13(spe) [14, 27] is chosen as the backbone, and the operon is ligated to it by Gibson assembly to generate pEX5.
Effect of overexpression of downstream genes of GTP synthesis pathway and ribA on riboflavin production
The pEX5 is introduced into the strain BSR (Table 3) to generate BEX5. BSR is constructed on the background of B. subtilis 168, containing a deregulated rib operon and a mutation of ribulose 5-phosphate 3-epimerase (RPE), which causes a reduced RPE activity, leading to the accumulation of purine intermediates as reported in our prior investigations [14]. Flask fermentation was conducted to test BEX5 and BS13, which is BSR transformed with the pHP13(spe) vector. As shown in Fig. 2A, while BEX5’s growth was slightly impeded compared to the control strain (11.27% decrease), the introduction of the synthetic operon significantly increased riboflavin production to 726 ± 12 mg/L (a 3.09-fold increase) after 48 h (Fig. 2B). This surpassed the results of ribA overexpression alone and closely matched the effects of rib operon overexpression reported previously [14].
Table 3.
Strains and plasmids used in this study
| Strains or plasmids | Description of genotype | Source |
|---|---|---|
| Strains | ||
| B. subtilis R (BSR) |
B.subtilis 168, araR: para-neo, ribO*, rib+(gsiB), purA*, rpe* |
[14] |
| BEX5 | BSR/pEX5 | This study |
| B13 | BSR/pHP13(spe) | This study |
| BSRE1 | BSR, △amyE::Pr-ribA-ndk-PvegI-guaB-guaA-gmk | This study |
| BSRE2 | BSRE1, Δapt | This study |
| BSRE3 | BSRE2, perRL71V | This study |
| BSRE4 | BSRE3, Δtkt(tkt0) | This study |
| BSRE4/pMX45 | BSRE4/pMX45 | This study |
| BSRA | BSR/pEXRA | This study |
| BSGA | BSR/pEXGA | This study |
| BSGB | BSR/pEXGB | This study |
| BSGK | BSR/pEXGK | This study |
| BSNK | BSR/pEXNK | This study |
| BSAA | BSR/pEX2AA | This study |
| BSAB | BSR/pEX2AB | This study |
| BSAN | BSR/pEX2AN | This study |
| BSAG | BSR/pEX2AG | This study |
| BSRNBA | BSR/pEX4RNBA | This study |
| BSRBAG | BSR/pEX4RBAG | This study |
| BSRNBG | BSR/pEX4RNAG | This study |
| BSRNAG | BSR/pEX4RNAG | This study |
| BSNBAG | BSR/pEX4NBAG | This study |
| BSR1 | BSR, Δapt | [20] |
| BSR2 | BSR, Δxpt | [20] |
| BSR3 | BSR, ΔhprT | [20] |
| BSR4 | BSR, ΔadeC | [20] |
| BSR5 | BSR, ΔpucABCDE | [20] |
| BSR6 | BSR, ΔyfkN | [20] |
| BSR7 | BSR, ΔyunD | [20] |
| BSR8 | BSR, ΔyktC | [20] |
| BSR9 | BSR, ΔycsE | [20] |
| BSR10 | BSR, ΔdeoD | [20] |
| BSR11 | BSR, ΔpupG | [20] |
| BSRPE1 | BSR1/pEX5 | This study |
| BSRPE2 | BSR2/pEX5 | This study |
| BSRPE3 | BSR3/pEX5 | This study |
| BSRPE4 | BSR4/pEX5 | This study |
| BSRPE5 | BSR5/pEX5 | This study |
| BSRPE6 | BSR6/pEX5 | This study |
| BSRPE7 | BSR7/pEX5 | This study |
| BSRPE8 | BSR8/pEX5 | This study |
| BSRPE9 | BSR9/pEX5 | This study |
| BSRPE10 | BSR10/pEX5 | This study |
| BSRPE11 | BSR11/pEX5 | This study |
| E.coli | Standard cloning strain | This study |
| Plasmids | ||
| pHP13 (spc) | Sper | [14] |
| pEX5 | pHP13(spe)-Pr-ribA-ndk-PvegI-guaB-guaA-gmk, Sper | This study |
| pEX4RNBA | pHP13(spe)-Pr-ribA-ndk-PvegI-guaB-guaA, Sper | This study |
| pEX4RBAG | pHP13(spe)-Pr-ribA-PvegI-guaB-guaA-gmk, Sper | This study |
| pEX4RNBG | pHP13(spe)-Pr-ribA-ndk-PvegI-guaB-gmk, Sper | This study |
| pEX4RNAG | pHP13(spe)-Pr-ribA-ndk-PvegI-guaA-gmk, Sper | This study |
| pEX4NBAG | pHP13(spe)-Pr-ndk-PvegI-guaB-guaA-gmk, Sper | This study |
| pEXRA | pHP13(spe)-Pr-ribA, Sper | This study |
| pEXGA | pHP13(spe)-Pr-guaA, Sper | This study |
| pEXGB | pHP13(spe)-Pr-guaB, Sper | This study |
| pEXGK | pHP13(spe)-Pr-gmk, Sper | This study |
| pEXNK | pHP13(spe)-Pr-ndk, Sper | This study |
| pEX2AA | pHP13(spe)-Pr-ribA-guaA, Sper | This study |
| pEX2AB | pHP13(spe)-Pr-guaA-guaB, Sper | This study |
| pEX2AN | pHP13(spe)-Pr-guaA-ndk, Sper | This study |
| pEX2AG | pHP13(spe)-Pr-guaA-gmk, Sper | This study |
| pMX45 | Eryr, SM19035-derived plasmid, carrying a complete rib operon | [48] |
Fig. 2.
The comparative analysis of growth and riboflavin production between strains overexpressing a synthetic operon and the control strain. (A) Presents the riboflavin production between BEX5 (BSR overexpression pEX5) and B13 (BSR overexpression pHP13 (spe)) during flask fermentation at 48 h, with sucrose employed as the carbon source. (B) The growth curve of BEX5 and B13
To investigate the effect of overexpression of a single gene on riboflavin production, vectors carrying five independent genes under the control of Pr promoter were constructed and transformed into BSR to generate BSRA, BSGA, BSGB, BSGK, and BSNK. As the flask fermentation results showed, only BSRA exhibited a significant enhancement of riboflavin production compared with the control strain (Fig. 3A). The biomass of these overexpressed strains was similar to that of the control strain, except for BSGA, which was higher than the control strain (Supplementary Fig. 2).
Fig. 3.
The riboflavin production performance is examined in flask fermentation at 48 h, within strains overexpressing specific genes from the synthetic operon. (A) Riboflavin production within strains overexpressing individual genes from the synthetic operon. (B) Riboflavin production when strains overexpress ribA in conjunction with the remaining four genes of the synthetic operon. (C) Riboflavin production within strains where four out of the five genes from the synthetic operon are co-overexpressed
These results indicate that overexpressing the combination of the five genes increases carbon flow towards riboflavin production, with ribA as the key enzyme. Further more, plasmids were constructed in which ribA was co-expressed with each of the other four genes individually. These plasmids were then transformed into BSR to generate BSAA, BSAB, BSAN, and BSAG. As shown in Fig. 3B, riboflavin production increased by 6.6% in the strain overexpressing the combination of ribA and gmk compared to the strain overexpressing ribA alone, while production decreased in other combinations. Alternatively, strains overexpressing random combinations of four of the five genes were constructed. Fermentation results demonstrated that riboflavin production decreased by 66% when ribA was absent compared to BSEX5. Additionally, riboflavin production decreased by 48.3%, 47.2%, 36.0%, and 22.4% in the absence of guaB, guaA, gmk, and ndk, respectively (Fig. 3C). These results demonstrate that all five genes are necessary, to varying degrees, for achieving higher riboflavin production.
In E. coli, the gene pairs gmk-ndk and guaB-guaA were both expressed to increase riboflavin production [28]. However, it was observed that only the gmk-ndk combination favorably impacted riboflavin production, indicating a divergence in purine metabolism between the two strains. In B. subtilis, inosine and IMP are the primary byproducts of purine pathways [14], whereas E. coli tends to accumulate xanthine when GMP synthase is knocked out [29].
Development of a riboflavin-producing strain
Subsequently, we combined the overexpression of the synthetic operon with other previously employed strategies in our studies to develop a more competitive riboflavin-producing strain. Initially, we generated strains by introducing pEX5 into purine metabolic network deletion mutants [20] to assess the regulatory effect on the synthetic operon. These strains were subsequently subjected to flask fermentation experiments. As shown in Fig. 4, the highest riboflavin production of 798 ± 61 mg/L was achieved in the apt deletion strain. Furthermore, the riboflavin production of BSRPE2 exceeded that of the parent strain. However, it was observed that gene deletions in BSRPE3-11 adversely affected strains overexpressing the synthetic operon. These findings underscore the diverse impacts of strain backgrounds on production when expressing the synthetic operon. This phenomenon is attributed to the complex regulation of the purine de novo synthesis pathway, which involves salvage, degradation, and interconversion pathways [20].
Fig. 4.

Riboflavin production was assessed in flask fermentation at 48 h, among strains with diverse genetic backgrounds, each of which overexpressed the synthetic operon. Specifically, the introduction of pEX5 was performed within deletion mutants of the purine metabolic network. Subsequently, the performance of these strains was evaluated through flask fermentation experiments
Subsequently, a series of genetic manipulations were performed on the background of BSR, which was derived from the wild-type strain B. subtilis 168 [14]. Initially, the synthetic operon was integrated into the amyE locus of BSR, resulting in the generation of BSRE1. Subsequently, the apt gene was deleted in BSRE1 to produce BSRE2, followed by the introduction of a site-directed mutation in perR [20] to generate BSRE3.
To further augment the supply of pentose precursors, a nonsense mutation of tkt [14] was introduced into BSRE3, resulting in the formation of BSRE4. Finally, plasmid pMX45, carrying an overexpressed rib operon, was introduced into BSRE4, yielding BSRE4/pMX45.
Flask fermentation experiments were conducted to assess the riboflavin production capacity of these strains. As Fig. 5 shows, when the synthetic operon was integrated into the genome, riboflavin production reached 790 ± 87 mg/L, representing a remarkable 2.46-fold increase compared to the parent strain. Notably, the production further surged to 991 ± 78 mg/L following the knockout of the apt gene. PerR, a global regulator with influence over purine metabolism [30], was strategically targeted with a site-directed mutation in previous studies. This mutation suppressed the dNTP synthesis pathway, redirecting carbon flow towards GTP/riboflavin production and leading to a notable 25% increase in riboflavin production. Consequently, in BSRE4, riboflavin production soared to 2012 ± 139 mg/L, even though the biomass of BSRE4 experienced a 32% reduction compared to BSRE3 (Supplementary Fig. 3). This suggests a significant redistribution of carbon flux between growth and precursor production. The production of riboflavin in BSRE4/pMX45 reached an impressive 2702 ± 224 mg/L. This is 32% higher than in BSRE4 and a remarkable 8.44-fold increase compared to BSR. Interestingly, it was noted that the growth and sucrose consumption rates of BSRE4/pMX45 were lower than those of BSRE4. (Fig. 5B, C, D)
Fig. 5.
Various aspects of the genetic engineering strain, including riboflavin production, biomass, and sucrose consumption. (A) Riboflavin production levels in a series of strains with a genome-integrated synthetic operon, all based on the BSR background. (B) Comparison of the biomass between the final strain BSRE4/pMX45 and the parent strain. (C) The sucrose concentration within the fermentation medium for both BSRE4/pMX45 and the parent strain. (D) The sucrose consumption rate specifically for BSRE4/pMX45
Optimization of the Fermentation Medium of BSRE4/pMX45
The sucrose consumption rate of BSRE4/pMX45, as illustrated in Fig. 5D, demonstrated a decline after 24 hours, specifically from 0.93 to 0.8 g/L/h. Furthermore, a noticeable rise in sugar accumulation occurred during the feeding process, as evidenced in Supplementary Fig. 4 Preliminary optimization efforts of the medium indicated that the levels of nitrogen sources, specifically corn steep powder, yeast extract, and (NH4)2SO4, had a substantial impact on riboflavin production and yield in BSRE4/pMX45. Consequently, we employed a Box-Behnken design and the response surface method (RSM) for further experimentation.”
To investigate the combined effects of these variables, we designed experiments with varying combinations using the Design Expert software. Table 2 summarizes the central composite experimental plan along with the experimental and predicted responses for each experiment. The corresponding equation could be written as:
![]() |
![]() |
![]() |
![]() |
Table 2.
Central composite experimental plan and results
| corn steep powder (g/L) | yeast extract (g/L) | (NH4)2SO4 (g/L) | riboflavin production (g/L) |
|---|---|---|---|
| 30 | 12.5 | 20 | 2595 |
| 18.75 | 12.5 | 12.5 | 2882 |
| 18.75 | 5 | 5 | 2562 |
| 30 | 12.5 | 5 | 2925 |
| 7.5 | 5 | 12.5 | 3292 |
| 30 | 5 | 12.5 | 2476 |
| 18.75 | 20 | 20 | 2949 |
| 30 | 20 | 12.5 | 3134 |
| 18.75 | 20 | 5 | 3100 |
| 7.5 | 12.5 | 20 | 2260 |
| 7.5 | 12.5 | 5 | 2629 |
| 18.75 | 12.5 | 12.5 | 2920 |
| 18.75 | 5 | 20 | 3023 |
| 7.5 | 20 | 12.5 | 2989 |
where R2 was 0.9711. Among the model terms, the linear coefficients for corn steep powder (P = 0.0275) and yeast extract (P = 0.0234) were more significant compared to other factors, indicating a substantial influence of their concentrations on riboflavin production. According to the equation, the optimized nitrogen sources for riboflavin production are as follows: corn steep powder 75 g/L, yeast extract 11.27 g/L, and (NH4)2SO4 7.5 g/L, with a predicted production of 3513 mg/L. Under optimal conditions, we carried out shaking-flask cultivation, achieving a yield of 3477±231 mg/L, which closely matched the predicted values, indicating good agreement between experimental and theoretical outcomes.
Discussion
In this study, we overexpressed the genes involved in downstream purine de novo synthesis, along with ribA, within a synthetic operon. The production of riboflavin exhibited a noteworthy increase when the synthetic operon was either integrated into the genome or introduced into BSR via a plasmid. Nevertheless, individual expression of the five genes revealed that only the expression of ribA resulted in augmented production compared to the parent strain. The combined expression of ribA with the other four genes, as well as four out of the five gene combinations, emphasized the profound influence of the gmk and guaB-guaA combination on riboflavin production. The optimization of fermentation media, utilizing the response RSM, unveiled a favorable effect of organic nitrogen sources on both riboflavin production and yield. It is worth mentioning that the optimal concentrations of corn steep powder and yeast extract were determined to be 4–6 times greater than their initial levels. These nitrogen source concentrations were notably higher than those commonly employed in the medium for the production of other chemicals by B. subtilis, as documented in previous studies [31–35].
This finding implies that a higher nitrogen input during the fermentation process is necessary to attain enhanced riboflavin production by the strain. Therefore, further research is needed to investigate the assimilation and utilization of nutrients in greater detail. Nitrogen sources are critical in supplying the essential precursors for amino acid and purine/pyrimidine biosynthesis in bacteria.
In the case of BSRE4/pMX45, the increased demand for nitrogen sources can be attributed to several factors. Firstly, the non-oxidative pentose phosphate pathway is impaired due to the presence of the rpe point mutation and tkt nonsense mutation. These mutations have the potential to disrupt the regular carbon and energy flux within the cell, resulting in an increased demand for nitrogen sources to offset the metabolic inefficiencies. Furthermore, a competition exists for the utilization of GTP between RNA synthesis and riboflavin biosynthesis in BSRE4/pMX45. This competition further intensifies the requirement for augmented nitrogen sources since GTP is a crucial element in both processes. Moreover, while the overexpression of genes is advantageous for boosting riboflavin production, it can impose a metabolic burden on the engineered strains. This burden can be alleviated by supplementing the culture medium with components that contain amino acids and nucleotides, such as corn steep powder and yeast extract, as previously described [36, 37]. These components supply vital precursors and cofactors necessary for diverse biosynthetic pathways, thereby enhancing the strain’s capacity to produce riboflavin efficiently.
Jiajia You and colleagues examined the impact of dissolved oxygen limitation on riboflavin production and downregulated the regulators tnrA and glnR, which are responsible for balancing intracellular nitrogen metabolism [38]. The low levels of dissolved oxygen in the flask environment may result in unfavorable conditions for riboflavin production owing to the inhibitory influence of tnrA and glnR on nitrogen source assimilation and utilization [39–41]. As a result, it was observed that medium optimization, specifically by elevating organic nitrogen source concentrations and reducing inorganic nitrogen source concentrations, led to the suppression of tnrA expression during cell cultivation [42]. The BSRE4/pMX45 strain was derived from the B.subtilis 168 background. In numerous references, it’s been noted that strains engineered from B.subtilis 168 tend to exhibit low biomass in fed-batch or batch fermentation processes [43–45]. As a result, flask fermentation is frequently employed for the evaluation of engineered riboflavin-producing strains. In fed-batch fermentation, the biomass of BSRE4/pMX45 remains low, exhibiting a measured OD600 value of 40. This low biomass does not pose a hindrance when producing primary metabolites like ribose and acetoin. Nonetheless, it is crucial to emphasize that riboflavin production is tightly associated with cell growth. Therefore, the riboflavin producing strains should undergo genetic mutations that enable continuous growth in the bioreactor, offering distinct advantages in this context.
By reducing the metabolic flux in the pyrimidine pathway, Xu et al. successfully increased riboflavin production to 7.01 g/L using 80 g/L of glucose, resulting in a yield of 0.089 g riboflavin/g glucose [46]. Zhang et al. also enhanced riboflavin production and yield through in vitro and in vivo modifications of the PP pathway, raising the yield from 0.065 g riboflavin/g glucose to 0.084 g riboflavin/g gluconate [47]. However, even compared with the industrial producer [48], the yield of inosine from engineered strains surpassed that of riboflavin. Takayuki Asahara et al. constructed a B. subtilis strain capable of inosine production through the introduction of just seven gene-targeted mutations [49]. This engineered strain achieved an impressive yield of 6 g/L inosine when supplied with 30 g/L of glucose, resulting in a remarkable yield of 1 g of inosine for every 5 g of glucose consumed. Notably, given that the yield of ribose/glucose was even higher [15], the purine de novo synthesis pathway has long been recognized as a bottleneck in riboflavin production. This leads us to hypothesize that the purine de novo biosynthesis pathway, especially downstream reactions involved in GTP synthesis, represents a significant limitation in terms of production and yield enhancement. In this study, we have partially validated this hypothesis and suggest that further experiments, such as the knockout of 5’-nucleotidases, warrant thorough investigation to enhance our understanding in this field. More importantly, the strategy of arranging previously dispersed genes into an artificial operon mimics nature’s deliberate biosynthetic processes that have occurred over the course of evolution. The implementation of artificial operons in metabolic engineering holds significant potential and provides a valuable framework for future research endeavors in microbial cell factories.
Conclusions
In an effort to enhance riboflavin production in B. subtilis, a strategic focus was directed toward optimizing the downstream reactions associated with GTP de novo synthesis. In summation, these particular steps were identified as the predominant limiting factors for riboflavin production, particularly when an ample supply of pentose precursors was at hand. The chosen expression strategy demonstrated remarkable efficacy in mitigating these limitations. Additionally, it is of noteworthy significance that the engineered strain exhibited a pronounced dependency on organic nitrogen sources to attain higher production levels. This insight offers valuable contributions to the ongoing efforts in fine-tuning growth medium optimization for these strains.
Material and method
Strains and plasmids
The strains and plasmids used in this study are listed in Table 3. B. subtilis R (BSR) was derived from B. subtilis 168 by genome engineering in our previous work [14]. The genes cloned in all experiments described in the paper are from B. subtilis 168. BSR is a riboflavin production strain with deregulated rib operon and a mutant of rpe on the genome. E. coli DH5α was used as the host strain for genetic manipulation. Luria-Bertani medium was used for standard cultures of B. subtilis and E. coli unless indicated otherwise. For investigation of the riboflavin production and biomass, the culture was inoculated into a fermentation medium containing: 40 g/L sucrose, 15 g/L corn steep powder (Solarbio, Beijing, China), 7.5 g/L (NH4)2SO4, 5 g/L yeast extract (Solarbio, Beijing, China), 4 g/L MgSO4, 3 g/L K2HPO4, 1 g/L KH2PO4, and appropriate antibiotics. The optimization of the medium is based on this fermentation medium. A mid-copy number plasmid pHP13(spe) was constructed by replacing the original antibiotic-resistant gene with a spectinomycin-resistant gene [14, 50], which was used for the expression of all genes. pMX45 was used to overexpress the rib operon [49].
Genome manipulation and plasmid construction
B. subtilis transformation was performed according to a published protocol [51]. The genome manipulation method is based on the paraR-neo/cat-araR counter-selection system, the same as previous studies [52]. Taking BEX5 as an example: the synthetic operon, which cloned from pEX5 was integrated at the aymE locus of BSR to generate BSRE1. The primer pairs AmyE-ex5-UP1/AmyE-ex5-UP2 and AmyE-ex5-DN1/AmyE-ex5-DN2 were used to clone the upstream and downstream sequences flanking the amyE locus. The primer pair CR1/AmyE-ex5-CR2 was used to clone the cat-araR (CR) fragment, while AmyE-ex5-CR2 also carried a direct repeat (DR, 20 bp) sequence, the homologous DR sequence was also located downstream of the UP fragment. The primer pair AmyE-ex5-ex5-1/AmyE-ex5-ex5-2 was used to clone the synthetic operon from pEX5, which was introduced into the downstream of CR fragment by overlap Polymerase Chain Reaction (PCR). Other fragments above were also assembled by overlapped PCR, with the nucleotides at the upstream and cat-araR end. This fragment was used to transform BSR, after which Cm-resistant transformants were selected, and verified by PCR using the primer pair AmyE-ex5-UP1/AmyE-ex5-DN2. The PCR fragment was sequenced to prevent the mutations. The verified clone was incubated in LB broth for 8 h at 37℃ to induce intra-genomic recombination at the two homologous DR fragments, after which the culture was plated onto LB agar plates containing Nm. After incubation at 37◦C for 1 day, Nm-resistant colonies were selected and verified by PCR using the primer pair AmyE-ex5-UP1/AmyE-ex5-DN2. Standard protocol was used for the construction, purification, and analysis of plasmid DNA and other DNA fragments (See Table 4).
Table 4.
Primers used in this study
| Name | Sequence (5’–3’) |
|---|---|
| tkt-ko-UP1 | AGCCAGCGGATATGAAATG |
| tkt-ko-UP2 | TGAACTAATGGGTGCTTTAGTTGAAGAGTGCGAATGGTAGCAACTGAT |
| tkt-ko-CR2 | CTGAGAAGCCGTATTCGTTAATGTGCGAATGGTAGCAACTGATTTCTTTTCAATTGTATCCATTATTCATTCAGTTTTCGTGCG |
| tkt-ko-DN1 | ATTAACGAATACGGCTTCTCAG |
| tkt-ko-DN2 | GCGGGTGATGAATGATTGC |
| apt-KO-UP1 | GCAGAAATGAACATGCTGTCTCC |
| apt-KO-UP2 |
TGAACTAATGGGTGCTTTAGTTGAAGACCCTCTTTCGGGTA ATCCGGTAC |
| apt-KO-CR2 |
TGCCGTCAAGGTAAGAAAGCTCGATTAAGAAAGCGCCCTC TTTCGGGTAATCCGGTACAATTGTTACGTATTGTTTTATTC ATTCAGTTTTCGTGCG |
| apt-KO-DN1 | CGCTTTCTTAATCGAGCTTTCTTACCTTG |
| apt-KO-DN2 | GCTTATTTTGCAGCACCATTTTTCG |
| perR-KO-UP2 |
TGAACTAATGGGTGCTTTAGTTGAAGAGGCTTCTTTTAGTT CATGTGCA |
| perR-KO-CR2 |
ATGATTTTCTTTTTTCGAACACTCTTGGGGCTTCTTTTAGTT CATGTGCAGCCATCCGTCATGCACCTTTATTCATTCAGTTT TCGTGCG |
| perR-KO-DN1 | CCAAGAGTGTTCGAAAAAAGAA |
| perR-KO-DN2 | TTCGGCAAACGGAAATGTA |
| CR1 | TCTTCAACTAAAGCACCCATTAGTTCAACAAACG |
| pHP13-2 | AAGCCTGGGGTGCCTAATGAGT |
| ph13-pr | CTCACTCATTAGGCACCCCAGGCTTAATTGACGGCTCAGAGTATCATG |
| ribA-1 | ATGTTTCATCCGATAGAAGAAGCACTGG |
| Pr-(ribA)-2 | TAAAGCGTCCAGTGCTTCTTCTATCGGATGAAACATTTTGAATTCCTCCTTTTGTCCTTATTGGTTA |
| ex5-ribA-2 | CCATCATTATGTATGTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| ex5-ndk-1 | CATACATAATGATGGGGTGGAGAATATGATG |
| ex5-ndk-2 | GAATATTGACTCTTGACGGTGAACTTGCTTAATAGATCCAGCCTGCCATAAGCT |
| ex5-PvegI-1 | GCAAGTTCACCGTCAAGAGTC |
| ex5-PvegI-2 | CGTTAAGCCTTCTTTTGAAAATTTACTTTCCCACATTGCATCCACCTCACTACATTTATTGTAC |
| ex5-guaB-1 | ATGTGGGAAAGTAAATTTTCAAAAGAAGGC |
| ex5-guaB-2 | CCTAATCTCCTCTAAGTTTATGAAATTGTATAGTTAGGTGATTCTTTTGTAATCTG |
| ex5-guaA-1 | ACTTAGAGGAGATTAGGTGACAACCAT |
| ex5-guaA-2 | CATGCGGCAATTACCCCTGCCCTTCATCTTATTCCCACTCAATCGTCGCAG |
| ex5-gmk-1 | GATGAAGGGCAGGGGTAATTGC |
| ex5-gmk-2 | CGACGGCCAGTGAATTTATTCAACCTCCAGCATTTTCTTATATCTT |
| pHP13-1 | ATTCACTGGCCGTCGTTTTACAAC |
| ex4-guaA-3 | CGACGGCCAGTGAATTTATTCCCACTCAATCGTCGCAG |
| ex4-guaB-3 | CCCCTGCCCTTCATCTTATGAAATTGTATAGTTAGGTGATTCTTTTGTAATCTG |
| ex4-ribA-3 | TGACGGTGAACTTGCTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| ex4-PvegI-3 | TAATCTCCTCTAAGTTGCATCCACCTCACTACATTTATTGTAC |
| ex4-pr | CCATCATTATGTATGTTTGAATTCCTCCTTTTGTCCTTATTGGTTATTA |
| ex2-ribA-guaA | TAATCTCCTCTAAGTTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| ex2-ribA-gmk | CCCCTGCCCTTCATCTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| ex2-ribA-guaB | TTTACTTTCCCACATTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| ex2-guaB-3 | AACGACGGCCAGTGAATTTATGAAATTGTATAGTTAGGTGATTCTTTTGTAATCTG |
| ex5-ribA-2 | CCATCATTATGTATGTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| ex2-ndk-3 | CGACGGCCAGTGAATTTAATAGATCCAGCCTGCCATAAGCT |
| Pr-ndk-oe-1 | AAGGAGGAATTCAAACATACATAATGATGGGGTGGAGAATATGATG |
| ndk-oe-2 | CGACGGCCAGTGAATTTAATAGATCCAGCCTGCCATAAGCT |
| ribA-002 | CGACGGCCAGTGAATTTAGAAATGAAGTAAATGACCTAGCTTGTTCAT |
| guaB-1 | AAGGAGGAATTCAAAATGTGGGAAAGTAAATTTTCAAAAGAAGGC |
| guaB-2 | CGACGGCCAGTGAATTTATGAAATTGTATAGTTAGGTGATTCTTTTGTAATCTGTACG |
| Pr-2 | TTTGAATTCCTCCTTTTGTCCTTATTGGTTA |
| guaA-1 | AAGGAGGAATTCAAAATGACAAAGTTAGTGAATGAAATGATTCTTGTC |
| guaA-2 | CGACGGCCAGTGAATTTATTCCCACTCAATCGTCGCAG |
| gmk-1 | AAGGAGGAATTCAAAATGAAAGAAAGAGGGTTATTAATCGTTCTC |
| gmk-2 | CGACGGCCAGTGAATTTATTCAACCTCCAGCATTTTCTTATATCTTGG |
| ndk-1 | AAGGAGGAATTCAAAATGATGGAAAAGACTTTTATCATGGTG |
| ndk-2 | CGACGGCCAGTGAATTTAATAGATCCAGCCTGCCATAAGCTG |
| AmyE-ex5-UP1 | GGCGTGAATGGGAAAAATAAGAGAG |
| AmyE-ex5-UP2 | TTTGTTGAACTAATGGGTGCTTTAGTTGAAGACAGTACCTAAGTAACGGTTGCC |
| CR1 | TCTTCAACTAAAGCACCCATTAGTTC |
| AmyE-ex5-CR2 | TGCTACTCCATGATACTCTGAGCCGTCAATTCAGTACCTAAGTAACGGTTGCCAATTTGATACGATGTCGGTTATTCATTCAGTTTTCGTGCGGAC |
| AmyE-ex5-ex5-1 | AATTGACGGCTCAGAGTATCATGG |
| AmyE-ex5-ex5-2 | AAAACTGTATTTCTCGGTCCTCGTTACACCTTATTCAACCTCCAGCATTTTCTTATATCTT |
| AmyE-ex5-DN1 | GGTGTAACGAGGACCGAGAAATAC |
| AmyE-ex5-DN2 | CTCGCAGAATCAAGTGTTGTG |
All of the expression plasmids were constructed using Gibson assembly (Supplementary Fig. 5). Taking pEX5 as an example, the five genes: ribA, guaB, guaA, gmk, ndk was cloned from the genome of B.subtilis 168 by PCR using the primer pairs ribA-1/ex5-ribA-2, ex5-ndk-1/ex5-ndk-2, ex5-guaB-1/ex5-guaB-2, ex5-guaA-1/ex5-guaA-2, and ex5-gmk-1/ex5-gmk-2. The Pr and PvegI promoter were cloned from the genome of B. subtilis R and B.subtilis 168 with the primer pairs Pr-(ribA)-2/ph13-pr and ex5-PvegI-1/ex5-PvegI-2, respectively. The vector was amplified by PCR using primer pair pHP13-1/pHP13-2. The fragments of Pr, ribA, and ndk were fused into a longer fragment F1 with primer pair ph13-pr/ex5-ndk-2. And fragments of guaB, guaA, and gmk were fused into a longer fragment F2 with primer pair ex5-guaB-1/ex5-gmk-2. The F1, F2, and pHP13(spe) fragments were assembled using the Clon Expressmulti kit (Vazyme, Nanjing, China).
Measurement of cell density and Riboflavin Titers
During fermentation, samples were taken at specific times to measure the cell growth and riboflavin production. The fermentation time was extended to 48–72 h until the production is not increasing. Cell growth was monitored by measuring the optical density (OD) at 600 nm. Determination and calculation of riboflavin concentration was performed as previous paper with some modifications [53]. Culture samples were diluted with 0.1 M NaOH to the linear range of the MAPADA V-1600 spectrophotometer (MAPADA, Shanghai, China). After dissolving for 20 min, 1 mL of the sample was centrifuged at 10,000 g for 2 min to remove the cells and other insoluble substances. Then the absorbance at 444 nm was immediately measured. The riboflavin concentration was calculated using a standard equation. All the fermentation experiments were performed in triplicates, and the reported results represented the average of three independent experiments.
Optimization of Fermentation Medium compositions
To explore the interactions and determine the precise levels of media compositions, including yeast extract, corn steep powder, and (NH4)2SO4, significantly influencing riboflavin production, we employed a Box-Behnken design for 3 variables at three levels (+ 1, 0, and − 1). This optimization method aimed to maximize riboflavin production by BSRE4/pMX45, building upon the insights gained from one-factor-at-a-time experiments [54]. The statistical matrix encompassed 14 experimental runs to fit the response surface, as detailed in Table 3, presenting the variables, their values, and the experimental design.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
Not applicable.
Abbreviations
- Ru5P
Ribose-5-phosphate
- R5P
Ribose-5-phosphate
- PRPP
5-phospho-α-D-ribosyl-1-pyrophosphate
- IMP
inosine mono-phosphate
- XMP
xanthosine monophosphate
- GMP
guanosine mono-phosphate
- GTP
guanosine tri-phosphate
- AMP
adenosine mono-phosphate
- DARPP
2,5-diamino-6-ribosylamino-4(3 H)-pyrimidinone-5′-phosphate
- ARPP
5-amino-6-(5′-phosphoribosylamino)uracil
- ArPP
5-amino-6-(5′-phosphoribitylamino)uracil
- ArP
4-(1-D-ribitylamino)- 5-amino-2,6-dihydroxypyrimidine
- DHPB
3,4- dihydroxy-2-butanone 4-phosphate
- DRL
6,7- dimethyl-8-ribityl-lumazine
- PCR
Polymerase chain reaction
- DR
direct repeat
- Nm
neomycin
- Cm
chloramphenicol
- Ery
erythromycin
- Spe
erythromycin
Author contributions
DWZ designed the research. CL designed the experiment. CL, FX, and SJW performed the fermentations, and constructed the strains under the guidance of MMX. CL provided ideas for the study, and drafted and revised the manuscript. FX and SJW analyzed the experimental data. All authors read and approved the final manuscript. MMX and CL contributed to the work equally and should be regarded as co-first authors.
Funding
This work was supported by the National Key R&D Program of China (2021YFC2100700), National Natural Science Foundation of China (22178372), Tianjin Synthetic Biotechnology Innovation Capacity Improvement Project (TSBICIP-KJGG-011, TSBICIP-CXRC-055). Yellow River Delta Industry Leading Talents (No.DYRC20190212).
Data availability
and supporting materials.
All data generated and analyzed during this study are included in this manuscript and in its Supplemental Table.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Von MJ, Bourgonje AR, Klaassen MAY, Alkhalifah HAA, Sadaghian SM, Vich V, Gacesa R, Gabriëls RY, Steinert RE, Jansen BH, Bulthuis MLC, Visschedijk VDHM, Festen MC, Weersma EAM, de Vos RK, Van P, Faber GH, Harmsen KN, Dijkstra HJM. Riboflavin supplementation in patients with Crohn’s disease [the RISE-UP study]. J Crohns Colitis. 2020 Jun;14:595–607. [DOI] [PMC free article] [PubMed]
- 2.Suwannasom N, Kao I, Pruß A, Georgieva R, Bäumler H. Riboflavin: the health benefits of a forgotten natural vitamin. Int J Mol Sci. 2020 Jan;21:950. [DOI] [PMC free article] [PubMed]
- 3.Bampidis V, Azimonti G, Bastos ML, Christensen H, Dusemund B, Fašmon Durjava M, Kouba M, López-Alonso M, López Puente S, Marcon F, Mayo B, Pechová A, Petkova M, Ramos F, Sanz Y, Villa RE, Woutersen R, Anguita M, Galobart J, Manini P, Pettenati E, Pizzo F. Safety and efficacy of a feed additive consisting of riboflavin-5’-phosphate ester monosodium salt (vitamin B2) (from riboflavin 98%, produced by Bacillus subtilis KCCM 10445) for all animal species (Hubei Guangji Pharmaceutical Co. Ltd). EFSA J. 2022 Nov;20:11.
- 4.Abbas CA, Sibirny AA. Genetic control of biosynthesis and transport of riboflavin and flavin nucleotides and construction of robust biotechnological producers. Microbiol Mol Biol Rev. 2011;75:321–60. doi: 10.1128/MMBR.00030-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Schwechheimer SK, Park EY, Revuelta JL, Becker J, Wittmann C. Biotechnology of Riboflavin. Appl Microbiol Biotechnol. 2016;100:2107–19. doi: 10.1007/s00253-015-7256-z. [DOI] [PubMed] [Google Scholar]
- 6.Balasubramaniam S, Christodoulou J, Rahman S. Disorders of Riboflavin metabolism. J Inherit Metab Dis. 2019;42:608–19. doi: 10.1002/jimd.12058. [DOI] [PubMed] [Google Scholar]
- 7.Kil YV, Mironov VN, Gorishin IYu, Kreneva RA, Perumov DA. Riboflavin operon of Bacillus subtilis: unusual symmetric arrangement of the regulatory region. Mol Gen Genet. 1992;233:483–6. doi: 10.1007/BF00265448. [DOI] [PubMed] [Google Scholar]
- 8.Worst DJ, Gerrits MM, Vandenbroucke-Grauls CM, Kusters JG. Helicobacter pylori ribBA-mediated riboflavin production is involved in iron acquisition. J Bacteriol. 1998;180:1473–9. doi: 10.1128/JB.180.6.1473-1479.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Sibirnyĭ AA, Shavlovskiĭ GM, Ksheminskaia GP. Effect of glucose and its derivatives on systems of riboflavin uptake and excretion in the yeast Pichia guilliermondii. Biokhimiia. 1978;43:1414. [PubMed] [Google Scholar]
- 10.Hu YG, Yang MY, Liu YM, Zhou XT. Method for increasing yield of Bacillus subtilis vitamin B2. CN109134468A 2019.
- 11.Christopher MF, Sébastien EP, Zoltán P, Michael PA. Improve production of Riboflavin. WO2020099303; 2020.
- 12.Zhang GY, Chen Y. Vitamin B2 high-yield bacterial strain and preparation method thereof. CN107475142A; 2017.
- 13.Riboflavin market - growth. trends, Covid-19 impact, and forecasts (2022–2027).https://www.mordorintelligence.com/industry-reports/riboflavin-market. Accessed 25 May 2022.
- 14.Yang B, Sun Y, Fu S, Xia M, Su Y, Liu C, Zhang C, Zhang D. Improving the production of riboflavin by introducing a mutant ribulose 5-phosphate 3-epimerase gene in Bacillus subtilis. Front Bioeng Biotechnol. 2021;9:704650. doi: 10.3389/fbioe.2021.704650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.De Wulf P, Vandamme EJ. Production of D-ribose by fermentation. Appl Microbiol Biotechnol. 1997;48:141–8. doi: 10.1007/s002530051029. [DOI] [PubMed] [Google Scholar]
- 16.Saxild HH, Brunstedt K, Nielsen KI, Jarmer H, Nygaard P. Definition of the Bacillus subtilis PurR operator using genetic and bioinformatic tools and expansion of the PurR regulon with glyA, guaC, pbuG, xpt-pbuX, yqhz-fold, and pbuO. J Bacteriol. 2001;183:6175–83. [DOI] [PMC free article] [PubMed]
- 17.Boumezbeur AH, Bruer M, Stoecklin G, Mack M. Rational engineering of transcriptional riboswitches leads to enhanced metabolite levels in Bacillus subtilis. Metab Eng. 2020;61:58–68. [DOI] [PubMed]
- 18.Smith JL, Zaluzec EJ, Wery J-P, Niu L, Switzer RL, Zalkin H, Satow Y. Structure of the allosteric regulatory enzyme of purine biosynthesis. Science. 1994;264:1427–33. [DOI] [PubMed]
- 19.Shi T, Wang Y, Wang Z, Wang G, Liu D, Fu J, Chen T, Zhao X. Deregulation of purine pathway in Bacillus subtilis and its use in riboflavin biosynthesis. Microb Cell Fact. 2014;13:101. [DOI] [PMC free article] [PubMed]
- 20.Sun Y, Liu C, Tang W, Zhang D. Manipulation of purine metabolic networks for riboflavin production in Bacillus subtilis. ACS Omega. 2020;5(29140–2914620):1085–93. doi: 10.1021/acsomega.0c03867. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V, Bertero MG, Bessières P, Bolotin A, Borchert S, Borriss R, Boursier L, Brans A, Braun M, Brignell SC, Bron S, Brouillet S, Bruschi CV, Caldwell B, Capuano V, Carter NM, Choi SK, Cordani JJ, Connerton IF, Cummings NJ, Daniel RA, Denziot F, Devine KM, Düsterhöft A, Ehrlich SD, Emmerson PT, Entian KD, Errington J, Fabret C, Ferrari E, Foulger D, Fritz C, Fujita M, Fujita Y, Fuma S, Galizzi A, Galleron N, Ghim SY, Glaser P, Goffeau A, Golightly EJ, Grandi G, Guiseppi G, Guy BJ, Haga K, Haiech J, Harwood CR, Hènaut A, Hilbert H, Holsappel S, Hosono S, Hullo MF, Itaya M, Jones L, Joris B, Karamata D, Kasahara Y, Klaerr-Blanchard M, Klein C, Kobayashi Y, Koetter P, Koningstein G, Krogh S, Kumano M, Kurita K, Lapidus A, Lardinois S, Lauber J, Lazarevic V, Lee SM, Levine A, Liu H, Masuda S, Mauël C, Médigue C, Medina N, Mellado RP, Mizuno M, Moestl D, Nakai S, Noback M, Noone D, O’Reilly M, Ogawa K, Ogiwara A, Oudega B, Park SH, Parro V, Pohl TM, Portelle D, Porwollik S, Prescott AM, Presecan E, Pujic P, Purnelle B, Rapoport G, Rey M, Reynolds S, Rieger M, Rivolta C, Rocha E, Roche B, Rose M, Sadaie Y, Sato T, Scanlan E, Schleich S, Schroeter R, Scoffone F, Sekiguchi J, Sekowska A, Seror SJ, Serror P, Shin BS, Soldo B, Sorokin A, Tacconi E, Takagi T, Takahashi H, Takemaru K, Takeuchi M, Tamakoshi A, Tanaka T, Terpstra P, Togoni A, Tosato V, Uchiyama S, Vandebol M, Vannier F, Vassarotti A, Viari A, Wambutt R, Wedler H, Weitzenegger T, Winters P, Wipat A, Yamamoto H, Yamane K, Yasumoto K, Yata K, Yoshida K, Yoshikawa HF, Zumstein E, Yoshikawa H, Danchin A. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature. 1997, 390: 249 – 56. [DOI] [PubMed]
- 22.Karp PD, Billington R, Caspi R, Fulcher CA, Latendresse M, Kothari A, Keseler IM, Krummenacker M, Midford PE, Ong Q, Ong WK, Paley SM, Subhraveti P. The BioCyc collection of microbial genomes and metabolic pathways. Brief Bioinform 2019. [DOI] [PMC free article] [PubMed]
- 23.Terakawa A, Natsume A, Okada A, Nishihata S, Kuse J, Tanaka K, Takenaka S, Ishikawa S, Yoshida KI. Bacillus subtilis 5’-nucleotidases with various functions and substrate specificities. BMC Microbiol. 2016;16:249. doi: 10.1186/s12866-016-0866-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Humbelin M, Griesser V, Keller T. GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone 4-phosphate synthase are rate-limiting enzymes in riboflavin synthesis of an industrial Bacillus subtilis strain used for riboflavin production. J Ind Microbiol Biotechnol. 1999;22:1–7. doi: 10.1038/sj.jim.2900590. [DOI] [Google Scholar]
- 25.Xia MM, Liu L, Ban R. The genetic modification effect of rib operon and ribC gene in Bacillus subtilis. Microbiol China. 2014;42:9–16. [Google Scholar]
- 26.Willenbacher J, Mohr T, Henkel M, Gebhard S, Mascher T, Syldatk C, Hausmann R. Substitution of the native srfA promoter by constitutive Pveg in two B. subtilis strains and evaluation of the effect on surfactin production. J Biotechnol. 2016;224:14–7. doi: 10.1016/j.jbiotec.2016.03.002. [DOI] [PubMed] [Google Scholar]
- 27.Peter H, Sierd B, Gerard V. The effect of restriction on shotgun cloning and plasmid stability in Bacillus subtilis Marburg. Mol Gen Genet. 1987;209:335–42. doi: 10.1007/BF00329663. [DOI] [PubMed] [Google Scholar]
- 28.Liu S, Hu W, Wang Z, Chen T. Rational Engineering of Escherichia coli for High-Level production of Riboflavin. J Agric Food Chem. 2021;69:12241–9. doi: 10.1021/acs.jafc.1c04471. [DOI] [PubMed] [Google Scholar]
- 29.Rinas U, Hellmuth K, Kang R, Seeger A, Schlieker H. Entry of Escherichia coli into stationary phase is indicated by endogenous and exogenous accumulation of nucleobases. Appl Environ Microbiol. 1995;61:4147–51. doi: 10.1128/aem.61.12.4147-4151.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Grifantini R, Toukoki C, Colaprico A, Gryllos I. Peroxide stimulon and role of PerR in group a Streptococcus. J Bacteriol. 2011;193:6539–51. doi: 10.1128/JB.05924-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yang S, Cao Y, Sun L, Li C, Lin X, Cai Z, Zhang G, Song H. Modular pathway engineering of Bacillus subtilisto promote de novo biosynthesis of menaquinone-7. ACS Synth Biol. 2019;8(1):70–81. doi: 10.1021/acssynbio.8b00258. [DOI] [PubMed] [Google Scholar]
- 32.Janek T, Gudiña EJ, Połomska X, Biniarz P, Jama D, Rodrigues LR, Rymowicz W, Lazar Z. Sustainable surfactin production by Bacillus subtilis using crude glycerol from different wastes. Molecules. 2021;8:3488. doi: 10.3390/molecules26123488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wu L, Li Z, Ye Q. Enhanced D-ribose biosynthesis in batch culture of a transketolase-deficient Bacillus subtilis strain by citrate. J Ind Microbiol Biotechnol. 2009;36:1289–96. doi: 10.1007/s10295-009-0612-1. [DOI] [PubMed] [Google Scholar]
- 34.Mohamed H, Awad MF, Shah AM, Sadaqat B, Nazir Y, Naz T, Yang W, Song Y. Coculturing of mucor plumbeus and Bacillus subtilis bacterium as an efficient fermentation strategy to enhance fungal lipid and gamma-linolenic acid (GLA) production. Sci Rep. 2022;12:13111. doi: 10.1038/s41598-022-17442-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zhang K, Tan R, Yao D, Su L, Xia Y, Wu J. Enhanced production of soluble pyrococcus furiosus α-Amylase in Bacillus subtilis through chaperone co-expression, heat treatment and fermentation optimization. J Microbiol Biotechnol. 2021;31:570–83. doi: 10.4014/jmb.2101.01039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Lin W, Li L, Jing Y, Liu XL. Study on compositions and antioxidant activity of corn steep liquor. Food Ind. 2018;39:173–5. [Google Scholar]
- 37.Chen J, Wang Z. The reason for the low content of flavor enhancer (5’-GMP) in the yeast extract RNA degradation properties in yeast autolysis. Shi Pin Ke Xue. 2003;25:103–5. [Google Scholar]
- 38.You J, Yang C, Pan X, Hu M, Du Y, Osire T, Yang T, Rao Z. Metabolic engineering of Bacillus subtilis for enhancing riboflavin production by alleviating dissolved oxygen limitation. Bioresour Technol. 2021;333:125228. doi: 10.1016/j.biortech.2021.125228. [DOI] [PubMed] [Google Scholar]
- 39.Wray LV, Jr, Zalieckas JM, Fisher SH. Bacillus subtilis glutamine synthetase controls gene expression through a protein–protein interaction with transcription factor TnrA. Cell. 2001;107:427–35. doi: 10.1016/S0092-8674(01)00572-4. [DOI] [PubMed] [Google Scholar]
- 40.Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y. Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Mol Microbiol. 2003;49:157–65. doi: 10.1046/j.1365-2958.2003.03567.x. [DOI] [PubMed] [Google Scholar]
- 41.Travis BA, Peck JV, Salinas R, Dopkins B, Lent N, Nguyen VD, Borgnia MJ, Brennan RG, Schumacher MA. Molecular dissection of the glutamine synthetase-GlnR nitrogen regulatory circuitry in Gram-positive bacteria. Nat Commun. 2022;13:3793. doi: 10.1038/s41467-022-31573-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Belitsky BR, Wray LV, Jr, Fisher SH, Bohannon DE, Sonenshein AL. Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. J Bacteriol. 2000;182:5939–47. doi: 10.1128/JB.182.21.5939-5947.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Jin P, Liang Z, Li H, Chen C, Xue Y, Du Q. Biosynthesis of low-molecular-weight mannan using metabolically engineered Bacillus subtilis 168. Carbohydr Polym. 2021;251:117115. doi: 10.1016/j.carbpol.2020.117115. [DOI] [PubMed] [Google Scholar]
- 44.Zhang L, Wang H, Zhou Z, Du G, Chen J, Kang Z. Optimization of heparosan synthetic pathway in Bacillus subtilis 168. Sheng Wu Gong Cheng Xue Bao. 2017;33:936–45. doi: 10.13345/j.cjb.160453. [DOI] [PubMed] [Google Scholar]
- 45.Park YC, Choi JH, Bennett GN, Seo JH. Characterization of D-ribose biosynthesis in Bacillus subtilis JY200 deficient in transketolase gene. J Biotechnol. 2006;121:508–16. doi: 10.1016/j.jbiotec.2005.08.003. [DOI] [PubMed] [Google Scholar]
- 46.Xu J, Wang C, Ban R. Improving riboflavin production by modifying related metabolic pathways in Bacillus subtilis. Lett Appl Microbiol. 2022;74:78–83. doi: 10.1111/lam.13584. [DOI] [PubMed] [Google Scholar]
- 47.Zhang M, Zhao X, Chen X, Li M, Wang X. Enhancement of riboflavin production in Bacillus subtilis via in vitro and in vivo metabolic engineering of pentose phosphate pathway. Biotechnol Lett. 2021;43:2209–16. doi: 10.1007/s10529-021-03190-2. [DOI] [PubMed] [Google Scholar]
- 48.Zhdanov VG, Stepanov AI. Riboflavin preparation. Patent FR2546907A1 1984.
- 49.Asahara T, Mori Y, Zakataeva NP, Livshits VA, Yoshida K, Matsuno K. Accumulation of gene-targeted Bacillus subtilis mutations that enhance fermentative inosine production. Appl Microbiol Biotechnol. 2010;87:2195–207. doi: 10.1007/s00253-010-2646-8. [DOI] [PubMed] [Google Scholar]
- 50.Wang G, Shi T, Chen T, Wang X, Wang Y, Liu D, Guo J, Fu J, Feng L, Wang Z, Zhao X. Integrated whole-genome and transcriptome sequence analysis reveals the genetic characteristics of a riboflavin-overproducing Bacillus subtilis. Metab Eng. 2018;48:138–49. doi: 10.1016/j.ymben.2018.05.022. [DOI] [PubMed] [Google Scholar]
- 51.Anagnostopoulos C, Spizizen J. Requirements for transformation in Bacillus subtilis. J Bacteriol. 1961;81:741–7. doi: 10.1128/jb.81.5.741-746.1961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Liu S, Endo K, Ara K, Ozaki K, Ogasawara N. Introduction of marker-free deletions in Bacillus subtilis using the AraR repressor and the ara promoter. Microbiology. 2008;154:2562–70. doi: 10.1099/mic.0.2008/016881-0. [DOI] [PubMed] [Google Scholar]
- 53.Himanshi S, Shraddha P, Bhavik P, Nitin S, Nurudin PJ, Digbijay BK. Development and validation of uv-visible spectrometric method for estimation of water soluble vitamin riboflavin. Int J Pharm Sci Res. 2012;3:3462–6. [Google Scholar]
- 54.Tahereh K, Mohammad JC, OmLeila N, Hamid G. Application of Box–Behnken design in the optimization of catalytic behavior of a new mixed chelate of copper (ІІ) complex in chemiluminescence reaction of luminol. J Lumin. 2011;131:838–42. doi: 10.1016/j.jlumin.2010.11.015. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
and supporting materials.
All data generated and analyzed during this study are included in this manuscript and in its Supplemental Table.







