Skip to main content
The Journal of Veterinary Medical Science logoLink to The Journal of Veterinary Medical Science
. 2024 Mar 11;86(5):584–591. doi: 10.1292/jvms.23-0389

Recombinase polymerase amplification-lateral flow dipstick (RPA-LFD) designed for rapid detection of canine distemper virus

Shanshan ZHANG 1, Chengyu WANG 1, Keyin MENG 1,*, Jun LIU 1,*
PMCID: PMC11144539  PMID: 38462524

Abstract

In the present study, recombinase polymerase amplification (RPA) was combined with the colloidal gold lateral flow dipstick (LFD) method to establish a new, stable, and efficient assay for the detection of canine distemper virus (CDV). We designed a set of specific primers labeled with biotin and a specific probe labeled with dSpacer and C3 spacer, according to the conserved region in the N-terminal gene sequence of CDV. The reaction conditions and systems were then optimized, and the sensitivity and specificity were analyzed for potential clinical application. The results showed that the RPA-LFD assay for CDV detection was successfully established. We also found that the temperature in a closed fist (35°C) is optimal for the RPA reaction. The optimal ratio of primer to probe was 2:1. The minimum detection limit of the RPA-LFD assay was 1 × 101 the median tissue culture infective dose (TCID50)/mL. Using this assay with samples from experimentally infected dogs, CDV was detected in nasal secretions, eye secretions, and blood on the fourth day post infection. In summary, this novel RPA-LFD assay for CDV detection is simple to use, and preliminary findings indicate its high specificity and sensitivity.

Keywords: canine distemper virus, lateral flow dipstick, recombinase polymerase amplification, sensitivity, specificity


Canine distemper virus (CDV) is the primary pathogen causing canine distemper, a highly contagious disease widely spread in dogs and wild carnivores [13]. Canine distemper is one of the major diseases threatening the health of felids, dogs, minks, and other animals involved in the fur trade [1]; therefore, it has a serious economic impact on the pet industry and the fur industry. Currently, several nucleic acid assay methods, such as reverse transcription–polymerase chain reaction (RT-PCR) [6], nested RT-qPCR [16], real-time RT-qPCR [5], and reverse transcription–loop-mediated isothermal amplification (RT-LAMP) [9], have been developed for CDV detection. However, these methods have some shortcomings. For example, assays based on DNA polymerase are thermocycler-dependent and therefore impractical for field and point-of-care applications [6]. Thermostatic technologies such as RT-LAMP and real-time RT-PCR assays, while no longer relying on robust and high-precision instruments, still require long times for amplification. Rapid, simple, and inexpensive assays for the detection of CDV would be beneficial for minimally equipped facilities and out in the field [18].

Recombinase polymerase amplification (RPA) is a type of constant temperature amplification technology using DNA as the template [10]. The RPA reaction principle depends on the recombinase, which can catalyze the binding of primers to broken DNA and enables DNA polymerase to use primers as starting sites for DNA strand synthesis. For example, in the TwistAmp™ nfo kit, the length of the probe is generally 46–52 nucleotides, with at least 30 nucleotides located at the 5’-terminus of the tetrahydrofuran residue (THF), also known as the dSpacer site, and at least 15 nucleotides located at the 3’-terminus of the THF. THF residues replace nucleotides that can normally pair with complementary sequences. During the reaction of the probe, the THF residue becomes the substrate of endonuclease IV (nfo), which will cleave the probe at the THF site, resulting in the formation of a newly generated 3-hydroxy group that can serve as the starting site for polymerase extension, thereby converting the probe into a primer [17]. Once the probe and primer sequences are determined, biotin and fluorescent groups can be added to the visualization medium based on the selected results. This method initiates the amplification reaction by the interaction of an upstream primer, a downstream primer, and a probe. The most optimal concentration of probe can be determined based on the amplification results (i.e., the color depth of a lateral flow dipstick (LFD)). Recombinase, single-stranded DNA binding protein, and strand displacement polymerase play key roles in RPA reactions. These three enzymes coordinate primer pairing with the target RNA/DNA to synthesize DNA and can amplify the DNA template materials from trace levels to detectable levels in a short time, thus providing a high sensitivity and specificity.

The principle of the LFD method is the same as that of the colloidal gold strip method for rapid detection [10]. As shown in Fig. 1, the LFD developed consists of a sample pad, a gold pad (coated with colloidal gold for staining purposes), a test pad, a quality control pad, and a water-absorbent pad. The 6-carboxyfluorescein (6-FAM)-labeled target product can specifically hybridize with the biotin-labeled probe to form a complex. Meanwhile, because the nonspecific products containing 6-FAM cannot hybridize with the biotin-labeled probes, they will bind to the control line containing anti-FITC. The principle is that after the amplification product containing biotin has been combined with a gold standard antibody against FITC, the immune complex is added dropwise to the sample pad. The immune complex diffuses through the gold standard pad chromatography membrane, and when it spreads to the detection line, the biotin labeled amplification product is captured by the antibody against biotin, forming a colored detection line on the test pad. The uncaptured immune complexes continue to diffuse to the quality control line, where they are captured by a specific antibody, forming a colored quality control line on the quality control pad. Due to easy visualization of the results, this is a suitable method for clinical sample testing. Since the LFD method can visualize the results of amplification, it is conceivable to combine the results of RPA with the LFD method.

Fig. 1.

Fig. 1.

Colloidal gold lateral flow dipstick (LFD) composition chart.

MATERIAL AND METHODS

Viral strains and clinical samples

Canine distemper virus Onderstepoort strain (CDV-GZ1), canine distemper virus 10th generation strain (CDV-10), canine parvovirus (CPV), canine adenovirus (CAV), and canine parainfluenza virus (CPIV) were provided by the Key Laboratory of Jilin Province for Zoonosis Prevention and Control at the Military Veterinary Institute, Academy of Military Medical Sciences, and were propagated in Vero cells, respectively. Nasal/oropharyngeal swabs were collected, respectively, from 24 dogs and 16 pandas of both sexes (various breeds and ages, with known and confirmed disease); they were provided by the Virology Laboratory of the Military Veterinary Research Institute, China, and kept at −80°C until use. The beagle dogs (a dog breed of specific pathogen-free grade) and samples required for testing were from Sino Biotechnology Co., Ltd., China.

RPA primers and probes for CDV detection

The nucleic acid sequences from the N gene of several lineages of CDV (accession numbers: KU725676.1, KU725679.1, KUGZ2, K265193.1, KR265196.1, KU5677.1, KU725678.1, AY390348.1, AB490680.1, and EU71633) were obtained from GenBank and aligned using the software DNAMAN 8. The CDV-specific RPA primers and probes (TwistAmp™ nfo, TwistDx, Cambridge, UK) were designed from the highly conserved consensus sequence of the N gene, according to the RPA guidelines (TwistAmp™ nfo, TwistDx). All the primers and TwistAmp™ nfo probe were synthesized and provided by Sangon (Sangon Biotech, Shanghai, China). R1, R2, and P represent the upstream and downstream primers and probe for the RPA-LFD detection method. F1 and F2 represent the upstream and downstream primers for the real-time RT-PCR detection method (Table 1).

Table 1. Primer sequences used in this study.

Name Sequence (5ʹ→3ʹ) References
T Biotin-TAGAATTGCTGAAATGATTTGTGATATAGA-dSpacer-AACTACATTGTGGAAGCTGG-C3Spacer
R1 ATCCTGCTAGCTAAAGCGGTGACTGCTCCTGAT
R2 FAM-CCCCATAGCATAACTCCAGAGCAATGGGTAGGA
F1 CGAGTCTTTGAGATAGGGTT [12, 19]
F2 CCTCCAAAGGGTTCCCATGA

DNA/RNA extraction

Viral RNA and DNA were extracted using a TIANamp Virus RNA kit and a TIANamp Virus DNA kit (Tiangen, Beijing, China), individually, according to the manufacturer’s protocols. A NanoDrop spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) was used to determine the quality of RNA. The OD260/OD280 value of the extracted RNA ranged from 1.8 to 2.0 and was transcribed into cDNA using a cDNA kit (Funeng, Shanghai, China), according to the manufacturer’s instructions, and stored at −80°C. In the present study, the cDNA of CDV-GZ1 was used as the positive control, the cDNA of Vero cells was used as the negative control, and Dulbecco’s modified Eagle medium (DMEM, Hyclone, Shanghai, China) was used as the blank control.

RPA-LFD assay for CDV detection

The RPA-LFD assay for CDV detection was performed in a 50-μL volume using a TwistAmp™ nfo kit (TwistDX). The mixture consisted of the following: R1, 2.1 µL (10 μmol/L); R2, 2.1 µL (10 μmol/L); T, 1.05 µL (10 μmol/L); primer-free rehydration buffer, 29.5 µL; sample, 4 µL; magnesium acetate, 2.5 µL (280 mM); and sterilized ultrapure water, 8.75 µL. To optimize the reaction temperature, reaction time, and primer-to-probe ratio, the reaction tubes were immediately incubated at 25, 30, 35, 39, and 40°C for 4, 6, 8, 10, 12, 14, 16, 18, and 20 min at primer-to-probe ratios of 1:1, 1.5:1, 2:1, 2.5:1, 3:1, 3.5:1, and 4:1. For each reaction, 25 μL of RPA product was added to the sample pads of the LFD for 5 min. As one reaction condition was being optimized, the other reaction conditions were set, according to the manufacturer’s instructions. The results were interpreted as follows: the presence of both red lines indicated a positive result, the presence of only the quality control line indicated a negative result, and invisibility of both lines indicated test failure. In order to achieve semi-quantitative detection of the target, the signal intensity of the peak area on the strips was further analyzed by ImageJ software to measure the ratio of the detection area (PT) to the quality control area (PC) [15]. The software used for data analysis was GraphPad Prism 5.

Enzyme-linked immunosorbent assay (ELISA) and real-time RT-PCR detection of CDV

The presence of the CDV-specific antigen was determined by a CDV ELISA kit (Langton, Shanghai, China), according to the manufacturer’s instructions. Real-time RT-qPCR was performed using a SYBR Green qPCR Master Mix kit (ExCell Biotech, Shanghai, China) on an ABI 7000 instrument (Applied Biosystems, Waltham, MA, USA). The 20-μL real-time qPCR system included 10 μL of the master mix, 1 μL of upstream and downstream primers, 4 μL of cDNA template, and 4 μL of ddH2O. The reaction procedure was predenaturation at 95°C for 5 min, denaturation at 95°C for 10 sec, then 40 cycles of 58°C for 60 sec.

Specificity and sensitivity analyzes of CDV by the RPA method

For the specificity analysis of the RPA-LFD assay, 10 ng of RNA or DNA of a panel of important dog pathogens, including CDV, CDV-10, CPV, CPIV, and CAV, was used as a template. Viral nucleic acids extracted from the infected cell culture supernatant with a known titer ranging from 1 × 105 the median tissue culture infective dose (TCID50)/mL to 1 × 10−2 TCID50/mL were serially diluted in DMEM to determine the detection limit of the RPA-LFD assay.

Validation of the RPA-LFD assay for CDV detection using simulated samples

Cell culture supernatants with different viral titers (106, 105, 104, 103, and 102 TCID50/mL) of CDV were mixed with nasal mucus collected from healthy dogs at a ratio of 1:10 to prepare a simulated test sample (at this point, the CDV concentration reached 105, 104, 103, 102, and 101 TCID50/mL). The RPA-LFD, ELISA, and RT-qPCR methods were then used to detect CDV in the samples to verify the applicability of the RPA-LFD assay [7].

Validation of the RPA-LFD assay for CDV detection using an animal model

Nine beagle dogs were inoculated with CDV to establish an in vivo infection model. The nasal mucus of infected dogs was then inoculated into Vero cells for virus isolation and observation by transmission electron microscopy. Transmission electron micrographs were taken on a JEOL JEM-1200+ instrument (JEOL, Tokyo, Japan) [11]. At the same time, nasal mucus, eye secretions, and blood of the infected dogs were collected for 10 consecutive days. The RPA-LFD assays were performed and compared with the CDV colloidal gold rapid test strips and real-time RT-PCR methods. All experimental protocols were approved and carried out in accordance with animal welfare guidelines and regulations.

Validation of the RPA-LFD assay for CDV detection using veterinary samples

RPA-LFD, ELISA, and real-time RT-PCR were used to detect CDV in 24 nasal swabs of diseased dogs (D1–D24) and 16 nasal swabs of giant pandas (P1–P16) to determine whether the RPA-LFD assay was suitable for clinical testing of CDV infection based on the consistency of the results. All animal experiments were approved by the Animal Care and Use Committee of Changchun Veterinary Research Institute. The IACUC approval number was AMMS-11-2022-009.

RESULTS

Optimization of the reaction conditions of the RPA-LFD assay for CDV detection

The optimal reaction conditions were determined according to the amount of detectable amplified product. As shown in Fig. 2A and 2B, the brightest detection line was found in the 35°C group, which had the highest PT/PC value of 0.806. Under normal circumstances, a human’s closed fist has a temperature of approximately 35°C. So, we tried to conduct the reaction in a closed fist and found that the temperature of the closed fist was suitable for the RPA reaction (Fig. 2C and 2D). As shown in Fig. 2E and 2F, the reddest detection line found in the 10-min group had the highest PT/PC value of 0.881, indicating that the optimum reaction time was within 10 min. As shown in Fig. 2G and 2H, the brightest detection line found in the 2:1 group had the highest PT/PC value of 1.401, indicating that the optimum primer-to-probe ratio was 2:1.

Fig. 2.

Fig. 2.

Optimization of the reaction conditions of the recombinase polymerase amplification-colloidal gold lateral flow dipstick (RPA-LFD) assay for canine distemper virus (CDV) detection. Strip imaging (A) and grayscale analysis (B) of reactions at different temperatures. Strip imaging (C) and grayscale analysis (D) of reactions in a closed fist (35°C). Strip imaging (E) and grayscale analysis (F) of different reaction times. Strip imaging (G) and grayscale analysis (F) of reactions using different primer-to-probe ratios. NC stands for negative control, PC stands for positive control, BC stands for blank control, and FC stands for closed fist group.

Specificity and sensitivity analyzes of CDV by the RPA method

As shown in Fig. 3A and 3B, the results revealed that only the CDV, CDV-10, and PC viruses could be detected in triplicate by our RPA-LFD assay, demonstrating the high specificity and repeatability of this method. The sensitivity of this test was determined by detecting CDV at a concentration range from 1 × 10−2 to 1 × 104 TCID50/mL under the optimal reaction conditions. At the same time, the sensitivity of the RPA-LFD assay was also compared with that of the ELISA and real-time RT-PCR methods. As shown in Fig. 3C and 3D, the intensity of the detection lines tended to decrease with reduction of the target concentration, and there was no visible detection line in the negative control and blank control groups. As shown in Fig. 3C and 3E, the limit of CDV detection by the RPA-LFD assay was 1 × 101 TCID50/mL, whereas the CDV detection limit of ELISA and real-time RT-PCR were both 1 × 102 TCID50/mL, indicating that RPA-LFD was more sensitive than ELISA.

Fig. 3.

Fig. 3.

The recombinase polymerase amplification-colloidal gold lateral flow dipstick (RPA-LFD) assay for canine distemper virus (CDV) detection in simulated samples. Strip imaging (A) and grayscale analysis (B) of simulated test samples containing different titers of virus. The ELISA (C) and real-time RT-qPCR (D) results of simulated samples containing different titers of virus.

CDV detection in simulated samples by RPA-LFD

As shown in Fig. 4, consistent with the ELISA and real-time RT-PCR assay results, the RPA-LFD method was able to detect the CDV spiked in the nasal mucus collected from healthy animals, indicating that the animal sample matrix did not affect the RPA-LFD assay.

Fig. 4.

Fig. 4.

Specificity and sensitivity of the recombinase polymerase amplification-colloidal gold lateral flow dipstick (RPA-LFD) assay for canine distemper virus (CDV) detection. Strip imaging (A) and grayscale analysis (B) of reactions using different virus samples. Strip imaging (C) and grayscale analysis (D) of reactions using different virus titers. (E) The results of detecting different titers of virus by ELISA. (F) The results of detecting different titers of virus by real-time RT-qPCR.

CDV detection in an animal model by RPA-LFD

Nine beagle dogs were inoculated with CDV at 106 TCID50/mL (6 mL). The dogs started to have a fever on the third day after CDV inoculation, and the eye secretions became viscous beginning on the fourth day postinfection. The electron microscopy results also showed that CDV was found in the nasal mucus on the fourth day postinfection (Fig. 5A). As shown in Table 2, the nasal secretions and eye secretions showed positive results by the CDV colloidal gold rapid test strips, ELISA, and real-time RT-PCR beginning on the fifth day postinfection. However, CDV was detected by RPA-LFD in the nasal secretions, blood, and eye secretions beginning on the fourth day postinfection, suggesting that the RPA-LFD assay was more sensitive than the colloidal gold test strip, ELISA, and real-time RT-PCR methods. These results also indicate that the RPA-LFD assay is promising for the rapid detection of CDV.

Fig. 5.

Fig. 5.

Test results of animal samples. The transmission electron micrograph of canine distemper virus (CDV) isolated from the beagle dog infection model.

Table 2. Comparison of canine distemper virus (CDV) detection by recombinase polymerase amplification-colloidal gold lateral flow dipstick (RPA-LFD), ELISA, and real-time RT-qPCR.

Detection
method
RPA colloidal gold ELISA RT-qPCR RPA colloidal gold ELISA RT-qPCR RPA colloidal gold ELISA RT-qPCR

Sample No./
Sample Type
N N N N B B B B E E E E
D1-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D1-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D1-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D2-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D2-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D2-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D3-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D3-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D3-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D4-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D4-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D4-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D5-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D5-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D5-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D6-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D6-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D6-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D7-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D7-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D7-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D8-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D8-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D8-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D9-1 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D9-2 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)
D9-3 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+) 4 (+) 5 (+) 5 (+) 5 (+)

N, nasal secretions; B, blood; E, eye secretions; colloidal gold-CDV, colloidal gold rapid test strips; 4 (+), CDV was detected in samples on the fourth day; 5 (+), CDV was detected in samples on the fifth day.

Clinical application of the RPA-LFD assay for CDV detection

The 40 clinically collected samples from dogs and pandas (nasal swab) were tested for CDV by RPA-LFD, ELISA, and real-time RT-PCR methods, respectively. As shown in Table 3, the consistent results of these three methods proved that the newly established RPA-LFD assay could be used for the specific detection of CDV in veterinary specimens from different animals.

Table 3. Comparison of canine distemper virus (CDV) detection in clinical samples by Recombinase polymerase amplification-lateral flow dipstick (RPA-LFD), ELISA, and real-time RT-PCR.

Sample Sample No. RPA-LFD ELISA (ng/L)
(content of CDV)
Real-time
RT-qPCR (Ct)
Dog D1 + 24.30 33.20
D2 + 30.20 29.69
D3 + 19.69 28.10
D4 - 0 >39
D5 + 21.03 36.09
D6 + 30.12 35.67
D7 + 25.01 36.21
D8 + 29.61 34.81
D9 + 25.61 36.25
D10 - 0 >39
D11 + 24.09 34.52
D12 + 19.67 39.64
D13 + 20.96 34.95
D14 - 10.64 >39
D15 + 0 29.64
D16 + 29.65 26.02
D17 + 30.21 35.72
D18 + 21.03 36.00
D19 + 19.65 39.14
D20 - 0 >39
D21 + 23.15 34.08
D22 + 19.65 35.78
D23 + 20.13 26.17
D24 + 19.63 37.55

Panda P1 - 0 >39
P2 - 0 >39
P3 - 0 >39
P4 - 0 >39
P5 + 0 >39
P6 - 0 >39
P7 - 0 >39
P8 - 0 >39
P9 - 0 >39
P10 - 0 >39
P11 - 0 >39
P12 + 31.05 36.02
P13 - 0 >39
P14 - 0 >39
P15 + 25.63 26.27
P16 - 0 >39

DISCUSSION

CDV is highly contagious and extremely lethal. When one animal develops canine distemper, the disease can spread rapidly to the same type of animal and can cause significant losses if it is not controlled [2, 4, 14]. At present, there is no specific treatment for canine distemper, and regular vaccination is only used for prevention. The main methods for detecting CDV include pathogen detection by electron microscopy, serological test methods such as ELISA, and molecular biological methods such as real-time RT-PCR [3, 8, 20]. However, these complex methods are generally limited to research laboratories and are unsuitable for preliminary on-site testing in harsh outdoor environments. The results of this study indicate that the RPA-LFD assay could detect CDV specifically within 5 min, without the need for precise instruments such as a thermocycler. The LFD method uses a vacuum-sealing device in which the amplification products can be directly put into a reaction tube to avoid aerosol contamination. The LFD method is also more convenient to carry out and can avoid errors caused by manual handling. Here, the combination of RPA and the LFD method could be used to visualize and measure the amplified targets in a short time. According to the sensitivity data analysis, it was found that the CDV titer was linear with the grayscale analysis.

The principle of RPA detection involves the complementary pairing of nucleic acids; thus, this method could improve the sensitivity and specificity significantly over LFD alone. It could also overcome the problems of false-positive and false-negative results found with commercial canine distemper colloidal gold test strips [19]. A total of 10 sets of primers were initially designed for this experiment, but only one set of primers we reported here had a good specificity. At the same time, the probe could be adjusted to change the output mode of the amplification results for different experimental conditions. Later, in the laboratory, this method could also be combined with the dye SYBR Green I so that the target product appeared as fluorescent green and the non-target product was red-brown (data not shown) [12].

The most important and crucial aspect of the RPA experiment is the design of the primers and probes. A total of ten sets of primers were designed in this experiment, with three of them able to initiate amplification reactions. However, only one set of primers demonstrated specificity and effectiveness. Primers can ensure the accuracy of the experimental results. At the same time, the design of the probe can be adjusted to cater to the different experimental conditions, such as combining it with the horizontal LFD for nucleic acid testing to become a test strip output method that can make the results visible. RPA is also time and temperature sensitive. The reaction temperature and time that are too high, too long, or too low, or too short can have a fundamental impact on the outcome of the entire experiment. Therefore, under different experimental conditions, it is necessary to optimize the reaction conditions and system to achieve the best detection sensitivity and specificity. In this study, we aimed to establish an assay to detect CDV quickly, sensitively, and effectively based on RPA technology in combination with the LFD method.

In conclusion, the novel RPA-LFD assay described herein could detect CDV in virus-infected tissue culture samples as well as in veterinary clinical samples with high sensitivity and specificity. The advantages of this method are that it can be performed in real time and it is accurate, rapid, and instrument-free. Furthermore, this method might be applied for the development of new CDV initial detection methods. It could be used in semi-quantitative analysis not only in clinical fields, but also in experimental studies of other viruses. This study successfully constructed a CDV RPA-LFD rapid detection method that provided a theoretical foundation for the establishment of a rapid detection method for a strong pathogen in high-level biosafety laboratories as the next step.

POTENTIAL CONFLICTS OF INTEREST

None of the authors of this paper has any financial or personal relationships with other people or organizations that could inappropriately influence or bias the content of the paper. The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.

Acknowledgments

This work was supported by the National Key Research and Development Program of China (Grant No. 2016YFD0501001).

REFERENCES

  • 1.Avendaño R, Barrueta F, Soto-Fournier S, Chavarría M, Monge O, Gutiérrez-Espeleta GA, Chaves A. 2016. Canine Distemper Virus in Wild Felids of Costa Rica. J Wildl Dis 52: 373–377. doi: 10.7589/2015-02-041 [DOI] [PubMed] [Google Scholar]
  • 2.Bouvet J, Cariou C, Poulard A, Oberli F, Cupillard L, Guigal PM. 2018. Compatibility between a rabies vaccine and a combined vaccine against canine distemper, adenovirosis, parvovirosis, parainfluenza virus and leptospirosis. Vet Immunol Immunopathol 205: 93–96. doi: 10.1016/j.vetimm.2018.11.001 [DOI] [PubMed] [Google Scholar]
  • 3.Cho HS, Park NY. 2005. Detection of canine distemper virus in blood samples by reverse transcription loop-mediated isothermal amplification. J Vet Med B Infect Dis Vet Public Health 52: 410–413. doi: 10.1111/j.1439-0450.2005.00886.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Coffin DL, Liu C. 1957. Studies of canine distemper infection by means of fluorescein-labeled antibody. II. The pathology and diagnosis of the naturally occurring disease in dogs and the antigenic nature of the inclusion body. Virology 3: 132–145. doi: 10.1016/0042-6822(57)90028-4 [DOI] [PubMed] [Google Scholar]
  • 5.Elia G, Decaro N, Martella V, Cirone F, Lucente MS, Lorusso E, Di Trani L, Buonavoglia C. 2006. Detection of canine distemper virus in dogs by real-time RT-PCR. J Virol Methods 136: 171–176. doi: 10.1016/j.jviromet.2006.05.004 [DOI] [PubMed] [Google Scholar]
  • 6.Frisk AL, König M, Moritz A, Baumgärtner W. 1999. Detection of canine distemper virus nucleoprotein RNA by reverse transcription-PCR using serum, whole blood, and cerebrospinal fluid from dogs with distemper. J Clin Microbiol 37: 3634–3643. doi: 10.1128/JCM.37.11.3634-3643.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Heldt S, Prattes J, Eigl S, Spiess B, Flick H, Rabensteiner J, Johnson G, Prüller F, Wölfler A, Niedrist T, Boch T, Neumeister P, Strohmaier H, Krause R, Buchheidt D, Hoenigl M. 2018. Diagnosis of invasive aspergillosis in hematological malignancy patients: Performance of cytokines, Asp LFD, and Aspergillus PCR in same day blood and bronchoalveolar lavage samples. J Infect 77: 235–241. doi: 10.1016/j.jinf.2018.05.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Jóźwik A, Frymus T. 2005. Comparison of the immunofluorescence assay with RT-PCR and nested PCR in the diagnosis of canine distemper. Vet Res Commun 29: 347–359. doi: 10.1023/B:VERC.0000048528.76429.8b [DOI] [PubMed] [Google Scholar]
  • 9.Kerdiles YM, Cherif B, Marie JC, Tremillon N, Blanquier B, Libeau G, Diallo A, Wild TF, Villiers MB, Horvat B. 2006. Immunomodulatory properties of morbillivirus nucleoproteins. Viral Immunol 19: 324–334. doi: 10.1089/vim.2006.19.324 [DOI] [PubMed] [Google Scholar]
  • 10.Li Y, Li L, Fan X, Zou Y, Zhang Y, Wang Q, Sun C, Pan S, Wu X, Wang Z. 2018. Development of real-time reverse transcription recombinase polymerase amplification (RPA) for rapid detection of peste des petits ruminants virus in clinical samples and its comparison with real-time PCR test. Sci Rep 8: 17760. doi: 10.1038/s41598-018-35636-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Luzuriaga MA, Welch RP, Dharmarwardana M, Benjamin CE, Li S, Shahrivarkevishahi A, Popal S, Tuong LH, Creswell CT, Gassensmith JJ. 2019. Enhanced stability and controlled delivery of mof-encapsulated vaccines and their immunogenic response in vivo. ACS Appl Mater Interfaces 11: 9740–9746. doi: 10.1021/acsami.8b20504 [DOI] [PubMed] [Google Scholar]
  • 12.Ma C, Chen M, He H, Chen L. 2019. Detection of coralyne and heparin by polymerase extension reaction using SYBR Green I. Mol Cell Probes 46: 101423. doi: 10.1016/j.mcp.2019.101423 [DOI] [PubMed] [Google Scholar]
  • 13.Martella V, Blixenkrone-Møller M, Elia G, Lucente MS, Cirone F, Decaro N, Nielsen L, Bányai K, Carmichael LE, Buonavoglia C. 2011. Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain. Vaccine 29: 1222–1227. doi: 10.1016/j.vaccine.2010.12.001 [DOI] [PubMed] [Google Scholar]
  • 14.Molenaar RJ, Buter R. 2018. Outbreaks of canine distemper in Dutch and Belgian mink farms. Vet Q 38: 112–117. doi: 10.1080/01652176.2018.1544427 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671–675. doi: 10.1038/nmeth.2089 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shin YJ, Cho KO, Cho HS, Kang SK, Kim HJ, Kim YH, Park HS, Park NY. 2004. Comparison of one-step RT-PCR and a nested PCR for the detection of canine distemper virus in clinical samples. Aust Vet J 82: 83–86. doi: 10.1111/j.1751-0813.2004.tb14651.x [DOI] [PubMed] [Google Scholar]
  • 17.Wang J, Wang J, Li R, Liu L, Yuan W. 2017. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification. BMC Vet Res 13: 241. doi: 10.1186/s12917-017-1180-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wilkes RP, Tsai YL, Lee PY, Lee FC, Chang HF, Wang HT. 2014. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction. BMC Vet Res 10: 213. doi: 10.1186/s12917-014-0213-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yang Y, Qin X, Song Y, Zhang W, Hu G, Dou Y, Li Y, Zhang Z. 2017. Development of real-time and lateral flow strip reverse transcription recombinase polymerase Amplification assays for rapid detection of peste des petits ruminants virus. Virol J 14: 24. doi: 10.1186/s12985-017-0688-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhao JJ, Yan XJ, Chai XL, Martella V, Luo GL, Zhang HL, Gao H, Liu YX, Bai X, Zhang L, Chen T, Xu L, Zhao CF, Wang FX, Shao XQ, Wu W, Cheng SP. 2010. Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from breeding foxes, raccoon dogs and minks in China. Vet Microbiol 140: 34–42. doi: 10.1016/j.vetmic.2009.07.010 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Veterinary Medical Science are provided here courtesy of Japanese Society of Veterinary Science

RESOURCES