Achillea fragrantissima (Forssk.) Sch.Bip instigates the ROS/FADD/c-PARP expression that triggers apoptosis in breast cancer cell (MCF-7)

Abdulrahman Alasmari

doi:10.1371/journal.pone.0304072

. 2024 May 31;19(5):e0304072. doi: 10.1371/journal.pone.0304072

Achillea fragrantissima (Forssk.) Sch.Bip instigates the ROS/FADD/c-PARP expression that triggers apoptosis in breast cancer cell (MCF-7)

Abdulrahman Alasmari ^1,^2,^*

Editor: Ajay Kumar³

PMCID: PMC11142488 PMID: 38820323

Abstract

Achillea fragrantissima is a shrub plant that belongs to the Asteraceae family in Arabia and Egypt. It is used as folk medicine and is a good source of phenolic acids, flavonoids, and some active compounds. To investigate the anti-cancer effect of A.fragrantissima on breast cancer MCF-7 cells and find the critical mechanism involved in apoptosis. The toxicity and pharmacokinetic studies of ethanolic extract of A.fragrantissima was examined for anti-breast cancer properties. In turn, cytotoxicity and cell viability were achieved by the MTT method. Furthermore, the trypan blue exclusion and microscopy examination proved the presence of apoptotic cells. Again, fluorescent staining such as AO/EtBr, DCFH-DA, Rho-123, and Hoechst-33342 reveals the cellular cytoplasmic disciplines upon A. fragrantissima effect. Moreover, cellular functioning tests like wound healing, colony formation, and Transwell invasion assay were demonstrated. In addition, the qRT-PCR technique authenticates the A. fragrantissima -induced apoptotic network genes (Caspase-3, Caspase-8, Caspase-9, Cytochrome c, BCL-2, BID, BAX, PARP, PTEN, PI3K, and Akt) expression were evaluated. Mainly, the Immunoblot technique proved the expressed level of apoptotic proteins such as cleaved PARP, CYCS, and FADD. This study confirmed that the A. fragrantissima exerts cytotoxicity at 20 μg/mL for 24 hrs in MCF-7 cells. Also, decreases cellular viability, producing apoptotic cells and damaged cellular surfaces with dead matter. Consequently, it creates ROS species accumulation, loss of mitochondrial membrane potential, and fragmentation of DNA in MCF-7 cells. Furthermore, it arrests cell migration, induces colony-forming ability loss, and suppresses cell invasion. In addition, A. fragrantissima significantly upregulates genes such as caspase-3, 9, cytochrome c, BID, BAX, and PTEN while downregulating the Pi3K/ Akt signaling. Nonetheless, A.fragrantissima induced cleaved PARP, CYCS, and FADD proteins in MCF-7 cells to avail apoptosis.

1. Introduction

Cancer is a significant disease in the human population, defined as the uncontrolled growth of cells with high metabolic changes. Breast cancer starts with breast tissue; In female society, it occupies the first place and surpasses lung cancer with 2.3 million new cases recorded in 2020 [1]. As of January 2022, breast cancer remains one of the most prevalent cancers globally, particularly among women. The current status of breast cancer research, diagnosis, and treatment is characterized by ongoing advancements in understanding its molecular subtypes, risk factors, and personalized therapies. Overall, breast cancer incidence rates vary across different regions and populations. Developed countries typically report higher incidence rates compared to developing countries, attributed to factors such as lifestyle, reproductive patterns, and access to healthcare. However, efforts in awareness, early detection, and improved healthcare systems have contributed to earlier diagnosis and better outcomes in many regions.

Epidemiologically, breast cancer incidence tends to increase with age, with the majority of cases diagnosed in women over 50 years old. However, it can also affect younger women, albeit less frequently. Certain risk factors have been identified, including genetic predisposition (e.g., mutations in BRCA1 and BRCA2 genes), hormonal factors (e.g., early menarche, late menopause), reproductive history (e.g., nulliparity, late age at first childbirth), lifestyle factors (e.g., alcohol consumption, obesity), and environmental exposures.

Efforts in epidemiological research aim to identify and understand these risk factors better, allowing for targeted prevention strategies and interventions. Additionally, ongoing research into the molecular mechanisms underlying breast cancer development and progression informs the development of novel therapies, including targeted therapies and immunotherapies, which hold promise for improving survival rates and quality of life for patients. Overall, while breast cancer remains a significant public health concern, progress in research, early detection, and treatment continues to improve outcomes for individuals diagnosed with the disease. Continued efforts in prevention, screening, and access to care are crucial in reducing the burden of breast cancer worldwide.

Apoptosis can be defined as cellular death and termed “Programmed Cell Death,” It may lead by the Fas-associated death domain protein (29 KDa). It is a cytoplasmic adaptor molecule capable of transferring the apoptosis signal transduction to the caspase cascade [2, 3] and overexpression of FADD induces cell apoptosis in lung cancer cells [4].

Cellular apoptosis is a complex process and takes place in numerous proteolytic enzymes in action. Cellular apoptosis depends on the upregulation of the apoptosis gene and the downregulation of anti-apoptotic genes. In other words, upregulation of tumor suppressors or significant expression of pro-apoptotic genes in the cells [5].The mitochondria play a regulatory role in the intrinsic apoptotic pathway combined with the anti-apoptotic and pro-apoptotic proteins. The alteration of these proteins helps the oligomerization between Bax/ Bak proteins to form a hole in the outer membrane of the mitochondria to release the cytochrome c molecule as a hallmark of apoptosis [5]. In addition, numerous cellular signalings such as MAPK, Akt, ERK, and NF-κB help the cellular survive under toxic or oxidative cellular stresses [6, 7]. Modern research is turned into traditional herbal medicine or phytochemicals from edible sources for targeting cancer cells, activating cell apoptosis via different targeting of cellular signaling [8].

Achillea fragrantissima is a shrub plant known as lavender cotton [9] belonging to the achillea genus classified under the Asteraceae family, and it was used as folk medicine in Middle Eastern populations, particularly in Saudi Arabia [10, 11]. This herbal plant is used against many illnesses, including nasal infections, vision problems, viral infections (smallpox), fatigue, intestinal obstruction, fever, diabetes, and dysmenorrhea [10, 12].However, the anti-cancer property of this herb is understudied, and we assumed that A. fragrantissima ethanolic extraction could be an antagonistic factor for breast cancer. The ethanolic extract of A.fragrantissima includes bioactive compounds such as Phenolic Compounds (flavonoids and phenolic acids), Terpenoids (sesquiterpenes and triterpenes), Alkaloids, Essential Oils (camphor, borneol, and eucalyptol), Tannins, and Acetylenes.

Herein, this study adopted MCF-7 cells to evaluate the cytotoxicity, cell viability, cell migration, cell invasion, and genes involved in apoptosis under the ethanolic extract of A. fragrantissima. The obtained data from MTT analysis proved that A. fragrantissima causes cytotoxicity and decreases cell viability. Further, DCFH-DA, Rho-123, and Hoechst analysis confirmed the generation of intracellular ROS, loss in mitochondria potential, and fragmented DNA, respectively. Furthermore, wound healing and transwell assay proved the reduction of cell migration and invasion in MCF-7 cells. Finally, the qRT-PCR and immunoblot data manifest evidence of induced apoptosis in MCF-7 cells. Taken together, A. fragrantissima could induce apoptosis in breast cancer MCF-7 cells, and these findings may be used in future cancer therapeutic studies.

2. Materials and methods

2.1. Chemical

The DMEM medium, Fetal Bovine Serum, and antibiotics were purchased from Himedia, Mumbai (India). Dyes such as Acridine orange, Ethidium Bromide, DCFH-DA, Rho-123, and Hoechst (33342) are procured from the Thermo Fisher Scientific Company (USA). All antibodies were procured from cell signaling technologies, USA.

2.2. Plant Collection, Identification, and extract preparation

In this study, A. fragrantissima plant ethanol extract was used to detect the apoptotic nature on MCF-7 cells. The mature A. fragrantissima plant leaves were collected in Tabuk, Saudi Arabia, and the prepared herbarium was identified and authenticated by Dr. Jacob Thomas, Taxonomist, Department of Botany and Microbiology, Riyadh, Saudi Arabia. The plant leaves were dried under dark conditions for seven days and were ground as a fine powder. The soxhlet apparatus was used to isolate the ethanol extract using 100 grams of fine leaves powder. The collected liquid was lyophilized and stored under -80°C until further use.

2.3. Cell culture

The human breast cancer MCF-7 cells and human embryonic kidney normal HEK-293 cells were purchased from American Type of Cell Culture (ATCC), USA. Cells were grown under DMEM with 10% FBS (V/V) and 1% penicillin/ streptomycin (W/V). The subculturing of cells was maintained at 5% CO₂ and 95% humidified atmosphere at 37° C. The fresh cultured cells were used for further experiments.

2.4. MTT assay

To determine the IC₅₀ value of the ethanol extract of A. fragrantissima, the MTT method was adopted. In brief, 1× 10⁴ cells of MCF-7 and HEK-293 were seeded in 96 multi-well plates overnight. The next day, the old medium was aspirated with a new fresh medium with differenced concentrated A. fragrantissima extracts. Then, the system was allowed for the next 24 hrs. Further, at the end of incubation, 20 μl of MTT substrate (5 mg/ 1 mL of 1× PBS) was added to each well and allowed for 4 hours. Then, the purple formazan crystal was diluted by adding 200 μl of DMSO. Finally, the plate was subjected to a multi-well plate reader at 595 nm. The cell viability graph was obtained by following the formula, % of cell viability = OD of the sample/ OD of the control [13].

2.5. Examination of apoptotic cells by trypan blue exclusion method

For the assessment of apoptotic cells, the study conducted the trypan blue exclusion assay. Briefly, MCF-7 cells were seeded (1×10⁵ cells) on six-well plates and treated with A. fragrantissima for 24 hrs. The next day, cells were trypsinized and pellet. The harvested cell was subjected to cell counting using trypan blue on the cell counting chamber. The apoptotic cells were counted, and the apoptotic graph was plotted.

2.6. Cell viability

To test the viability nature of cells under A. fragrantissima, we used the MTT method for calculating cell viability. Different concentrations (0, 20, and 40 μg) of A.fragrantissima and time intervals (0, 12, 24, and 48 hrs) were utilized to affirm cell viability (Mosmann, 1983).

2.7. Phase-contrast microscopic examination

The phase-contrast microscopic analysis was used to identify the cells’ morphological disturbance. In turn, cells were treated with a respective concentration of A. fragrantissimafor intimated hours. Finally, the plate was analyzed under Accu-Scope microscopy, Life Technology, USA. The photographs were documented using a 20× magnification field.

2.8. Live/ dead assay (AO/EtBr staining)

The impact of A. fragrantissima was checked by analyzing the Live/Dead material under fluorescence microscopy. Briefly, 1×10⁵ MCF-7 cells were seeded on six-well plates and allowed to overnight for maturation. Further, cells were treated with A.fragrantissima for 24 hrs. After the treatment, cells were incubated with AO/EtBr dual staining solution for 10 min in a dark room. Then the plate was analyzed under fluorescence microscopy at the magnification field of 20× (Accu-Scope, EXI-310, USA), and images were documented.

2.9. Determination of reactive oxygen species

For the determination of intra-cellular generated ROS, the DCFH-DA dye method was performed. First, MCF-7 cells were seeded on the six-well plate (1× 10⁵ cells). After the maturation of cells, the cells were incubated under the A. fragrantissima for 24 hrs based on the IC₅₀ value. At the end of treatment, the plate was carefully processed by adding DCFH-DA solution and allowed for 30 minutes under darkroom conditions. Further, a liquid layer was removed, and the plate was analyzed under a green filter using Accu-Scope, EXI-310, USA. Finally, the captured images were documented. For spectroflurometer analysis, treated cells were detached and stained with DCFH-DA for 30 min and cells were resuspended with 1×PBS and subjected to Spectroflurometer examination. The OD values were recorded.

2.10. Mitochondrial membrane potential (Rho-123)

For the detection of the healthy mitochondria (ΔΨm), we moved to examine the mitochondrial membrane potential by the Rho-123 staining. Briefly, 1× 10⁵ MCF-7 cells were plated in a six-well plated and treated with or without A. fragrantissima for 24 hrs. At the end of the treatment, the cells were washed with 1× PBS and stained with Rho-123. Continuously, the plate was placed under dark conditions for 15 minutes. After that, the excess dye was removed, and the plates were analyzed under green light. Fluorescence microscopy captured the images and documents (Accu-Scope, EXI-310, USA).

2.11. Nuclear fate (Hoechst-33342)

For the detection of fragmented DNA, we used Hoechst (33342) staining method. Briefly, the MCF-7 cells were seeded on six-well plates and placed overnight in an incubator. The next day, cells were treated with or without A. fragrantissima for 24 hrs. Further, the plate was processed for the next, incubated with Hoechst dye for 15 minutes under dark conditions. Afterward, the plate was examined under a blue filter with a 20× magnification field (Accu-Scope, EXI-310, USA).

2.12. Wound healing assay

For the analysis of cell migration properties, we performed a wound-healing assay. First, we cultured a good monolayer of MCF-7 cells on the six-well plates. Based on that, the monolayer was wounded by a sterile pipette tip (p-10); afterward, the respective concentration of A. fragrantissima was added. Finally, and started the image documentation time-dependent using Accu-Scope, EXI-310, USA.

2.13. Matrigel-coated transwell assay

To test cell invasion properties, the matrigel-coated Transwell migration insert chamber was used. Briefly, the matrigel (2mg/ mL, BD Biosciences) was coated on the upper part of the chamber. The MCF-7 cells were seeded on top of matrigel, and it was treated with A. fragrantissima. Meantime the treatment hour, 10% FBS was added bottom of the chamber. The invaded cells from the upper part of the chamber were fixed with methanol for 20 minutes. The fixed cells are stained with 0.1% crystal violet solution. The invaded cells are counted by light microscopy at a 20× magnification field [14].

2.14. Colony formation assay

The colony-forming ability played a vital role in cell migration ability of cancer cells. Considering this, we performed colony formation by crystal violet staining. After exposure to A. fragrantissima; cells were collected and re-cultured for 15 days without any disturbance. Further, those colonies are stained with 0.1% crystal violet staining and counted. Finally, the graph was plotted.

2.15. qRT-PCR analysis

The qRT-PCR analysis determined the apoptotic network gene expressions. The A. fragrantissima-treated and non-treated cells were used to isolate the total RNA using the TRIZOL method. The 2μg of total RNA was used to construct the cDNA (cDNA synthesis kit, TAKARA, 6110A), and the syber green solution was used to find the specific gene expression (Used primers listed in Table 1). The β-Actin levels were utilized as the internal control. The relative quantitative gene expression was calculated by the 2-^ΔΔct method.

Table 1. Primers were used in this study.

S. No	Gene	Forward primer	Reverse Primer
1	Actin-B	`F:5’-TGAAGGCTTTTGGTCTCCCTG -3’`	`R:5’-ACAAAGTCACACTTGGCCTCA -3’`
2	Caspase-3	`F:5’-TCCTAGCGGATGGGTGCTAT -3’`	`R:5’-CTCACGGCCTGGGATTTCAA -3’`
3	Caspase-8	`F:5’-TTCAGACTGAGCTTCCTGCC -3’`	`R:5’-GACCAACTCAAGGGCTCAGG -3’`
4	Caspase-9	`F:5’-AGGCCCCATATGATCGAGGA -3’`	`R:5’-GGCCTGTGTCCTCTAAGCAG -3’`
5	BCL2	`F:5’-F-AAAAATACAACATCACAGAGGAAGT -3’`	`R:5’-GTTTCCCCCTTGGCATGAGA -3’`
6	Bax	`F:5’-GGAGCAGCCCAGAGGC -3’`	`R:5’-TTCTTGGTGGACGCATCCTG -3’`
7	BID	`F:5’-TGGGAGACGCTGCCTCG -3’`	`R:5’-GGAACCGTTGTTGACCTCAC -3’`
8	CYCS	`F:5’-TCGTTGTGCCAGCGACTAAA -3’`	`R:5’-ACCATGGAGATTTGGCCCAG -3’`
9	PTEN	`F:5’- AGGGACGAACTGGTGTAATGA -3’`	`R:5’- GGGAATAGTTACTCCCTTTTTGTCT -3’`
10	PI3K	`F:5’-CCCGATGCGGTTAGAGCC -3’`	`R:5’-TGATGGTCGTGGAGGCATTG -3’`
11	Akt	`F:5’-CAGGATGTGGACCAACGTGA -3’`	`R:5’-AAGGTGCGTTCGATGACAGT -3’`
12	PARP	`F:5’-CGCCTGTCCAAGAAGATGGT -3`	`R:5’-CTGACTCGCACTGTACTCGG -3’`

Open in a new tab

2.16. Immunoblot analysis

In the determination of specific protein expression, this study adopted immunoblot analysis. Briefly, cells were treated with or without an IC₅₀ value of A. fragrantissima and the whole cellular protein were isolated by the RIPA buffer method. Then, the protein was quantified using Lowry’s method [15]. Finally, an equal concentration of protein was loaded on SDS-PAGE gel for protein separation. Then the gel was subjected to the protein transfer method using the nitrocellulose membrane. After that, the membrane was incubated with a specific primary antibody overnight. Then, the membrane was incubated with a secondary antibody for 4 hours. Finally, after a gentle wash, the membrane was allowed to react with BCIP/NBT substrate for a minute. A blots scanner documented the developed band.

2.17. Statistical analysis

All obtained results were presented as mean ± SD. p-value was considered statistically significant when p< 0.05, ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05 and ns. One-way and Two-ANOVA were performed to find the significance between the groups.

3. Results

3.1. Achillea fragrantissima induces cytotoxicity in MCF-7 and HEK-293 cells

This study adopted the breast cancer cell MCF-7 and normal HEK-293 cells to explore the cytotoxicity nature of A. fragrantissima. The 24 hrs experimental times revealed that the A. fragrantissima induces the 50% cell death at 20 μg/ mL in MCF-7 cell. Moreover, the increasing concentration of extracts significantly induces cytotoxicity in MCF-7 cells, as shown in Fig 1A. Further, HEK-293 cells exhibited the IC₅₀ value at 30 μg/ mL at 24 hrs Fig 1B. The obtained data from the MTT method depicts that the A. fragrantissima is more toxic to breast cancer cells (MCF-7) than normal cells, and MCF-7 cells are subjected to further experiments in this study.

Fig 1 — **a and b)** Show that *achillea fragrantissima* induced cell cytotoxicity in breast cancer (MCF-7) and normal cells (HEK-293), respectively. c) Shows the production of dead cells beneath *achillea fragrantissima* administrated. d) The graph illustrates the *achillea fragrantissima*-induced decrease of cell viability in MCF-7 cells at different time intervals. e) Shows the spectrofluorimeter analysis of the intracellular generation of ROS in MCF-7 cells. f) The images represent the *achillea fragrantissima* caused cellular structural damages in MCF-7 cells with differenced magnification. Values denoted mean ± SD for three independent performings (n = 3). Values are statistically significant at *** P<0.0001, ** P<0.01, and ns. (0.05 Two Way ANOVA/ Turkey test).

3.2. Achillea fragrantissima produces apoptotic cells

The apoptotic nature of MCF-7 cells was studied under the administration of A.fragrantissima through trypan blue exclusion method. The trypan blue exclusion assay data states that the concentration of A.fragrantissima increases; it induces apoptotic cells in a time-dependent manner. The 24 and 48 hrs death curves were higher than 0 hrs. The obtained data judged that increasing time produces apoptosis in MCF-7 under A.fragrantissima administration (Fig 1C).

3.3. Achillea fragrantissima decreases cell viability in MCF-7 cells

The cell viability was checked by the MTT method through different experimental times. The results revealed that the selected concentration of A.fragrantissima significantly reduced the viability power of MCF-7 cells by increasing experimental time and concentrations. Altogether, data suggested that the administration of A.fragrantissima is toxic to the MCF-7 cells, as shown in Fig 1D.

3.4. Achillea fragrantissima generates intracellular ROS

Cellular signaling is regulated mainly by the amount of produced ROS within the cellular cytoplasm of cells. Hence, we analyzed the intracellular ROS with a spectrofluorimeter. The results confirm that the A.fragrantissima triggers the intra-cellular ROS species in MCF-7 cells while increasing experimental time, as shown in Fig 1E. The obtained result clearly shows the A.fragrantissima induces the ROS accumulation in the cytoplasm of MCF-7 cells as result it may involve in the upregulation or downregulation of cellular function.

3.5. Achillea fragrantissima disturbs the morphology of MCF-7 monolayer

Morphology assessments of MCF-7 cells were documented after being treated with A.fragrantissima. The obtained images enforced that the control cells reflect good morphology and an increased number of cells. Meanwhile, the treated cells impair cell propagation and rupture the cell surface. The microscopic examination confirms that the A.fragrantissima more vulnerable effect on the MCF-7 morphology (Fig 1F).

3.6. Achillea fragrantissima instigates dead cells and ROS in MCF-7 cells

To enumerate cellular disciplines such as live/dead cells and intracellular ROS, we performed the AO/EtBr and DCFH-DA analysis by fluorescence microscopy. Briefly, Fig 2 AO/EtBr, i) showed excellent morphology and compact nuclei with significant emission of green light rather than red light. Fig 2 AO/EtBr, ii) reflects the weekend morphology with disturbed nuclei. Green and red color emissions were observed during the morphology examination. Moreover, DCFH-DA analysis depicts that the A.fragrantissima induces a higher level of ROS species in the treated MCF-7 when compared with the control MCF-7 cells. The control cells emitted a low level of green light Fig 2 DCFH-DA, i and ii). The obtained data shows the A.fragrantissima can induce ROS species to produce dead cells in the MCF-7 cultures.

Fig 2 — **AO/EtBr, i and ii)** Images reveal the MCF-7 morphological changes by the dual staining (AO/EtBr) method. Control cells exhibit green emission along with compact nuclei as well as good morphology of cytoplasm. On the contrary, *achillea fragrantissima*-treated cells exhibit red emission, shrinkage, loss of cell membrane potential, damaged nuclei, and monolayer cellular destruction. **ROS, i and ii)** Explain the higher intracellular generation of ROS in *achillea fragrantissima* -treated MCF-7 cells when compared to non-treated cells. **Rho-123, i and ii)** The Figure illustrates the mitochondrial membrane potential of MCF-7 after the *achillea fragrantissima* treatment. The *achillea fragrantissima*-treated cells exhibit the loss of mitochondrial membrane potential when considered to control MCF-7 cells. **Hoechst, i, and ii)** The images represent the nuclear fate of MCF-7 cells under *achillea fragrantissima* treatment. Treated cells are accounted for the loss of nuclear membrane potential and disruption in nuclear integrity with enormous emission of blue emission. In the case of control cells, mild blue emission was documented. All images were snapped by 20× magnification using 125 μm.

3.7. Achillea fragrantissima impacts mitochondrial health and DNA fragmentation in MCF-7 cells

The mitochondrial membrane potential plays an essential role in cellular energy production in cells. Keeping this in mind, we performed the Rho-123 staining to understand the effect of A.fragrantissima on mitochondria. The analyzed results explore the control cells emitting a significantly higher green emission than the treated MCF-7 cells. We assume that A.fragrantissima reduced the mitochondria’ health and paved the way for energy depletion in the A.fragrantissima-treated MCF-7 cells (Fig 2 Rho-123, i and ii). Next, DNA integrity was cross-checked by the Hoechst-33342 staining method. Control MCF-7 cells do not emit blue light significantly, as they are compact nuclei and undamaged parts of the cells; control cells nucleus are does not loss their potential of neuclar envelop. In the case of treated cells, it emits blue light gratefully. By the observation, we judged that A.fragrantissima accelerated the DNA fragmentation in MCF-7 cells (Fig 2 Hoechst-33342, i and ii).

3.8. Achillea fragrantissima inhibits cell migration in MCF-7 cells

To investigate the effect of A.fragrantissima on cellular migrationwound healing assay was performed in MCF-7 cells in vitro. As shown in Fig 3A and 3B, wound healing properties were diminished in the treated group. But control cells migrated actively and covered the wounded area rapidly. During the increasing interval, cellular integrity was lost in the treated group. Total findings illustrated the loss in cellular migration in MCF-7 cells induced by A.fragrantissima. The quantification data also reflects the suppression of the cellular migration ratio in MCF-7 cells.

3.9. Achillea fragrantissima impacts on colony formation of MCF-7 cells

Tumor re-births or tumor relapse was well-associated with the production of new colonies by the cancer cells. Based on that, the study conducted the colony formation assay in MCF-7 cells in in-vitro conditions. The results revealed that control cells have more capacity to produce large colonies, while decreased colonies were observed in the treated MCF-7 cells. The results account for the A.fragrantissima has more toxicity to the ability of colony formation in MCF-7 cells (Fig 3C).

3.10. Achillea fragrantissima suppresses the cell invasion (MCF-7) in vitro

Next, the invasion property of MCF-7 cells was examined by the Transwell chamber-matrigel coated assay. It was noted that active invasion was observed in the control MCF-7 cells and A.fragrantissima significantly reduced the active invasion among the treated MCF-7 cells. The finding concluded that the invasion ability was suppressed by the A.fragrantissima administration (Fig 3D and 3E).

3.11. Achillea fragrantissima impacts on Caspase-3 expression

Caspase-3 plays a significant role in “programmed cell death” among the caspase cascade family. Hence, the study needs to check the expression level of caspase-3 mRNA under A.fragrantissima condition. The selected experimental time reveals a gradually increasing level of caspase-3 mRNA in MCF-7 cells. The real-time PCR results coincide with the increased mRNA production in 4, 8, and 12 hrs (Fig 4). Conversely, immunoblot results reveal the null expression of caspase-3 (Data not shown) due to its genetics of MCF-7 cells [16].

Fig 4 — The qRT-PCR analysis revealed that the administration of *achillea fragrantissima* in breast cancer cells (MCF-7) stimulates the production of *Caspase-3* mRNA at different hours. Values denoted mean ± SD for three independent performings (n = 3). Values are statistically significant at ** P<0.01 and ns. (0.05 Two Way ANOVA/ Dunnett’s test).

3.12. Achillea fragrantissima significantly regulates anti, pro, and apoptotic genes in MCF-7 cells

It is a well-known key point that inducing cell death in the tumor would be a survival possibility among cancer patients. Thus, the expression levels of Caspase-3, Caspase-8, Caspase-9, Cytochrome c, BCL-2, BID, BAX, PARP, E-Cadherin, PTEN, PI3K, and Akt, were analyzed by the qRT-PCR which regulates apoptosis. After the treatment (24 and 48 hrs) with A.fragrantissima, the mentioned genes were analyzed using MCF-7 genomes.

As expected, apoptotic genes such as caspase-3 and 9 mRNAs were expressed under the 24 hrs treated condition, and caspase-8 mRNA expression was downregulated. On the other hand, the anti-apoptotic BCL-2 mRNA level was significantly suppressed. Meantime, the pro-apoptotic gene BID and Bax significantly elevated and acted as the initiator for apoptosis in MCF-7 cells. Moreover, CYCS (Cytochrome c) is crucial for regulating the ETC and thus releasing denotes cellular apoptosis. Hence, we analyzed the CYCS mRNA expression. Interestingly, the A.fragrantissima induces the expression of CYCS mRNA in MCF-7 cells. Furthermore, the study examined the PARP mRNA expression under the A.fragrantissima revealed that PARP expression was non-significantly downregulated in MCF-7 cells. In addition, E-cadherin mRNA level was downregulated under-treated conditions. Finally, a tumor suppressor PTEN mRNA expression was analyzed and significantly upregulated. In contrast, the expressions of PI3K/Akt mRNAs were suppressed (Fig 5). Fig 6 authenticated the genes expressions patterns as mentioned above; more considerably the same under the 48 hrs treatment. The obtained results revealed that the A.fragrantissima possibly regulates the apoptotic network genes at the mRNA levels in MCF-7 cells.

Fig 5 — The MCF-7 cells were incubated with *achillea fragrantissima* for 24 hrs. The target mRNA such as *Caspase-3*, *Caspase-8*, *Caspase-9*, *Cytochrome c*, *BCL-2*, *BID*, *BAX*, *PARP*, *E-Cadherin*, *PTEN*, *PI3K*, and *Akt* expression was analyzed by qRT-PCR. The *β-Actin* level was utilized as an internal control. All values are represented as mean ± SD (n = 3). Statistically significant at ^# P<0.0001, *** P<0.001, ** P<0.01, * P<0.1 and ns. Statistical significance was performed by Two Way ANOVA/ Dunnett’s test.

Fig 6 — The MCF-7 cells were incubated with *achillea fragrantissima* for 48 hrs. The target mRNA such as *Caspase-3*, *Caspase-8*, *Caspase-9*, *Cytochrome c*, *BCL-2*, *BID*, *BAX*, *PARP*, *E-Cadherin*, *PTEN*, *PI3K*, and *Akt* expression was analyzed by qRT-PCR. The *β-Actin* level was utilized as the internal control. All values are represented as mean ± SD (n = 3). Statistically significant at ^# P<0.0001, *** P<0.001, ** P<0.01, * P<0.1 and ns. Statistical significance was performed by Two Way ANOVA/ Dunnett’s test.

3.13. Achillea fragrantissima triggers PARP, CYCS, Caspase-8, and FADD proteins in MCF-7 cells

Cellular apoptosis is characterized by the upregulation of proteins such as caspases, PARP cleavage, and CYCS releasing. In other words, down-regulation of anti-apoptotic proteins along with stimulation of tumor suppressor protein. Keeping this in mind, we speculated that A.fragrantissima might upregulate PARP, FADD, CYCS, and caspase-8 proteins in MCF-7 cells. In this regard, this study performed immunoblotting for specific protein detections. The blotting results confirmed that increasing time-interval produces PARP cleavage more significantly in MCF-7 cells, authenticates the cleaved portion of PARP, and helps the impairment of DNA repairing. The ETC mainly relies upon a protein called Cytochrome c, and thus expression was analyzed. The A.fragrantissima actively stimulated the release of cytoplasmic CYCS protein in MCF-7 cells. Brifly, the A.fragrantissima upregulates CYCS protein (0.4 fold) release in the 24 hrs treated cells. Continusoly, it boosts upto 0.5-fold increases while compared with the untreated MCF-7 cells. Interestingly, the caspase-8 expression was induced in a time-dependent manner translation level. The instability of caspase-8-mRNA in the control group leads to a downregulated protein level. That assumes that caspase-8 mRNA stability is boosted by the A.fragrantissima in the treated group. Deeply, under 24 hrs treatment condition induces the expression of casapase-8 protein 1.1-fold level. Moreover, 2.1-fold is increases under the 48 hrs trated MCF-7 cells. Furthermore, FADD protein expression was significantly increased by the A.fragrantissima administration as incrased fold levals of 2.6 and 2.9 in 24 and 48 hrs treated MCF-7 cells while compared with untreated cells. Total findings concluded that PARP cleavage, CYCS releasing, caspase-8, and enhanced expression of FADD authenticates the A.fragrantissima induces apoptosis in breast cancer MCF-7 cells (Fig 7).

Fig 7 — The image shows the target protein expressions of *achillea fragrantissima* treated breast cancer MCF-7 cells. The speculated proteins, such as *PARP*, *FADD*, *and CYSC* expression, were tested by the Immuno-blotting method. The *β-Actin* level was used as an internal control of the experiment. Values are represented as mean ± SD (n = 3). Statistically significant at ^# P<0.0001, *** P<0.001, ** P<0.01, * P<0.1 and ns. Statistical significance was performed by Two Way ANOVA/ Dunnett’s test.

4. Discussion

Achillea fragrantissima is a shrub plant found in regions of Arabic countries, and it was used as medicine in ancient days. Achillea is a significant genome classified under the Asteraceae family that contains over 300 species including A.fragrantissima [10, 11]. Aerial parts of this achillea were used in folk medicine in Saudi Arabia, followed by the historical hero Achilles during the A.fragrantissima Trojan war period [11]. Various studies have been performed, and it illustrates that medicinal properties such as anti-neuroinflammatory [17], anti-angiogenesis [18], anti-metastasis [18], neuroprotection [19], myorelaxant [20], anti-inflammatory [21], anti-diabetic [22, 23], anti-trypanosomal [24], anti-microbial [25, 26], anti-oxidant [27], anti-proliferation [28], pro-apoptotic [28], cytotoxicity [9, 27], and anti-cancer [29–33] effects through the difference solvent extract, prepared oil or phytochemical constituents isolation methods. Despite that, a deep mechanism needs to prove the effect of A.fragrantissima on apoptosis function.

In this study, apoptotic properties of A.fragrantissima were documented using breast cancer cell MCF-7 as a model. Indeed, we sought the apoptotic regulator expressions upon treatment of A.fragrantissima. As a continuation, the preliminary screening authenticates and notifies that increasing concentration of A.fragrantissima induces cell cytotoxicity and increases apoptotic cells in breast cancer cells. Consequently, the viability nature of the cell decreases [9, 27]. Also, the generated ROS in breast cancer cells leads the apoptosis, which was well-matched with Redza and Bates [34]. Along with this, ROS upregulated mitochondrial-mediated cell death and ER responsibility [34]. The IC₅₀ effects were cross-checked, and the findings were reflected in AO/ EtBr examination. Collectively, our preliminary results suggested that the role of A.fragrantissima on stimulation of mitochondrial-mediated cell apoptosis with collapsed cytoplasm.

Next, this study assumes the impact of mitochondria on energy production and sustainability of ATPs upon the treatment condition. Hence, the Rho-123 staining confirmed the permeabilization on the outer membrane of mitochondria and it was well-linked with apoptosis [35]. As a continuation of this exploration, the cleavage of central dogma is considered a fundamental hallmark of apoptosis [36]. Together, this evidence must disintegrate cellular morphology and pave the way for cellular dysfunction. In addition, the increased level of ROS might contribute to the loss in cell migration. This phenomenon was clarified and proved by Yang and his colleagues [37]. They characterized the upregulation of DLC1 prominently suppressing theCAV-1 in breast cancer cells. It reflected in wound healing ability loss upon treatment with CAT/H₂O₂ [37], and present findings comply with the same.

In addition, an increased amount of extracellular ATP renders the migration property and invasion ability to tumor cells in response to cell death by chemotherapeutic drugs [38]. Conversely, this study reveals that plant-based extraction could arrest the invasion traits of MCF-7 as the response to cellular apoptosis and decreased levels of cellular ATP. Moreover, theATP lacks, resulting in a decreasing amount of new colonies formation. Further, apoptosis relies upon the upregulation of pro-apoptotic genes elevation; regarding this, Bali et al.[39] performed the PCR assay among prostate cancer cells that had been treated with Achillea teretifolia. The assay revealed that BCL2, Caspase-3, and Bax genes were significantly expressed, and these findings were more clearly reflected in our present results. Activated pro-apoptotic genes might activate the Bid level, and it helps the oligomerization of Bax proteins to form the pore in the mitochondria membrane [40]and release the cytochrome c. The released cytochrome c is connected with Apaf-1 activation and theATP to form the apoptosome. Caspase cascades are activated and lead to cell apoptosis [41]. Further, the formed apoptosome might cause PARP protein cleaving and impair DNA repair. In turn, the cleaved 89 kDa PARP fragment activates the Apoptosis Induction Factor (AIF) [42]. In addition, apoptosis caused cell adhesion integrity loss, which had been notified through E- Cadherin down-regulation [43, 44]. PTEN acted as the tumor suppressor role in normal cells and conversely worked and upregulated the life span of mutant cells. The current study explores that A.fragrantissima upregulated the tumor suppressor PTEN gene and finely downregulated the PI3K/Akt mRNAs. These findings are corroborated by the previous documented report [45, 46]. In addition, over-expression of FADD instigates apoptosis through the extrinsic pathway and also regulates HCC cell apoptosis [3, 46]. A.fragrantissima significantly regulates the apoptosis in MCF-7 cells through intrinsic and extrinsic cell death factors.

The present findings illustrate that the ROS level was boosted by the A.fragrantissima ethanolic extraction in MCF-7 cells. The imbalance of free radical ions creates an impact on the tumor suppressor gene and downregulates the cell survival signaling through inhibited anti-apoptotic genes and significantly expressed pro-apoptotic genes. It jointly created the pour in the outer membrane of mitochondria. Altogether, it generates the leaking of cytochrome c and it enters to form the apoptosome with activated caspase-9/Apaf-1. The caspase cascade helps cleave the mature PARP into cleaved PARP and affects the DNA repair machinery. The proteolytic enzymes engage with the FAS recruitment and activate the FADD and signals to the caspase-8 active form. Finally, cell apoptosis could occur in MCF-7 cells (Fig 8). Herein, this study documented that A.fragrantissima instigated mitochondrial-mediated apoptosis in breast cancer MCF-7 cells. A recent study has demonstrated the anti-breast cancer activity of the dichloromethane extract, particularly in triple-negative breast cancer (TNBC). This extract exhibited a positive activation of caspase 3/7 activity. Similarly, our study indicated that MCF-7 cells were impacted by the ethanolic extract of A.fragrantissima, potentially by influencing the Pi3K/Akt signaling cascade [22].

Fig 8 — A diagram explains the possible role of *achillea fragrantissima* ethanol extract on MCF-7 cell apoptosis.

5. Conclusion

In conclusion, the findings from this study underscore the cytotoxic potential of the ethanol extract of A.fragrantissima against MCF-7 cells, evidencing its ability to induce cell death characterized by the generation of reactive oxygen species (ROS), disruption of mitochondrial potential, and DNA fragmentation. Notably, the extract exhibited promising inhibitory effects on cell migration and invasion, indicative of its potential role in impeding cancer progression. Moreover, A.fragrantissima demonstrated a modulatory impact on apoptosis-related genes, notably upregulating key mediators such as Caspase-8, Cytochrome c, and FADD, while inducing significant PARP cleavage, a hallmark of apoptotic activity. These collective findings suggest the therapeutic potential of A.fragrantissima in breast cancer management. Nonetheless, further investigations, particularly in vivo studies, are imperative to elucidate the precise molecular mechanisms underpinning its actions and to validate its efficacy and safety for clinical application.

Supporting information

S1 File

(DOCX)

pone.0304072.s001.docx^{(193.6KB, docx)}

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

1.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., et al. 2021. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA. Cancer J. Clin. 71, 209–249. doi: 10.3322/caac.21660 [DOI] [PubMed] [Google Scholar]
2.Boldin M.P., Varfolomeev E.E., Pancer Z., Mett I.L., Camonis J.H., Wallach D., 1995. A novel protein that interacts with the death domain of Fas/APO1 contains a sequence motif related to the death domain. J. Biol. Chem. 270, 7795–7798. doi: 10.1074/jbc.270.14.7795 [DOI] [PubMed] [Google Scholar]
3.Chinnaiyan A.M., O’Rourke K., Tewari M., Dixit V.M., 1995. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505–512. doi: 10.1016/0092-8674(95)90071-3 [DOI] [PubMed] [Google Scholar]
4.Kim P.K.M., Park S.-Y., Koty P.P., Hua Y., Luketich J.D., Billiar T.R., 2003. Fas-associating death domain protein overexpression induces apoptosis in lung cancer cells. J. Thorac. Cardiovasc. Surg. 125, 1336–1342. doi: 10.1016/s0022-5223(02)73227-3 [DOI] [PubMed] [Google Scholar]
5.Cavalcante G.C., Schaan A.P., Cabral G.F., Santana-da-Silva M.N., Pinto P., Vidal A.F., et al. 2019. A Cell’s Fate: An Overview of the Molecular Biology and Genetics of Apoptosis. Int. J. Mol. Sci. doi: 10.3390/ijms20174133 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Hotamisligil G.S., Davis R.J., 2016. Cell Signaling and Stress Responses. Cold Spring Harb. Perspect. Biol. 8. doi: 10.1101/cshperspect.a006072 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Kuwabara M., Asanuma T., Niwa K., Inanami O., 2008. Regulation of cell survival and death signals induced by oxidative stress. J. Clin. Biochem. Nutr. 43, 51–57. doi: 10.3164/jcbn.2008045 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Rahman M.A., Hannan M.A., Dash R., Md Hasanur Rahman, Islam R., Uddin M.J., et al. 2021. Phytochemicals as a Complement to Cancer Chemotherapy: Pharmacological Modulation of the Autophagy-Apoptosis Pathway. Front. Pharmacol. 12, 639628. doi: 10.3389/fphar.2021.639628 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Awad B.M., Habib E.S., Ibrahim A.K., Wanas A.S., Radwan M.M., Helal M.A., et al. , 2017. Cytotoxic activity evaluation and molecular docking study of phenolic derivatives from Achillea fragrantissima (Forssk.) growing in Egypt. Med. Chem. Res. 26, 2065–2073. 10.1007/s00044-017-1918-6 [DOI] [Google Scholar]
10.Patocka J., 2019. Achillea fragrantissima: Pharmacology Review. Clin. Oncol. 4, 1601. [Google Scholar]
11.Saeidnia S., Gohari A., Mokhber-Dezfuli N., Kiuchi F., 2011. A review on phytochemistry and medicinal properties of the genus Achillea. Daru 19, 173–186. [PMC free article] [PubMed] [Google Scholar]
12.Farouk A., Ali H., Al-Khalifa A.R., Mohsen M., Fikry R., 2019. Comparative study for the volatile constituents and the antioxidant activity of the essential oils of dried Achillea fragrantissima cultivated in Madinah Monawara, Saudi Arabia and Egypt. Int. J. Food Prop. 22, 395–404. 10.1080/10942912.2019.1588901 [DOI] [Google Scholar]
13.Mosmann T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55–63. doi: 10.1016/0022-1759(83)90303-4 [DOI] [PubMed] [Google Scholar]
14.Hulkower K.I., Herber R.L., 2011. Cell migration and invasion assays as tools for drug discovery. Pharmaceutics 3, 107–124. doi: 10.3390/pharmaceutics3010107 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Lowry Oliver H., Rosebrough NiraJ, Farr A. Lewis, R.R., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. https://doi.org/https://dx.doi.org/10.1016/s0021-9258(19)52451-6 [PubMed] [Google Scholar]
16.Jänicke R.U., 2009. MCF-7 breast carcinoma cells do not express caspase-3. Breast Cancer Res. Treat. 10.1007/s10549-008-0217-9 [DOI] [PubMed] [Google Scholar]
17.Elmann A., Mordechay S., Erlank H., Telerman A., Rindner M., Ofir R., 2011. a. Anti-Neuroinflammatory effects of the extract of Achillea fragrantissima. BMC Complement. Altern. Med. 11. doi: 10.1186/1472-6882-11-98 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Ullah M.F., Ahmad A., Bhat S.H., Abuduhier F.M., Mustafa S.K., Al-Qirim T., 2022. Functional profiling of Achillea fragrantissima (a perennial edible herb) against human cancer cells and potential nutraceutical impact in neutralizing cell proliferation by interfering with VEGF and NF-κB signaling pathways. Ital. J. Food Sci. 34, 35–47. doi: 10.15586/ijfs.v34i3.2211 [DOI] [Google Scholar]
19.Elmann A., Telerman A., Mordechay S., Erlank H., Rindner M., Ofir R., et al. 2011. b. Extract of Achillea fragrantissima Downregulates ROS Production and Protects Astrocytes from Oxidative-Stress-Induced Cell Death. Neurodegener. Dis.—Process. Prev. Prot. Monit. 10.5772/32398 [DOI] [Google Scholar]
20.Mustafa E.H., Abu Zarga M., Abdalla S., 1992. Effects of cirsiliol, a flavone isolated from Achillea fragrantissima, on rat isolated ileum. Gen. Pharmacol. 23, 555–560. 10.1016/0306-3623(92)90127-6 [DOI] [PubMed] [Google Scholar]
21.Hijazi M.A., Jambi H.A., Aljehany B.M., Althaiban M.A., 2019. Potential protective effect of Achillea fragrantissima against adriamycin-induced cardiotoxicity in rats via an antioxidant and anti-inflammatory pathway. Biomed Res. Int. 2019. 10.1155/2019/5269074 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.ELFattah A., Ali S., Aly H., AbdAlla H., Shalaby N., Saleh M., 2018. Therapeutic potential of Achillea fragrantissima extracts in amelioration of high-fat diet and low dose streptozotocin diabetic rats. J. Complement. Med. Res. 7, 115. 10.5455/jcmr.20180121122758 [DOI] [Google Scholar]
23.Ezzat S.M., Salama M.M., 2014. A new α-glucosidase inhibitor from Achillea fragrantissima (Forssk.) Sch. Bip. growing in Egypt. Nat. Prod. Res. 28, 812–818. 10.1080/14786419.2014.891203 [DOI] [PubMed] [Google Scholar]
24.Skaf J., Hamarsheh O., Berninger M., Balasubramanian S., Oelschlaeger T.A., Holzgrabe U., 2018. Improving anti-trypanosomal activity of alkamides isolated from Achillea fragrantissima. Fitoterapia 125, 191–198. 10.1016/j.fitote.2017.11.001 [DOI] [PubMed] [Google Scholar]
25.Alsohaili S., 2018. Seasonal Variation in the Chemical Composition and Antimicrobial Activity of Essential Oil Extracted from Achillea fragrantissima Grown in Northern—Eastern Jordanian Desert. J. Essent. Oil Bear. Plants 21, 139–145. 10.1080/0972060X.2018.1446848 [DOI] [Google Scholar]
26.Break M.K. Bin, Younes K.M., Elkahoui S., Unissa R., Alfahidat S.A., Alshawi K.S., et al. 2021. Achillea fragrantissima (Forssk.) Sch.Bip. methanolic extract exerts potent antimicrobial activity and causes cancer cell death via induction of caspase-dependent apoptosis and S-phase arrest. Nat. Prod. Res. 36, 4639–4644. doi: 10.1080/14786419.2021.2010074 [DOI] [PubMed] [Google Scholar]
27.Navaie B.A., Kavoosian S., Fattahi S., Hajian-tilaki K., Asouri M., Bishekolaie R., et al. , 2016. Antioxidant and Cytotoxic Effect of Aqueous and Hydroalcoholic Extracts of the Achillea Millefolium L. on MCF-7 Breast Cancer Cell Line. Ibbj 1, 119–125. [Google Scholar]
28.Alshuail N., Alehaideb Z., Alghamdi S., Suliman R., Al-Eidi H., Ali R., et al. , 2022. Achillea fragrantissima (Forssk.) Sch.Bip Flower Dichloromethane Extract Exerts Anti-Proliferative and Pro-Apoptotic Properties in Human Triple-Negative Breast Cancer (MDA-MB-231) Cells: In Vitro and In Silico Studies. Pharmaceuticals 15, 1060. doi: 10.3390/ph15091060 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Alenad A.M., Al-Jaber N.A., Krishnaswamy S., Yakout S.M., Al-Daghri N.M., Alokail M.S., 2013. Journal of Medicinal Plants Research Achillea fragrantissima extract exerts its anticancer effect via induction of differentiation, cell cycle arrest and apoptosis in chronic myeloid leukemia (CML) cell line K562. J. Med. Plants Res. 7, 1561–1567. 10.5897/JMPR12.852 [DOI] [Google Scholar]
30.Ma Y.S., Yao C.N., Liu H.C., Yu F.S., Lin J.J., Lu K.W., et al. , 2018. Quercetin induced apoptosis of human oral cancer SAS cells through mitochondria and endoplasmic reticulum mediated signaling pathways. Oncol. Lett. 15, 9663–9672. doi: 10.3892/ol.2018.8584 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Mansi I., Awadh Ali N.A., Mhaidat N.M., Hussain K., Al-Kaf A.G., Anwar S., et al. 2019. Chemical composition and biological activity of the essential oil isolated from the leaves of achillea fragrantissima growing wild in Yemen. Pharmacogn. J. 11, 1077–1081. 10.5530/pj.2019.11.168 [DOI] [Google Scholar]
32.Mouchira A.C., 2017. Chemical composition and anticancer activity of Achillea fragrantissima (Forssk.) Sch. Bip. (Asteraceae) essential oil from Egypt. J. Pharmacogn. Phyther. 9, 1–5. 10.5897/jpp2015.0399 [DOI] [Google Scholar]
33.Thoppil R.J., Harlev E., Mandal A., Nevo E., Bishayee A., 2013. Antitumor activities of extracts from selected desert plants against HepG2 human hepatocellular carcinoma cells. Pharm. Biol. 51, 668–674. doi: 10.3109/13880209.2012.749922 [DOI] [PubMed] [Google Scholar]
34.Redza-Dutordoir M., Averill-Bates D.A., 2016. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta 1863, 2977–2992. doi: 10.1016/j.bbamcr.2016.09.012 [DOI] [PubMed] [Google Scholar]
35.Wang C., Youle R.J., 2009. The role of mitochondria in apoptosis*. Annu. Rev. Genet. 43, 95–118. doi: 10.1146/annurev-genet-102108-134850 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Zhang J.H., Xu M., 2000. DNA fragmentation in apoptosis. Cell Res. 10, 205–211. doi: 10.1038/sj.cr.7290049 [DOI] [PubMed] [Google Scholar]
37.Yang B., Zhu W., Zheng Z., Chai R., Ji S., Ren G., et al. , 2017. Fluctuation of ROS regulates proliferation and mediates inhibition of migration by reducing the interaction between DLC1 and CAV-1 in breast cancer cells. Vitr. Cell. Dev. Biol.—Anim. 53, 354–362. doi: 10.1007/s11626-016-0123-0 [DOI] [PubMed] [Google Scholar]
38.Sharma S., Kalra H., Akundi R.S., 2021. Extracellular ATP Mediates Cancer Cell Migration and Invasion Through Increased Expression of Cyclooxygenase 2. Front. Pharmacol. 11. doi: 10.3389/fphar.2020.617211 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Bali E.B., Açık L., Elçi P., Sarper M., Avcu F., Vural M., 2015. In vitro anti-oxidant, cytotoxic and pro-apoptotic effects of Achillea teretifolia Willd extracts on human prostate cancer cell lines. Pharmacogn. Mag. 11, S308–15. doi: 10.4103/0973-1296.166060 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Korsmeyer S., Wei M., Saito M. et al. 2000. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ 7, 1166–1173 [DOI] [PubMed] [Google Scholar]
41.Li P., Nijhawan D., Budihardjo I., Srinivasula S.M., Ahmad M., Alnemri E.S., et al. 1997. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489. doi: 10.1016/s0092-8674(00)80434-1 [DOI] [PubMed] [Google Scholar]
42.Mashimo M., Onishi M., Uno A., Tanimichi A., Nobeyama A., Mori M.,et al., 2021. The 89-kDa PARP1 cleavage fragment serves as a cytoplasmic PAR carrier to induce AIF-mediated apoptosis. J. Biol. Chem. 296, 100046. doi: 10.1074/jbc.RA120.014479 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Lifang L., Yonghui Y., Fang L., Hongyun L., 2003. Relationship between apoptosis and E-cadherin expression in bronchial epithelium of smoking mouse. J. Huazhong Univ. Sci. Technol. [Medical Sci. 23, 216–218. 10.1007/BF02829495 [DOI] [PubMed] [Google Scholar]
44.Steinhusen U., Weiske J., Badock V., Tauber R., Bommert K., Huber O., 2001. Cleavage and Shedding of E-cadherin after Induction of Apoptosis. J. Biol. Chem. 276, 4972–4980. doi: 10.1074/jbc.M006102200 [DOI] [PubMed] [Google Scholar]
45.Weng L., Brown J., Eng C., 2001. PTEN induces apoptosis and cell cycle arrest through phosphoinositol-3-kinase/Akt-dependent and -independent pathways. Hum. Mol. Genet. 10, 237–242. doi: 10.1093/hmg/10.3.237 [DOI] [PubMed] [Google Scholar]
46.Sun B.-H., Zhao X.-P., Wang B.-J., Yang D.-L., Hao L.-J., 2000. FADD and TRADD expression and apoptosis in primary hepatocellular carcinoma. World J. Gastroenterol. 6, 223–227. doi: 10.3748/wjg.v6.i2.223 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0304072.r001

Decision Letter 0

Ajay Kumar

6 Feb 2024

PONE-D-23-40260Achillea fragrantissima (Forssk.) Sch.Bip instigates the ROS/FADD/c-PARP expression: An actuation of apoptosis in breast cancer cellPLOS ONE

Dear Dr. ALASMARI,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Mar 22 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ajay Kumar, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that your Data Availability Statement is currently as follows: All relevant data are within the manuscript and its Supporting Information files.

Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition).

For example, authors should submit the following data:

- The values behind the means, standard deviations and other measures reported;

- The values used to build graphs;

- The points extracted from images for analysis.

Authors do not need to submit their entire data set if only a portion of the data was used in the reported study.

If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories.

If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access.

3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. Revise the scientific name of the plant throughout the entire manuscript.

2. Ensure that all gene names are formatted in italics.

3. Authors should reference the supporting papers for the materials and methods section and specify the number of cells used in various in vitro assays.

4. Clearly indicate the specific part of the plant utilized in this study.

5. Rewrite the heading "Determination of Live/Dead assay (AO/EtBr)."

6. Consider replacing "produces" with "induces" in the sentence "The 24-hour experimental time revealed that A. Fragrantissima induces 50% cell death at 20 µg/mL in MCF-7 cells."

7. Based on the results, it appears that the selected plant extract is toxic to normal cells at very low concentrations. If the IC50 value exceeds 100 µg/mL for the normal cell line (HEK293), it can be assumed that the extract is safe for normal cells.

8. Question the need for performing a cell viability experiment if the cell viability has already been assessed through the MTT assay. Consider excluding this experiment from the article.

9. Elaborate on the results section of 3.4, as the material and method for this experiment are missing.

10. To validate cellular integrity, Hoechst or DAPI staining will be used. The colony formation assay only validates the cell migration ability of cancer cells.

11. Authors should provide macroscopic and microscopic images of colonies in the colony formation experiment section.

12. Check the statistical significance in Figure 1d. Authors have marked **** in the image panel.

13. Include a scale bar in Figure 3d.

14. Enhance the language to improve readability and understanding.

15. Avoid using abbreviations in the abstract.

16. In the abstract section, write the name of the plant, Achillea fragrantissima (A. fragrantissima), in the proper format, as well as throughout the entire manuscript.

17. The introductory part should include a brief overview of the current status, overall incidence rates, and epidemiology of breast cancer to make the article more impactful.

18. Address grammatical errors and spelling mistakes throughout the entire article, including line 102, 111, 115, 121, 167, 207, 271.

19. Characterize the ethanolic extract of A. fragrantissima and include information about various bioactive compounds present in the extract.

20. Ensure consistency between the result section 3.1 and Figure 1b, as the normal cells HEK-293 are mentioned as HEK-293T in Figure 1b.

21. Provide the relevance of the present results with previous research to enhance the impact of the article.

22. Specify the criteria for selecting the time intervals in Figures 1d, 3a, and 4.

23. Clearly distinguish between gene and protein for better understanding.

24. Highlight the "toxicity and pharmacokinetic studies" of the ethanolic extract of A. fragrantissima in the article.

25. Improve image quality for better visualization of cell morphology.

26. Ensure that the concentration unit in Figure 1a, b, and c is in μg/mL.

27. In Figure 7, correct the mention of CYSC protein to CYCS in the graphical part.

28. Elaborate on the concluding parts of the article.

Reviewer #2: 1. The manuscript contains several grammatical errors.

2. Inclusion of other breast cancer cell lines alongside MCF-7 will improve the manuscript.

3. In the section 3.1.A, in place of using HEK cells as a control, it is advised to use MCF-10A cells, which is more appropriate control for breast cancer studies.

4. Vehicle control (e.g., ethanol alone) is missing in the ethanol-extracted compound experiment. Further, inclusion of positive control in cell death experiments, such staurosporine or doxycycline induced cell death etc. will be useful.

5. In case of dual staining experiments, apart from merged images, images from the individual channels must be added.

6. Lack of Hoechst 33342 based nucleus staining in the control samples need to be explained.

7. In the mRNA expression analysis, both, PARP and caspase 8 are downregulated. However, in the western-blot based experiments, both are increased. What is the reason behind this discrepancy?

8. In case of cytochrome c release experiment, it is not clear whether the whole cell extract was used or only mitochondrial extract was used.

Reviewer #3: Abdulrahman ALASMARI evaluated the efficacy of Achillea fragrantissima against the breast cancer cell (MCF-7) and claims the possible involvement of ROS/FADD/c-PARP expression for induced apoptotic network genes (Caspase-3, Caspase-8, Caspase-9, Cytochrome c, BCL-2, BID, BAX, PARP, PTEN, PI3K, and Akt).

The manuscript is well designed and scientifically sound, however data analysis should be improved. Discussion part is poorly explained.

I offer the following comments in hope to assist with improvement:

1. Author used ethanol extract of A. Fragrantissima in treating MCF-7 cells. Did they used any appropriate vehicle control for experiment? Include this in manuscript.

2. A. Fragrantissima has shown the decreased cell viability against normal cells - HEK-293 T cells (fig 1). How the result was correlated?

3. I wonder to see the image of DCFH-DA (ROS) and Hoechst-33342 (DNA Fragmentation) stained cells. No cellular expression has been observed in control/MCF-7 cells (Fig 2).

4. The quantitative analysis is poorly defined and need to be elaborated (such as percentage change or modulation-% increase/decrease etc.) for all data.

5. Manuscript title is not conclusive; it could be improved.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Akhilesh Kumar

Reviewer #3: Yes: Akhilendra Kumar Maurya

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 May 31;19(5):e0304072. doi: 10.1371/journal.pone.0304072.r002

Author response to Decision Letter 0

17 Apr 2024

Authors Response to Reviewer/Editors Comments

We express our gratitude to the reviewers for their valuable comments and suggestions on this manuscript. We are pleased to present the revised version for potential publication in your esteemed journal.

Reviewer #1:

1. Revise the scientific name of the plant throughout the entire manuscript.

In accordance with the reviewer's suggestion, we have updated the botanical nomenclature throughout the manuscript.

2. Ensure that all gene names are formatted in italics.

We have italicized gene names throughout the entire manuscript and figures as per formatting guidelines.

3. Authors should reference the supporting papers for the materials and methods section and specify the number of cells used in various in vitro assays.

We have included pertinent references for certain methods, while adhering to the standard protocol for the remaining methods.

4. Clearly indicate the specific part of the plant utilized in this study.

In the method section, we have specified the particular part of the plant. Thank you.

5. Rewrite the heading "Determination of Live/Dead assay (AO/EtBr).

We have revised the sub-heading to "Live/Dead Assay (AO/EtBr Staining)".

6. Consider replacing "produces" with "induces" in the sentence "The 24-hour experimental time revealed that A. Fragrantissima induces 50% cell death at 20 µg/mL in MCF-7 cells."

Following the reviewer's feedback, we have substituted the term "induces". Thank you.

If the dosage exceeds 100 µg/mL, it would indeed become toxic to HEK-293 cells.

8. Question the need for performing a cell viability experiment if the cell viability has already been assessed through the MTT assay. Consider excluding this experiment from the article.

We acknowledge this comment. The temporal dynamics and dose-response relationship of A. Fragrantissima were characterized using the MTT test. We kindly request you to consider including these results in the manuscript.

9. Elaborate on the results section of 3.4, as the material and method for this experiment are missing.

Section 3.4 has been expanded upon, and the respective method has been included. Thank you.

10. To validate cellular integrity, Hoechst or DAPI staining will be used. The colony formation assay only validates the cell migration ability of cancer cells.

We concur. Thank you. The Hoechst DNA integrity assay was conducted. Additionally, the colony formation method section has been rectified.

11. Authors should provide macroscopic and microscopic images of colonies in the colony formation experiment section.

We conducted the colony formation assay and counted the colonies for graphing purposes. The plates were then destroyed after the colonies were counted once. We apologize for any inconvenience caused.

12. Check the statistical significance in Figure 1d. Authors have marked **** in the image panel.

Upon careful analysis, we have corrected the error.

13. Include a scale bar in Figure 3d.

The scale bar has been indicated in Figure 3d.

14. Enhance the language to improve readability and understanding.

The language of the manuscript has been improved.

15. Avoid using abbreviations in the abstract.

We have corrected the error in the abstract section.

16. In the abstract section, write the name of the plant, Achillea fragrantissima (A. fragrantissima), in the proper format, as well as throughout the entire manuscript.

The plant name has been rectified throughout the entire manuscript.

17. The introductory part should include a brief overview of the current status, overall incidence rates, and epidemiology of breast cancer to make the article more impactful.

The introduction section has been enriched with a concise overview of breast cancer.

18. Address grammatical errors and spelling mistakes throughout the entire article, including line 102, 111, 115, 121, 167, 207, 271.

The grammatical error was corrected.

19. Characterize the ethanolic extract of A. fragrantissima and include information about various bioactive compounds present in the extract.

In the manuscript, we have detailed the bioactive compounds found in the ethanol-based crude extract of A. Fragrantissima.

20. Ensure consistency between the result section 3.1 and Figure 1b, as the normal cells HEK-293 are mentioned as HEK-293T in Figure 1b.

We corrected the error, and we used HEK-293 cells.

21. Provide the relevance of the present results with previous research to enhance the impact of the article.

Our current findings were compared with recent findings and it was added in manuscript.

22. Specify the criteria for selecting the time intervals in Figures 1d, 3a, and 4.

Performing in-vitro studies with various time points enables researchers to thoroughly evaluate temporal dynamics, dose-response relationships, kinetics of cellular processes, and clinical significance of tested treatments. This approach offers valuable insights into their efficacy and mechanism of action.

23. Clearly distinguish between gene and protein for better understanding.

We differentiated the protein and gene in the manuscript.

24. Highlight the "toxicity and pharmacokinetic studies" of the ethanolic extract of A. Fragrantissima in the article.

We highlighted the toxicity and pharmacokinetic studies in this article.

25. Improve image quality for better visualization of cell morphology.

The quality of morphology image was improved.

26. Ensure that the concentration unit in Figure 1a, b, and c is in μg/mL.

The concentration unit was corrected.

27. In Figure 7, correct the mention of CYSC protein to CYCS in the graphical part.

We corrected “CYSC into CYCS”. Thank you.

28. Elaborate on the concluding parts of the article.

Conclusion section was rewrite with necessary words.

Reviewer #2:

1. The manuscript contains several grammatical errors.

As per the reviewer suggestions, the several grammatical error was corrected.

2. Inclusion of other breast cancer cell lines alongside MCF-7 will improve the manuscript.

Thank you for your comment. We have concentrated on investigating the impact of A. Fragrantissima on MCF-7 cells, which serve as a prominent cell line model for breast cancer studies.

3. In the section 3.1.A, in place of using HEK cells as a control, it is advised to use MCF-10A cells, which is more appropriate control for breast cancer studies.

Due to the availability of a widely used normal cell line, HEK-293 was utilized. Additionally, several important articles have recommended the use of HEK-293 as normal cells for breast cancer studies. Thank you.

Thank you for your comment. From a technical standpoint, we employed a lyophilization step to remove ethanol solvent from the crude extract. Consequently, ethanol could not influence the growth of the cell line or induce cell death in MCF-7 cells. This is why we opted not to conduct a vehicle control test.

We did not utilize a positive control for screening apoptosis. The rationale behind this decision is that we did not compare our extracted compound with other anti-cancer agents. Moreover, the plant extract unequivocally induces cell death. Considering these factors, we omitted the positive control from this study. Thank you.

5. In case of dual staining experiments, apart from merged images, images from the individual channels must be added.

We performed the dual staining assay as a merged manner. Excuse this inconvenience.

6. Lack of Hoechst 33342 based nucleus staining in the control samples need to be explained.

The action of Hoechst staining on control cells had explained.

7. In the mRNA expression analysis, both, PARP and caspase 8 are downregulated. However, in the western-blot based experiments, both are increased. What is the reason behind this discrepancy?

We are also surprised by these results. The explanation lies in the fact that control cells do not undergo apoptosis. Consequently, during the protein translation stage, PARP and Caspase-8 proteins undergo normal cellular degradation and cleavage. However, in the case of treated cells, these proteins remain stable throughout the treatment and induce apoptosis. Thank you.

8. In case of cytochrome c release experiment, it is not clear whether the whole cell extract was used or only mitochondrial extract was used.

We are using whole cell lysate for western blot analysis. Now, we mentioned it method section and thank you.

Reviewer #3:

Abdulrahman ALASMARI evaluated the efficacy of Achillea fragrantissima against the breast cancer cell (MCF-7) and claims the possible involvement of ROS/FADD/c-PARP expression for induced apoptotic network genes (Caspase-3, Caspase-8, Caspase-9, Cytochrome c, BCL-2, BID, BAX, PARP, PTEN, PI3K, and Akt). The manuscript is well designed and scientifically sound, however data analysis should be improved. Discussion part is poorly explained. I offer the following comments in hope to assist with improvement:

1. Author used ethanol extract of A. Fragrantissima in treating MCF-7 cells. Did they used any appropriate vehicle control for experiment? Include this in manuscript.

Thank you for your feedback. As a technical measure, we implemented a lyophilization step to remove ethanol solvent from the crude extract. This ensured that ethanol did not influence the growth of MCF-7 cells or trigger cell death. Hence, we opted not to conduct a vehicle control test.

Additionally, we did not incorporate a positive control for apoptosis screening. This decision stems from the fact that we did not compare our extracted compound with other anti-cancer agents. Moreover, the plant extract unequivocally induces cell death. Considering these factors, we omitted the positive control from this study. Thank you.

2. A. Fragrantissima has shown the decreased cell viability against normal cells - HEK-293 T cells (fig 1). How the result was correlated?

The plant extract also triggers cell death in HEK-293 cells, albeit at a higher concentration compared to cancerous cell lines. Thank you.

3. I wonder to see the image of DCFH-DA (ROS) and Hoechst-33342 (DNA Fragmentation) stained cells. No cellular expression has been observed in control/MCF-7 cells (Fig 2).

The images are now corrected. Thank you.

4. The quantitative analysis is poorly defined and need to be elaborated (such as percentage change or modulation-% increase/decrease etc.) for all data.

Agreed and the western blot result was elaborated.

5. Manuscript title is not conclusive; it could be improved.

As per reviewer suggestions the title was altered in the revised manuscript.

*****

Attachment

Submitted filename: Authors Response_to_Reviewer_Editor Comments.docx

pone.0304072.s002.docx^{(20.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0304072.r003

Decision Letter 1

Ajay Kumar

7 May 2024

Achillea fragrantissima (Forssk.) Sch.Bip instigates the ROS/FADD/c-PARP expression: An actuation of apoptosis in breast cancer cell

PONE-D-23-40260R1

Dear Dr. ALASMARI,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ajay Kumar, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

The authors have adequately addressed all the comments asked by the reviewers and have accordingly revised the manuscript. Hence, the manuscript can be accepted for publication in its present form.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: The manuscript has undergone a comprehensive review process. All the comments, suggestions, are addressed. Recommended for publication.

Reviewer #2: (No Response)

Reviewer #3: Authors incorporated all the suggestions and concern; and addressed properly in manuscript for its betterment. I recommend my acceptance for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Akhilesh Kumar

Reviewer #3: Yes: Akhilendra Kumar Maurya

**********

PLoS One. doi: 10.1371/journal.pone.0304072.r004

Acceptance letter

Ajay Kumar

18 May 2024

PONE-D-23-40260R1

PLOS ONE

Dear Dr. Alasmari,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ajay Kumar

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File

(DOCX)

pone.0304072.s001.docx^{(193.6KB, docx)}

Attachment

Submitted filename: Authors Response_to_Reviewer_Editor Comments.docx

pone.0304072.s002.docx^{(20.4KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0304072.ref001] 1.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., et al. 2021. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA. Cancer J. Clin. 71, 209–249. doi: 10.3322/caac.21660 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref002] 2.Boldin M.P., Varfolomeev E.E., Pancer Z., Mett I.L., Camonis J.H., Wallach D., 1995. A novel protein that interacts with the death domain of Fas/APO1 contains a sequence motif related to the death domain. J. Biol. Chem. 270, 7795–7798. doi: 10.1074/jbc.270.14.7795 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref003] 3.Chinnaiyan A.M., O’Rourke K., Tewari M., Dixit V.M., 1995. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505–512. doi: 10.1016/0092-8674(95)90071-3 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref004] 4.Kim P.K.M., Park S.-Y., Koty P.P., Hua Y., Luketich J.D., Billiar T.R., 2003. Fas-associating death domain protein overexpression induces apoptosis in lung cancer cells. J. Thorac. Cardiovasc. Surg. 125, 1336–1342. doi: 10.1016/s0022-5223(02)73227-3 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref005] 5.Cavalcante G.C., Schaan A.P., Cabral G.F., Santana-da-Silva M.N., Pinto P., Vidal A.F., et al. 2019. A Cell’s Fate: An Overview of the Molecular Biology and Genetics of Apoptosis. Int. J. Mol. Sci. doi: 10.3390/ijms20174133 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref006] 6.Hotamisligil G.S., Davis R.J., 2016. Cell Signaling and Stress Responses. Cold Spring Harb. Perspect. Biol. 8. doi: 10.1101/cshperspect.a006072 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref007] 7.Kuwabara M., Asanuma T., Niwa K., Inanami O., 2008. Regulation of cell survival and death signals induced by oxidative stress. J. Clin. Biochem. Nutr. 43, 51–57. doi: 10.3164/jcbn.2008045 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref008] 8.Rahman M.A., Hannan M.A., Dash R., Md Hasanur Rahman, Islam R., Uddin M.J., et al. 2021. Phytochemicals as a Complement to Cancer Chemotherapy: Pharmacological Modulation of the Autophagy-Apoptosis Pathway. Front. Pharmacol. 12, 639628. doi: 10.3389/fphar.2021.639628 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref009] 9.Awad B.M., Habib E.S., Ibrahim A.K., Wanas A.S., Radwan M.M., Helal M.A., et al. , 2017. Cytotoxic activity evaluation and molecular docking study of phenolic derivatives from Achillea fragrantissima (Forssk.) growing in Egypt. Med. Chem. Res. 26, 2065–2073. 10.1007/s00044-017-1918-6 [DOI] [Google Scholar]

[pone.0304072.ref010] 10.Patocka J., 2019. Achillea fragrantissima: Pharmacology Review. Clin. Oncol. 4, 1601. [Google Scholar]

[pone.0304072.ref011] 11.Saeidnia S., Gohari A., Mokhber-Dezfuli N., Kiuchi F., 2011. A review on phytochemistry and medicinal properties of the genus Achillea. Daru 19, 173–186. [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref012] 12.Farouk A., Ali H., Al-Khalifa A.R., Mohsen M., Fikry R., 2019. Comparative study for the volatile constituents and the antioxidant activity of the essential oils of dried Achillea fragrantissima cultivated in Madinah Monawara, Saudi Arabia and Egypt. Int. J. Food Prop. 22, 395–404. 10.1080/10942912.2019.1588901 [DOI] [Google Scholar]

[pone.0304072.ref013] 13.Mosmann T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55–63. doi: 10.1016/0022-1759(83)90303-4 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref014] 14.Hulkower K.I., Herber R.L., 2011. Cell migration and invasion assays as tools for drug discovery. Pharmaceutics 3, 107–124. doi: 10.3390/pharmaceutics3010107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref015] 15.Lowry Oliver H., Rosebrough NiraJ, Farr A. Lewis, R.R., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. https://doi.org/https://dx.doi.org/10.1016/s0021-9258(19)52451-6 [PubMed] [Google Scholar]

[pone.0304072.ref016] 16.Jänicke R.U., 2009. MCF-7 breast carcinoma cells do not express caspase-3. Breast Cancer Res. Treat. 10.1007/s10549-008-0217-9 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref017] 17.Elmann A., Mordechay S., Erlank H., Telerman A., Rindner M., Ofir R., 2011. a. Anti-Neuroinflammatory effects of the extract of Achillea fragrantissima. BMC Complement. Altern. Med. 11. doi: 10.1186/1472-6882-11-98 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref018] 18.Ullah M.F., Ahmad A., Bhat S.H., Abuduhier F.M., Mustafa S.K., Al-Qirim T., 2022. Functional profiling of Achillea fragrantissima (a perennial edible herb) against human cancer cells and potential nutraceutical impact in neutralizing cell proliferation by interfering with VEGF and NF-κB signaling pathways. Ital. J. Food Sci. 34, 35–47. doi: 10.15586/ijfs.v34i3.2211 [DOI] [Google Scholar]

[pone.0304072.ref019] 19.Elmann A., Telerman A., Mordechay S., Erlank H., Rindner M., Ofir R., et al. 2011. b. Extract of Achillea fragrantissima Downregulates ROS Production and Protects Astrocytes from Oxidative-Stress-Induced Cell Death. Neurodegener. Dis.—Process. Prev. Prot. Monit. 10.5772/32398 [DOI] [Google Scholar]

[pone.0304072.ref020] 20.Mustafa E.H., Abu Zarga M., Abdalla S., 1992. Effects of cirsiliol, a flavone isolated from Achillea fragrantissima, on rat isolated ileum. Gen. Pharmacol. 23, 555–560. 10.1016/0306-3623(92)90127-6 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref021] 21.Hijazi M.A., Jambi H.A., Aljehany B.M., Althaiban M.A., 2019. Potential protective effect of Achillea fragrantissima against adriamycin-induced cardiotoxicity in rats via an antioxidant and anti-inflammatory pathway. Biomed Res. Int. 2019. 10.1155/2019/5269074 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref022] 22.ELFattah A., Ali S., Aly H., AbdAlla H., Shalaby N., Saleh M., 2018. Therapeutic potential of Achillea fragrantissima extracts in amelioration of high-fat diet and low dose streptozotocin diabetic rats. J. Complement. Med. Res. 7, 115. 10.5455/jcmr.20180121122758 [DOI] [Google Scholar]

[pone.0304072.ref023] 23.Ezzat S.M., Salama M.M., 2014. A new α-glucosidase inhibitor from Achillea fragrantissima (Forssk.) Sch. Bip. growing in Egypt. Nat. Prod. Res. 28, 812–818. 10.1080/14786419.2014.891203 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref024] 24.Skaf J., Hamarsheh O., Berninger M., Balasubramanian S., Oelschlaeger T.A., Holzgrabe U., 2018. Improving anti-trypanosomal activity of alkamides isolated from Achillea fragrantissima. Fitoterapia 125, 191–198. 10.1016/j.fitote.2017.11.001 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref025] 25.Alsohaili S., 2018. Seasonal Variation in the Chemical Composition and Antimicrobial Activity of Essential Oil Extracted from Achillea fragrantissima Grown in Northern—Eastern Jordanian Desert. J. Essent. Oil Bear. Plants 21, 139–145. 10.1080/0972060X.2018.1446848 [DOI] [Google Scholar]

[pone.0304072.ref026] 26.Break M.K. Bin, Younes K.M., Elkahoui S., Unissa R., Alfahidat S.A., Alshawi K.S., et al. 2021. Achillea fragrantissima (Forssk.) Sch.Bip. methanolic extract exerts potent antimicrobial activity and causes cancer cell death via induction of caspase-dependent apoptosis and S-phase arrest. Nat. Prod. Res. 36, 4639–4644. doi: 10.1080/14786419.2021.2010074 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref027] 27.Navaie B.A., Kavoosian S., Fattahi S., Hajian-tilaki K., Asouri M., Bishekolaie R., et al. , 2016. Antioxidant and Cytotoxic Effect of Aqueous and Hydroalcoholic Extracts of the Achillea Millefolium L. on MCF-7 Breast Cancer Cell Line. Ibbj 1, 119–125. [Google Scholar]

[pone.0304072.ref028] 28.Alshuail N., Alehaideb Z., Alghamdi S., Suliman R., Al-Eidi H., Ali R., et al. , 2022. Achillea fragrantissima (Forssk.) Sch.Bip Flower Dichloromethane Extract Exerts Anti-Proliferative and Pro-Apoptotic Properties in Human Triple-Negative Breast Cancer (MDA-MB-231) Cells: In Vitro and In Silico Studies. Pharmaceuticals 15, 1060. doi: 10.3390/ph15091060 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref029] 29.Alenad A.M., Al-Jaber N.A., Krishnaswamy S., Yakout S.M., Al-Daghri N.M., Alokail M.S., 2013. Journal of Medicinal Plants Research Achillea fragrantissima extract exerts its anticancer effect via induction of differentiation, cell cycle arrest and apoptosis in chronic myeloid leukemia (CML) cell line K562. J. Med. Plants Res. 7, 1561–1567. 10.5897/JMPR12.852 [DOI] [Google Scholar]

[pone.0304072.ref030] 30.Ma Y.S., Yao C.N., Liu H.C., Yu F.S., Lin J.J., Lu K.W., et al. , 2018. Quercetin induced apoptosis of human oral cancer SAS cells through mitochondria and endoplasmic reticulum mediated signaling pathways. Oncol. Lett. 15, 9663–9672. doi: 10.3892/ol.2018.8584 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref031] 31.Mansi I., Awadh Ali N.A., Mhaidat N.M., Hussain K., Al-Kaf A.G., Anwar S., et al. 2019. Chemical composition and biological activity of the essential oil isolated from the leaves of achillea fragrantissima growing wild in Yemen. Pharmacogn. J. 11, 1077–1081. 10.5530/pj.2019.11.168 [DOI] [Google Scholar]

[pone.0304072.ref032] 32.Mouchira A.C., 2017. Chemical composition and anticancer activity of Achillea fragrantissima (Forssk.) Sch. Bip. (Asteraceae) essential oil from Egypt. J. Pharmacogn. Phyther. 9, 1–5. 10.5897/jpp2015.0399 [DOI] [Google Scholar]

[pone.0304072.ref033] 33.Thoppil R.J., Harlev E., Mandal A., Nevo E., Bishayee A., 2013. Antitumor activities of extracts from selected desert plants against HepG2 human hepatocellular carcinoma cells. Pharm. Biol. 51, 668–674. doi: 10.3109/13880209.2012.749922 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref034] 34.Redza-Dutordoir M., Averill-Bates D.A., 2016. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta 1863, 2977–2992. doi: 10.1016/j.bbamcr.2016.09.012 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref035] 35.Wang C., Youle R.J., 2009. The role of mitochondria in apoptosis*. Annu. Rev. Genet. 43, 95–118. doi: 10.1146/annurev-genet-102108-134850 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref036] 36.Zhang J.H., Xu M., 2000. DNA fragmentation in apoptosis. Cell Res. 10, 205–211. doi: 10.1038/sj.cr.7290049 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref037] 37.Yang B., Zhu W., Zheng Z., Chai R., Ji S., Ren G., et al. , 2017. Fluctuation of ROS regulates proliferation and mediates inhibition of migration by reducing the interaction between DLC1 and CAV-1 in breast cancer cells. Vitr. Cell. Dev. Biol.—Anim. 53, 354–362. doi: 10.1007/s11626-016-0123-0 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref038] 38.Sharma S., Kalra H., Akundi R.S., 2021. Extracellular ATP Mediates Cancer Cell Migration and Invasion Through Increased Expression of Cyclooxygenase 2. Front. Pharmacol. 11. doi: 10.3389/fphar.2020.617211 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref039] 39.Bali E.B., Açık L., Elçi P., Sarper M., Avcu F., Vural M., 2015. In vitro anti-oxidant, cytotoxic and pro-apoptotic effects of Achillea teretifolia Willd extracts on human prostate cancer cell lines. Pharmacogn. Mag. 11, S308–15. doi: 10.4103/0973-1296.166060 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref040] 40.Korsmeyer S., Wei M., Saito M. et al. 2000. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ 7, 1166–1173 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref041] 41.Li P., Nijhawan D., Budihardjo I., Srinivasula S.M., Ahmad M., Alnemri E.S., et al. 1997. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489. doi: 10.1016/s0092-8674(00)80434-1 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref042] 42.Mashimo M., Onishi M., Uno A., Tanimichi A., Nobeyama A., Mori M.,et al., 2021. The 89-kDa PARP1 cleavage fragment serves as a cytoplasmic PAR carrier to induce AIF-mediated apoptosis. J. Biol. Chem. 296, 100046. doi: 10.1074/jbc.RA120.014479 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0304072.ref043] 43.Lifang L., Yonghui Y., Fang L., Hongyun L., 2003. Relationship between apoptosis and E-cadherin expression in bronchial epithelium of smoking mouse. J. Huazhong Univ. Sci. Technol. [Medical Sci. 23, 216–218. 10.1007/BF02829495 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref044] 44.Steinhusen U., Weiske J., Badock V., Tauber R., Bommert K., Huber O., 2001. Cleavage and Shedding of E-cadherin after Induction of Apoptosis. J. Biol. Chem. 276, 4972–4980. doi: 10.1074/jbc.M006102200 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref045] 45.Weng L., Brown J., Eng C., 2001. PTEN induces apoptosis and cell cycle arrest through phosphoinositol-3-kinase/Akt-dependent and -independent pathways. Hum. Mol. Genet. 10, 237–242. doi: 10.1093/hmg/10.3.237 [DOI] [PubMed] [Google Scholar]

[pone.0304072.ref046] 46.Sun B.-H., Zhao X.-P., Wang B.-J., Yang D.-L., Hao L.-J., 2000. FADD and TRADD expression and apoptosis in primary hepatocellular carcinoma. World J. Gastroenterol. 6, 223–227. doi: 10.3748/wjg.v6.i2.223 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Achillea fragrantissima (Forssk.) Sch.Bip instigates the ROS/FADD/c-PARP expression that triggers apoptosis in breast cancer cell (MCF-7)

Abdulrahman Alasmari

Roles

Abstract

1. Introduction

2. Materials and methods

2.1. Chemical

2.2. Plant Collection, Identification, and extract preparation

2.3. Cell culture

2.4. MTT assay

2.5. Examination of apoptotic cells by trypan blue exclusion method

2.6. Cell viability

2.7. Phase-contrast microscopic examination

2.8. Live/ dead assay (AO/EtBr staining)

2.9. Determination of reactive oxygen species

2.10. Mitochondrial membrane potential (Rho-123)

2.11. Nuclear fate (Hoechst-33342)

2.12. Wound healing assay

2.13. Matrigel-coated transwell assay

2.14. Colony formation assay

2.15. qRT-PCR analysis

Table 1. Primers were used in this study.

2.16. Immunoblot analysis

2.17. Statistical analysis

3. Results

3.1. Achillea fragrantissima induces cytotoxicity in MCF-7 and HEK-293 cells

Fig 1. Effect of achillea fragrantissima on cell cytotoxicity, cell apoptosis, cell viability, ROS generation, and morphological changes in breast cancer.

3.2. Achillea fragrantissima produces apoptotic cells

3.3. Achillea fragrantissima decreases cell viability in MCF-7 cells

3.4. Achillea fragrantissima generates intracellular ROS

3.5. Achillea fragrantissima disturbs the morphology of MCF-7 monolayer

3.6. Achillea fragrantissima instigates dead cells and ROS in MCF-7 cells

Fig 2. Achillea fragrantissima triggers rupture in cell morphology (AO/EtBr), ROS generation, loss of mitochondrial potential, and DNA fragmentation in MCF-7 cells.

3.7. Achillea fragrantissima impacts mitochondrial health and DNA fragmentation in MCF-7 cells

3.8. Achillea fragrantissima inhibits cell migration in MCF-7 cells

Fig 3. Achillea fragrantissima actively inhibits migration, colony formation, and invasion in MCF-7 cells.

3.9. Achillea fragrantissima impacts on colony formation of MCF-7 cells

3.10. Achillea fragrantissima suppresses the cell invasion (MCF-7) in vitro

3.11. Achillea fragrantissima impacts on Caspase-3 expression

Fig 4. Achillea fragrantissima upregulated Caspase-3 mRNA in MCF-7 cells.

3.12. Achillea fragrantissima significantly regulates anti, pro, and apoptotic genes in MCF-7 cells

Fig 5. Impact of achillea fragrantissima on apoptosis regulatory genes at 24 hrs (An mRNA account).

Fig 6. Impact of achillea fragrantissima on apoptosis regulatory genes at 48 hrs (An mRNA account).

3.13. Achillea fragrantissima triggers PARP, CYCS, Caspase-8, and FADD proteins in MCF-7 cells

Fig 7. PARP, FADD, and CYSC proteins are upregulated under achillea fragrantissima administration (a protein account) in MCF-7 cells.

4. Discussion

Fig 8. Schematic representation of the study.

5. Conclusion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Ajay Kumar

Roles

Author response to Decision Letter 0

Decision Letter 1

Ajay Kumar

Roles

Acceptance letter

Ajay Kumar

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases