Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Jun 7.
Published in final edited form as: J Hypertens. 2017 Sep;35(9):1899–1908. doi: 10.1097/HJH.0000000000001378

Sodium butyrate suppresses angiotensin II-induced hypertension by inhibition of renal (pro)renin receptor and intrarenal renin–angiotensin system

Lei Wang a,*, Qing Zhu a,*, Aihua Lu a, Xiaofen Liu a, Linlin Zhang a, Chuanming Xu a, Xiyang Liu a, Haobo Li a, Tianxin Yang a,b
PMCID: PMC11157961  NIHMSID: NIHMS1995285  PMID: 28509726

Abstract

Objectives:

Butyrate, a short-chain fatty acid, is the end product of the fermentation of complex carbohydrates by the gut microbiota. Recently, sodium butyrate (NaBu) has been found to play a protective role in a number of chronic diseases. However, it is still unclear whether NaBu has a therapeutic potential in hypertension. The present study was aimed to investigate the role of NaBu in angiotensin II (Ang II)-induced hypertension and to further explore the underlying mechanism.

Methods:

Ang II was infused into uninephrectomized Sprague-Dawley rats with or without intramedullary infusion of NaBu for 14 days. Mean arterial blood pressure was recorded by the telemetry system. Renal tissues, serum samples, and 24-h urine samples were collected to examine renal injury and the regulation of the (pro)renin receptor (PRR) and renin.

Results:

Intramedullary infusion of NaBu in Sprague-Dawley rats lowered the Ang II-induced mean arterial pressure from 129 ± 6 mmHg to 108 ± 4 mmHg (P < 0.01). This corresponded with an improvement in Ang II-induced renal injury, including urinary albumin, glomerulosclerosis, and renal fibrosis, as well as the expression of inflammatory mediators tumor necrosis factor α, interleukin 6. The renal expression of PRR, angiotensinogen, angiotensin I-converting enzyme and the urinary excretion of soluble PRR, renin, and angiotensinogen were all increased by Ang II infusion but decreased by NaBu treatment. In cultured innermedullary collecting duct cells, NaBu treatment attenuated Ang II-induced expression of PRR and renin.

Conclusion:

These results demonstrate that NaBu exerts an antihypertensive action, likely by suppressing the PRR-mediated intrarenal renin–angiotensin system.

Keywords: Ang II, blood pressure, butyrate, gut microbiota, renin–angiotensin system, short-chain fatty acid

INTRODUCTION

Hypertension is a leading modifiable risk factor for both cardiovascular disease and chronic kidney disease. The prevalence of hypertension globally increased from 0.6 billion in 1980 to 1.39 billion in 2010 [1]. Chronic high blood pressure (BP) leads to inflammation and organ damage. Thus it is important to understand the underlying mechanism and to learn new approaches to the treatment of hypertension. The renin–angiotensin system (RAS) is one of the most important for the regulation of BP, cardiovascular function, sodium reabsorption and renal hemodynamics. Recent research demonstrates that, in addition to systemic RAS, local RAS exists in a variety of tissues, including the kidney [2,3]. Mounting evidence shows that the intrarenal RAS plays a critical role in angiotensin II (Ang II)-induced hypertension. In response to Ang II, intrarenal RAS is activated, as reflected by increased urinary and renal medullary renin levels [4]. This effect is direct since exogenous Ang II treatment induces endogenous Ang II generation by increasing renin mRNA and (pro)renin protein levels in the innermedullary collecting duct (IMCD) cells [5]. Recent studies show that overexpression of renin in renal collecting duct cells results in spontaneous hypertension and that knockout of renin in the collecting duct controls Ang II-induced hypertension in animals [6,7].

The (pro)renin receptor (PRR) is a new component of the RAS. It is a 350-amino acid transmembrane protein that binds renin and prorenin with equal affinity to increase their catalytic activity [8,9]. Our previous studies demonstrate an important role of PRR in regulating the activity of intrarenal RAS [10–12]. We showed that chronic infusion of Ang II in rats elevates the medullary PRR protein levels, which directly upregulates renin activity and renin content during hypertension. The inhibitor of PRR, PRO20 [the first 20 amino acids of the mouse prorenin prosegment, synthesized by the Neo Peptide Company (Cambridge, Massachusetts, USA)] attenuates Ang II-induced increases in BP, and renin activity [10]. The extracellular domain of PRR is cleaved to produce a soluble form of PRR. Soluble PRR (sPRR) is detected in serum and urine of humans and animals, which is associated with heart failure, renal diseases, and hypertension [13–16].

Short-chain fatty acids (SCFAs) are end products from the fermentation of complex carbohydrates by the gut microbiota [17]. The most abundant SCFAs, acetate, propionate, and butyrate, are generated in the intestine by anaerobic bacteria, after which they enter the bloodstream and have roles in energy metabolism, immune responses, and pathogenesis [18–20]. Among SCFAs, butyrate has been extensively investigated. A four-carbon molecule, it becomes sodium butyrate (NaBu) after receiving sodium. Researchers have found that NaBu has protective effects in inflammatory bowel diseases, obesity, and diabetes that involve cell proliferation, apoptosis, and energy metabolism in animal or cellular models [21–23]. Increasing evidence also suggests that NaBu works as an inhibitor of histone deacetylases (HDACs) to modulate gene expression [24–26]. Recently, butyrate has been reported to attenuate Ang II-induced hypertension possibly through alterations in gut dysbiosis [27]. However, it remains unclear how NaBu exerts renal protective effects and contributes to the treatment of hypertension. In this study, we investigated the beneficial effects of NaBu in renal protection and in the regulation of BP in Ang II-dependent hypertension through the inhibition of PRR and intrarenal RAS.

METHODS

Animals

Male Sprague-Dawley rats (250–300 g; the animal center of Guangdong Province, China) were cage housed and maintained in a temperature-controlled room with 12 : 12 light–dark cycle, with free access to tap water and standard rat chow. The animal protocols were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University and University of Utah. The animals were euthanized with an excess intravenous dose of pentobarbital sodium (150 mg/kg) after experiments.

Chronic infusion of angiotensin II and sodium butyrate, monitoring of blood pressure, measurement of urinary albumin, assay of plasma and urinary creatinine, and collection of kidney

Rats were anesthetized with 2% isoflurane and unineph-rectomized 1 week before. Ang II was infused for 14 days (Sigma, 200 ng/kg min) via Alzet osmotic minipumps (model 2002; Cupertino, California, USA) implanted subcutaneously. The left kidney was exposed from the flank region and an interstitial infusion catheter was placed into the renal medulla, approximately 4–5 mm underneath the kidney surface, and secured using 3 mol/l Vetbond tissue (3M, Saint Paul, Minnesota, USA) adhensive and a small piece of fat tissue [28]. The catheter was connected to the other subcutaneous osmotic pump (same model as above) containing vehicle or NaBu (Sigma, 1 μg/kg min). The telemetry system (Data Science International, St Paul, Minnesota, USA) was implanted to record mean arterial BP as we described previously [29]. At the endpoint of experiment, 24-h urine samples were collected with metabolic cages. Urinary albumin was measured using rat albumin ELISA kit (Cloud-clone Corp., Houston, Texas, USA). Blood samples were collected from abdominal aorta while rats were deeply anesthetized with 2% isoflurane. Creatinine concentrations in plasma and urine were accessed by ELISA kit (BioAsssay Systems, Hayward, California, USA). Kidneys were removed and cut longitudinally. Half of the kidney was fixed in10% paraformaldehyde and the other half dissected into cortex and medulla, and frozen in liquid N2 and stored at −80°C.

Morphological and immunohistochemical analysis

The fixed kidneys were paraffin embedded and cut into 4-μm sections. For morphological analysis, the tissue sections were stained with periodic acid-Schiff staining. Glomerular damage was morphologically evaluated by two independent examiners who were blinded as to animal groups and semiquantitatively scored based on the degree of glomerular damage as described previously [29–31]. In brief, a minimum of 20 glomeruli in each specimen were examined and the severity of lesions were graded from 0 to 4 according to the percentage of glomerular involvement. Thus, 0 = normal; 1 = less than 25% of glomerular area involved; 2 = 25–50%; 3 = 50–75%; and 4 = more than 75% of tuft area involved. The average scores from counted glomeruli were used as the glomerular damage index for each animal. For immunostaining, the slides were incubated in 0.3% H2O2 diluted in 100% MeOH for 30 min to block endogenous peroxidase activity. The sections were incubated at room temperature for 30 min in phosphate-buffered saline (PBS) containing 1% BSA (Sigma, St. Louis, Missouri, USA) to block nonspecific binding and then incubated overnight at 4°C in a humidified chamber with an antibody against PRR [rabbit polyclonal immunoglobulin G (IgG); Abcam, San Francisco, California, USA] diluted 1 : 200 in PBS containing 1% BSA. Then the slides were incubated for 60 min at room temperature in a humidified chamber with a biotinylated goat antirabbit IgG diluted 1 : 200 in PBS as a secondary antibody. Then the slides were incubated with 50 μl of diaminobenzadine (Boster Biological Technology Co., Ltd, Wuhan, China) as a substrate, counterstained with hematoxylin (Leagene, Beijing, China), dehydrated, and fixed with permount histological neutral balsam (HAORAN Biological Technology Co., Ltd, Shanghai, China).

Quantitative reverse transcriptase PCR

For quantitative reverse transcription PCR (qRT-PCR), total RNA isolation were performed as previously described [11]. Reverse transcription and SYBR green based quantitative polymerase chain reaction were performed as the manufacturer’s instructions (Roche, Indianapolis, Indiana, USA). Primers for renin were GATCACCATGAAGGGGGTCTCTGT (sense) and GTTCCTGAAGGGATTCTTTTGCAC (antisense); primers for tumor necrosis factor α (TNF-α) were CCACGTCGTAGCAAACCACCAAG (sense) and CAGGTACATGGGCTCATACC (antisense); primers for interleukin 6 were CCAATTTCCAATGCTCTCCT (sense) and ACCACAGTGAGGAATGTCCA (antisense); primers for GAPDH were GTCTTCACTACCATGGAGAAGG (sense) and TCATGGATGACCTTGGCCAG (antisense).

Western blotting

Renal tissues or cells were lyzed and subsequently sonicated in PBS that contained 1% Triton X-100 (Sigma, Milwaukee, Wisconsin, USA), 250 μmol/L phenylmethanesulfonyl fluoride, 2 mmol/L EDTA, and 5 mmol/L dithiothrietol (pH 7.5). Protein concentrations were determined by the use of Comassie reagent (Sigma). Thirty milligrams of protein for each sample was denatured in boiling water for 10 min then separated by SDS-PAGE and transferred onto nitrocellulose membranes. The blots were blocked overnight with 5% nonfat dry milk in Tris-buffered saline (HAORAN Biological Technology Co, Ltd), followed by incubation overnight with rabbit anti-PRR or α-smooth muscle actin (α-SMA) antibody (Abcam Inc., Cambridge, Massachusetts, USA) at 48C. For β-actin, the membranes were stripped and reprobed with mouse anti β-actin antibody. After washing with Tris-buffered saline, membranes were incubated with goat antirabbit or goat antimouse horseradish peroxidase-conjugated secondary antibody and visualized using enhanced chemiluminescence. The intensities of blotted bands were quantified with the software (ImageJ, freedownloadfrom http://rsbweb.nih.gov/ij/).

Enzyme-linked immunosorbent assay

sPRR in urine were detected with commercially available enzyme immunoassay kits according to the manufacturer’s instructions (Immuno-Biological Laboratories Co., Ltd, Toronto, Canada) [16]. Renin activities in urine and cell culture medium were determined under the native condition by measurement of Ang I generation (Cayman Chemical, Ann Arbor, Michigan, USA) as previously described [11]. Angiotensinogen (AGT) content in urine was accessed as described by the manufacturer’s instruction of the commercial kit (Cloud-Clone Corp.).

Primary cultures of rat innermedullary collecting duct cells

Primary cultures enriched in IMCD cells were prepared from pathogen-free male Sprague-Dawley rats (40–100 g body weight) as previously described [32]. The IMCD cells were pretreated with NaBu (2 μmol/L) for 1 h, followed by Ang II treatment at 1 μmol/L. After 24 h, the cells were harvested for gene expression analysis and the media for renin assay.

Statistical analysis

Data are summarized as mean ± stand error. Statistical analysis for animal and cell culture experiments was performed using analysis of variance with the Bonferroni test for multiple comparisons or by unpaired Student t test for two comparisons. A P value below 0.05 was considered statistically significant.

RESULTS

Effects of sodium butyrate on mean arterial pressure, cardiac hypertrophy, and glomerular injury in angiotensin II-induced hypertensive rats

To examine the functional role of NaBu in BP regulation, we gave uninephrectomized Sprague-Dawley rats a subcutaneous infusion of Ang II for 14 days with or without an infusion of NaBu. The Ang II infusion caused considerable increases in the mean arterial pressure (MAP) of the rats compared with that of the control group, which was substantially attenuated in the Ang II and NaBu group (Fig. 1a). BP in the Ang II group and the control group was 129 ± 6 mmHg and 104 ± 2 mmHg, respectively. In the Ang II and NaBu group, MAP showed an acute rise on day 1, was especially reduced on day 2, and became more significantly blunted thereafter; it was only 108 ± 4 mmHg by the end of the experiment. MAP remained unchanged in the control rats during the entire experiment. Consistent with the BP data, the cardiac hypertrophy induced by Ang II treatment was significantly blocked by NaBu infusion (Fig. 1b).

FIGURE 1.

FIGURE 1

Open in a new tab

Effects of NaBu on Ang II-induced increases in mean arterial pressure, heart weight percentage, urinary albumin excretion. (a) 10-day mean arterial pressure (n = 10). (b) Heart weight percentage (n = eight per group). (c) Urinary albumin excretion (n = nine per group). (d) CCr (n = six per group). **P < 0.01 or *P < 0.05 vs. all other groups. NS means no significance. Ang II, angiotensin II; CCr, creatinine clearance; MAP, mean arterial pressure; NaBu, sodium butyrate.

We subsequently examined a series of indices of glomerular injury. Ang II infusion caused a considerable increase in urinary albumin levels, which were attenuated by NaBu infusion (Fig. 1c). There was no difference in creatinine clearances among the three animal groups (Fig. 1d). Morphological analysis showed that Ang II produced glomerular sclerotic damages as indicated by glomerular mesangial expansion with hypercellularity, capillary collapse, and matrix deposition in glomeruli (Fig. 2a). The glomerular damage index was substantially higher in Ang II-treated rats; however, Ang II-induced glomerular damage was significantly attenuated by NaBu infusion (Fig. 2a and b). The expression of α-SMA in the renal cortex as an index of interstitial injuries was determined by immunoblotting. The results showed that Ang II increased the levels of α-SMA and that this increase was attenuated by NaBu (Fig. 2c). Together, these data suggested that NaBu exerted a protective effect against glomerular injury during Ang II-induced hypertension.

FIGURE 2.

FIGURE 2

Open in a new tab

Effects of NaBu on Ang II-induced morphological changes and interstitial injury in glomeruli. (a) Representation photomicrographs showing glomerular structures (periodic acid-schiff staining, 400×) and summarized glomerular damage index by semiquantitation of scores in different groups. (b) Representative immunoblots of α-SMA in renal cortex and summarized intensities of blots. N = six for each group. Ang II, angiotensin II; NaBu, sodium butyrate; α-SMA, α-smooth muscle actin.

Effects of sodium butyrate on angiotensin II-induced inflammation in the kidney

In Ang II-induced hypertension renal inflammation is a well known important hallmark. We performed qRT-PCR to assess the renal expression of inflammatory markers such as TNF-α and interleukin 6. Both TNF-α and interleukin 6 mRNA levels increased with Ang II infusion and diminished with chronic intrarenal infusion of NaBu (Fig. 3a–d).

FIGURE 3.

FIGURE 3

Open in a new tab

Effects of NaBu on Ang II-induced inflammation in the kidney by real-time reverse transcription PCR analysis. (a) TNF-α mRNA levels in the renal medulla. (b) TNF-α mRNA levels in the renal cortex. (c) IL-6 mRNA levels in the renal medulla. (d) IL-6 mRNA levels in the renal cortex. N = 6 for each group. Ang II, angiotensin II; NaBu, sodium butyrate; TNF-α, tumor necrosis factor α.

Effects of sodium butyrate on (pro)renin receptor expression in the kidney

PRR in the distal nephron has been implicated in mediating the hypertensive response of Ang II via enhancement of intrarenal RAS [10,33].We hypothesized that NaBu may act by targeting PRR and intrarenal RAS. To test this hypothesis, we examined the effects of NaBu on the levels of PRR and components of the tissue RAS following Ang II infusion. As previously reported, immunoblotting (Fig. 4a and b) showed that renal PRR protein levels were significantly increased in Ang II infused rats. This increase was blunted by NaBu infusion. Immunostaining showed that PRR labeling was mostly restricted to the intercalated cells of the collecting duct and was enhanced by Ang II, which was attenuated by NaBu infusion (Fig. 5). sPRR is detected in serum and urine and elevated under various physiological and pathological conditions [13–15]. As shown in Fig. 4c, the urinary sPRR level was elevated by Ang II infusion and decreased by NaBu infusion.

FIGURE 4.

FIGURE 4

Open in a new tab

Effects of NaBu on the regulation of PRR expression in the kidneys. (a) Representative immunoblots of PRR protein levels in the renal medulla and summarized intensities of blots (n = eight per group). (b) Representative immunoblots of PRR protein levels in the renal cortex and summarized intensities of blots (n = eight per group). (b) ELISA analysis of urinary sPRR (n = six per group). Ang II, angiotensin II; NaBu, sodium butyrate; PRR, (pro)renin receptor; sPRR, soluble (pro)renin receptor.

FIGURE 5.

FIGURE 5

Open in a new tab

Representative DAB IHC-stained sections of the renal medulla and cortex demonstrating the expression of renal PRR. White arrows point to the DAB staining area. n = five per group. Ang II, angiotensin II; DAB, diaminobenzidine; IHC, immunohistochemistry; NaBu, sodium butyrate.

Effects of sodium butyrate on angiotensin II-induced activation of the intrarenal renin–angiotensin system

Activation of renin response in the distal nephron is shown to mediate Ang II-induced hypertension [33]. This local renin response is reflected by increases in renin levels in the urine and the renal medulla. Following Ang II infusion, circulating renin is suppressed but intrarenal renin is upregulated [10]. First, qRT-PCR was used to assess renin mRNA expression. As expected, renal medullary renin mRNA was induced by Ang II infusion and was blunted by NaBu infusion (Fig. 6a). Urinary renin activity, renin content, and total renin content were all upregulated by Ang II and each of these was suppressed by NaBu infusion (Fig. 6b–d).

FIGURE 6.

FIGURE 6

Open in a new tab

Effects of NaBu on Ang II-induced renin expression in kidney and urinary renin release. (a) Renin mRNA levels in the renal medulla by real-time reverse transcription PCR analysis (n = eight per group). (b) ELISA analysis of renin activity in urine (n = six per group). (c) ELISA analysis of active renin content in urine (n = six per group). (d) ELISA analysis of total renin content in urine (n = six per group). Ang II, angiotensin II; NaBu, sodium butyrate.

AGT and angiotensin I-converting enzyme are important components of intrarenal RAS. Long-time infusion of Ang II stimulates AGT and angiotensin I-converting enzyme [34,35]. As shown in Fig. 7, AGT mRNA in the renal cortex and urinary excretion of AGT was induced by Ang II, findings that are consistent with previous work [34]. Such inductions of cortical expression and urinary excretion of AGT were remarkably decreased with NaBu treatment (Fig. 7a and b). Renal ACE expression was stimulated by Ang II and inhibited by NaBu (Fig. 7c and d).Taken together, these results indicate that NaBu infusion suppressed the activation of intrarenal RAS following Ang II infusion.

FIGURE 7.

FIGURE 7

Open in a new tab

Effects of NaBu on Ang II-induced AGT and ACE expression in kidney and urinary AGT excretion. (a) AGT mRNA levels in the renal cortex by real-time reverse transcription PCR analysis. (b) ELISA analysis of urinary AGT excretion. (c) ACE mRNA levels in the renal medulla by real-time reverse transcription PCR analysis. (d) ACE mRNA levels in the renal cortex by real-time reverse transcription PCR analysis. n = six per group. ACE, angiotensin-converting enzyme; AGT, angiotensinogen; Ang II, angiotensin II; NaBu, sodium butyrate.

Effect of sodium butyrate on angiotensin II-induced (pro)renin receptor expression and renin release in primary rat innermedullary collecting duct cells

To further determine the role of NaBu in suppressing Ang II-induced increases on PRR and renin, we prepared and treated primary rat IMCD cells with NaBu or NaBu plus Ang II. As shown in Fig. 8a, NaBu treatment abolished the increase in PRR protein levels induced by Ang II. There was no significant difference in PRR protein levels between cells treated with NaBu alone and control cells, suggesting that NaBu has no effect on the basal PRR expression level. Because renin release follows the activation of intrarenal RAS, we further assessed the effects of NaBu on renin activity and active renin content. Our results showed that 24-h Ang II treatment significantly increased both renin activity in the medium and active renin content, which were attenuated in cells treated with 2 mmol/L NaBu (Fig. 8b–c). Similarly, there was no significant difference between control cells and NaBu-treated cells in the levels of renin activity and active renin content in the medium. These results suggested that NaBu-regulated PRR expression and renin release in Ang II-treated primary IMCD cells.

FIGURE 8.

FIGURE 8

Open in a new tab

Effects of NaBu on Ang II-induced PRR expression and medium renin release of primary rat IMCD cells. The cells were exposed to 1 μmol/L Ang II with or without 2 μmol/L NaBu for 24 h. (a) representative immunoblots of PRR and summarized intensities of blots. (b) ELISA analysis of medium renin activity. (c) ELISA analysis of medium active renin content. n = six per group. Ang II, angiotensin II; IMCD, innermedullary collecting duct; PRR, (pro)renin receptor; NaBu, sodium butyrate.

DISCUSSION

Butyrate is an SCFA that is produced by the gut microbiota. Given the rising interest in the causal role of dysbiosis in a number of chronic diseases such as hypertension and chronic kidney disease, we investigated the function of butyrate during Ang II-induced hypertension. Accordingly, we examined the effect of NaBu on Ang II-induced hypertension and further explored the underlying mechanism, with an emphasis on PRR and intrarenal RAS. In Sprague-Dawley rats, intramedullary NaBu infusion remarkably suppressed elevation of Ang II-induced hypertension, attenuating glomerular injury, and inflammation. The antihypertensive, anti-inflammatory, and renal protective actions of NaBu were associated with a corresponding inhibition of renal PRR and the intrarenal renin response. We further provided in-vitro evidence from primary rat IMCD cells that NaBu exerted a direct inhibitory effect on PRR expression and renin levels induced by Ang II.

An increasing number of published papers demonstrate that the gut microbiota is associated with multiple chronic diseases, including diabetes, obesity, and cardiovascular diseases [20]. Recent studies reveal that the composition and richness of gut microbiota is significantly different in hypertensive animals [36,37]. Fecal transplantation suggests that the gut microbiota is causally linked to hypertension in Dahl rat [36]. Moreover, oral administration of sourmilk in animals or humans has been found to lower systemic BP [38]. However, it is still unclear how the gut microbiota exerts an impact on BP. Butyrate is an SCFA that is naturally metabolized by the gut microbiota, which has significant roles in cell proliferation, apoptosis, energy metabolism, and immune response [21,23,39]. Our data showed that intrarenal infusion of NaBu significantly decreased MAP from 129 ± 6 mmHg to 108 ± 3 mmHg (P < 0.01) after treatment with Ang II. In addition, NaBu infusion considerably improved Ang II-induced albuminuria, glomerulosclerosis, and renal interstitial injury. These results reveal the important role of NaBu in lowering BP and protecting against kidney injury during AngII-induced hypertension. Our work also provides clues that the gut microbiota may be involved in a counter-regulatory mechanism in BP control through metabolized products such as butyrate. In this regard, butyrate-producing bacteria may be promising candidates as probiotics for the treatment of hypertension.

Activation of PRR and intrarenal RAS represents the key to the pathogenesis of hypertension particularly during Ang II infusion. Our previous work reveals that the intramedullary infusion of PRR inhibitor PRO20, which interrupts the binding of prorenin to PRR, attenuates the increase of BP, renin activity, glomerullar damage, and inflammation induced by Ang II [10]. We further showed that mice lacking PRR in the collecting duct [collecting duct PRR knockout (KO)] were resistant to Ang II-induced hypertension [40]. Other investigators have shown that in mice, deletion of renin in the collecting duct produced a BP phenotype similar to that seen in collecting duct PRR KO mice [41]. In the present study, we found that when it was administered via intramedullary infusion, NaBu, acting like PRO20, exhibited potent antihypertensive action accompanied by an improvement in glomerular injury and renal inflammation. In parallel, NaBu suppressed renal PRR and renin levels in vivo and in vitro. Being capable of simultaneously targeting both PRR and renin in the distal nephron, NaBu may represent a potential therapeutic strategy for the long-term management of hypertension and its treatment and/or the prevention of renal injuries in Ang II-dependent hypertension.

The present study has several limitations. First, the current experimental design did not allow us to establish causality between the suppression of renal PRR and the antihypertensive effect of NaBu. Second, although we identified PRR and renin as the molecular targets of NaBu, the precise mechanism for its action remains unknown. NaBu has been reported to potentially serve as an HDAC inhibitor in several pathologic animal and cell line models [24–26]. HDACs are found to modulate gene expression in cells and tissues, including kidney. HDAC plays multiple roles during kidney development and the pathogenesis of renal diseases through inhibition of oxidative stress, inflammation, apoptosis, and DNA damage [42–45]. Cardinale et al. [45] revealed that HDAC activation is associated with hypertension in the spontaneously hypertensive rat. It has been well accepted that NaBu and other SCFAs are HDAC inhibitors with class I specificity and relatively weak inhibition activity. Additionally, in intestinal epithelial cells, NaBu can signal in G-protein receptor (GPR)-41/GPR-43 pathways to promote activation of MAP kinase and stimulation of proinflammatory cytokines [46]. A specific signaling pathway mediating the protective action of NaBu in the kidney needs to be determined in future studies. Lastly, our study lacks a physiological examination of the relevance of NaBu to gut microbiota. Although NaBu is infused at 1 μg/kg min, which appears to be a low dose, we were unable to determine the physiological concentrations of circulating or local NaBu under basal conditions or under an Ang II infusion state.

In conclusion, in the present study, we used an intrarenal infusion strategy to investigate the role of a gut microbiota metabolite, butyrate, in Ang II-induced hypertension. We found not only a significant BP-lowering and renal-protective effect of NaBu, but also a possible mechanism involving inhibition of PRR and intrarenal RAS. Although the physiological implications of this finding, particularly its relevance to the endogenous generation of butyrate from gut microbiota, remain to be investigated, solid data clearly demonstrate the therapeutic potential of this product in hypertension and renal injury.

Reviewers’ Summary Evaluations.

Referee 1

Using an angiotensin II-induced hypertension model, the authors evaluated the antihypertensive effects of butyrate perfused in the renal medullary and concluded that butyrate exerts antihypertensive and renoprotective effects via inhibition of the different components of renal RAS. Angiotensin II-dependent hypertension is not a common type of hypertension in humans, so the efficacy of butyrate should be evaluated with a model similar to essential hypertension. In addition, as a future therapeutic tool, butyrate must be effective by oral administration. This would be a considerable advance in the treatment of hypertension if the endogenous production of butyrate through the intestinal flora could be stimulated and lead to a decrease in blood pressure.

Referee 2

In a rat model of hypertension induced by angiotensin II infusion, the present work evaluated the antihypertensive effects of butyrate, a short-chain fatty acid and its action on the different components of renal RAS, particularly on the (pro)renin receptors. The butyrate was administered via intra-medullary infusion. The authors concluded that the butyrate has renal protective and antihypertensive effects via the inhibition of intrarenal RAS by suppressing the (pro)renin receptor expression.

ACKNOWLEDGEMENTS

The work was supported by National Natural Science Foundation of China Grant No. 91439205, No. 31330037, and No. 81600322; Fundamental Research Funds of Sun Yat-sen University 16ykpy47; Veterans Affairs Merit Review, and National Institutes of Health Grant DK094956 and DK104072. T.Y. is a Research Career Scientist in the Department of Veterans Affairs.

Abbreviations:

α-SMA

α-smooth muscle actin

ACE

angiotensin I-converting enzyme

AGT

angiotensinogen

Ang II

angiotensin II

IMCD

innermedullary collecting duct

MAP

mean arterial pressure

NaBu

sodium butyrate

PRR

(pro)renin receptor

RAS

renin–angiotensin system

SCFA

short-chain fatty acid

sPRR

soluble PRR

qRT-PCR

quantitative reverse transcription PCR

TNF-α

tumor necrosis factor α

Footnotes

Conflicts of interest

There are no conflicts of interest.

REFERENCES

  • 1.Mills KT, Bundy JD, Kelly TN, Reed JE, Kearney PM, Reynolds K, et al. Global disparities of hypertension prevalence and control: a systematic analysis of population-based studies from 90 countries. Circulation 2016; 134:441–450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Navar LG, Kobori H, Prieto MC, Gonzalez-Villalobos RA. Intratubular renin-angiotensin system in hypertension. Hypertension 2011; 57:355–362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Navar LG, Harrison-Bernard LM, Nishiyama A, Kobori H. Regulation of intrarenal angiotensin II in hypertension. Hypertension 2002; 39:316–322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Prieto-Carrasquero MC, Harrison-Bernard LM, Kobori H, Ozawa Y, Hering-Smith KS, Hamm LL, Navar LG. Enhancement of collecting duct renin in angiotensin II-dependent hypertensive rats. Hypertension 2004; 44:223–229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shao W, Seth DM, Navar LG. Augmentation of endogenous intrarenal angiotensin II levels in Val5-ANG II-infused rats. Am J Physiol Renal Physiol 2009; 296:F1067–F1071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ramkumar N, Ying J, Stuart D, Kohan DE. Overexpression of renin in the collecting duct causes elevated blood pressure. Am J Hypertens 2013; 26:965–972. [DOI] [PubMed] [Google Scholar]
  • 7.Ramkumar N, Stuart D, Rees S, Hoek AV, Sigmund CD, Kohan DE. Collecting duct-specific knockout of renin attenuates angiotensin II-induced hypertension. Am J Physiol Renal Physiol 2014; 307:F931–F938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Burckle C, Bader M. Prorenin and its ancient receptor. Hypertension 2006; 48:549–551. [DOI] [PubMed] [Google Scholar]
  • 9.Nguyen G, Delarue F, Burckle C, Bouzhir L, Giller T, Sraer JD. Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular responses to renin. J Clin Invest 2002; 109:1417–1427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang F, Lu X, Liu M, Feng Y, Zhou SF, Yang T. Renal medullary (pro)renin receptor contributes to angiotensin II-induced hypertension in rats via activation of the local renin-angiotensin system. BMC Med 2015; 13:278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wang F, Lu X, Peng K, Zhou L, Li C, Wang W, et al. COX-2 mediates angiotensin II-induced (pro)renin receptor expression in the rat renal medulla. Am J Physiol Renal Physiol 2014; 307:F25–F32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wang F, Lu X, Peng K, Du Y, Zhou SF, Zhang A, et al. Prostaglandin E-prostanoid4 receptor mediates angiotensin II-induced (pro)renin receptor expression in the rat renal medulla. Hypertension 2014; 64:369–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fukushima A, Kinugawa S, Homma T, Masaki Y, Furihata T, Abe T, et al. Increased plasma soluble (pro)renin receptor levels are correlated with renal dysfunction in patients with heart failure. Int J Cardiol 2013; 168:4313–4314. [DOI] [PubMed] [Google Scholar]
  • 14.Hamada K, Taniguchi Y, Shimamura Y, Inoue K, Ogata K, Ishihara M, et al. Serum level of soluble (pro)renin receptor is modulated in chronic kidney disease. Clin Exp Nephrol 2013; 17:848–856. [DOI] [PubMed] [Google Scholar]
  • 15.Morimoto S, Ando T, Niiyama M, Seki Y, Yoshida N, Watanabe D, et al. Serum soluble (pro)renin receptor levels in patients with essential hypertension. Hypertens Res 2014; 37:642–648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lu X, Wang F, Xu C, Soodvilai S, Peng K, Su J, et al. Soluble (pro)renin receptor via beta-catenin enhances urine concentration capability as a target of liver X receptor. Proc Natl Acad Sci U S A 2016; 113:E1898–E1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wong JM, de Souza R, Kendall CW, Emam A, Jenkins DJ. Colonic health: fermentation and short chain fatty acids. J Clin Gastroenterol 2006; 40:235–243. [DOI] [PubMed] [Google Scholar]
  • 18.Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006; 444:1027–1031. [DOI] [PubMed] [Google Scholar]
  • 19.Wen L, Ley RE, Volchkov PY, Stranges PB, Avanesyan L, Stonebraker AC, et al. Innate immunity and intestinal microbiota in the development of Type 1 diabetes. Nature 2008; 455:1109–1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kinross JM, Darzi AW, Nicholson JK. Gut microbiome-host interactions in health and disease. Genome Med 2011; 3:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li N, Hatch M, Wasserfall CH, Douglas-Escobar M, Atkinson MA, Schatz DA, et al. Butyrate and type 1 diabetes mellitus: can we fix the intestinal leak? J Pediatr Gastroenterol Nutr 2010; 51:414–417. [DOI] [PubMed] [Google Scholar]
  • 22.Machado RA, Constantino Lde S, Tomasi CD, Rojas HA, Vuolo FS, Vitto MF, et al. Sodium butyrate decreases the activation of NF-kappaB reducing inflammation and oxidative damage in the kidney of rats subjected to contrast-induced nephropathy. Nephrol Dial Transplant 2012; 27:3136–3140. [DOI] [PubMed] [Google Scholar]
  • 23.Sharma B, Singh N. Attenuation of vascular dementia by sodium butyrate in streptozotocin diabetic rats. Psychopharmacology (Berl) 2011; 215:677–687. [DOI] [PubMed] [Google Scholar]
  • 24.Chang PV, Hao L, Offermanns S, Medzhitov R. The microbial metabolite butyrate regulates intestinal macrophage function via histone deacetylase inhibition. Proc Natl Acad Sci U S A 2014; 111:2247–2252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Aguilar EC, Leonel AJ, Teixeira LG, Silva AR, Silva JF, Pelaez JM, et al. Butyrate impairs atherogenesis by reducing plaque inflammation and vulnerability and decreasing NFkappaB activation. Nutr Metab Cardiovasc Dis 2014; 24:606–613. [DOI] [PubMed] [Google Scholar]
  • 26.Nor C, Sassi FA, de Farias CB, Schwartsmann G, Abujamra AL, Lenz G, et al. The histone deacetylase inhibitor sodium butyrate promotes cell death and differentiation and reduces neurosphere formation in human medulloblastoma cells. Mol Neurobiol 2013; 48:533–543. [DOI] [PubMed] [Google Scholar]
  • 27.Kim S, Wang G, Lobaton G, Li E, Yang T, Raizada M. Os 05–10 the microbial metabolite, butyrate attenuates angiotensin ii-induced hypertension and dysbiosis. J Hypertens 2016; 34 (Suppl 1):e60–e61. [Google Scholar]
  • 28.Zhu Q, Wang Z, Xia M, Li PL, Zhang F, Li N. Overexpression of HIF-1α transgene in the renal medulla attenuated salt sensitive hypertension in Dahl S rats. Biochim Biophys Acta 2012; 1822:936–941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhu Q, Wang Z, Xia M, Li PL, Van Tassell BW, Abbate A, et al. Silencing of hypoxia-inducible factor-1alpha gene attenuated angiotensin II-induced renal injury in Sprague-Dawley rats. Hypertension 2011; 58:657–664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Raij L, Azar S, Keane W. Mesangial immune injury, hypertension, and progressive glomerular damage in Dahl rats. Kidney Int 1984; 26:137–143. [DOI] [PubMed] [Google Scholar]
  • 31.Nangaku M, Yamada K, Gariepy CE, Miyata T, Inagi R, Kurokawa K, et al. ET(B) receptor protects the tubulointerstitium in experimental thrombotic microangiopathy. Kidney Int 2002; 62:922–928. [DOI] [PubMed] [Google Scholar]
  • 32.Chou CL, Yip KP, Michea L, Kador K, Ferraris JD, Wade JB, Knepper MA. Regulation of aquaporin-2 trafficking by vasopressin in the renal collecting duct. Roles of ryanodine-sensitive Ca2+ stores and calmodulin. J Biol Chem 2000; 275:36839–36846. [DOI] [PubMed] [Google Scholar]
  • 33.Prieto MC, Botros FT, Kavanagh K, Navar LG. Prorenin receptor in distal nephron segments of 2-kidney, 1-clip goldblatt hypertensive rats. Ochsner J 2013; 13:26–32. [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhuo JL, Kobori H, Li XC, Satou R, Katsurada A, Navar LG. Augmentation of angiotensinogen expression in the proximal tubule by intra-cellular angiotensin II via AT1a/MAPK/NF-small ka, CyrillicB signaling pathways. Am J Physiol Renal Physiol 2016; 310:F1103–F1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Harrison-Bernard LM, Zhuo J, Kobori H, Ohishi M, Navar LG. Intrarenal AT(1) receptor and ACE binding in ANG II-induced hypertensive rats. Am J Physiol Renal Physiol 2002; 282:F19–F25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mell B, Jala VR, Mathew AV, Byun J, Waghulde H, Zhang Y, et al. Evidence for a link between gut microbiota and hypertension in the Dahl rat. Physiol Genomics 2015; 47:187–197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yang T, Santisteban MM, Rodriguez V, Li E, Ahmari N, Carvajal JM, et al. Gut dysbiosis is linked to hypertension. Hypertension 2015; 65:1331–1340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Jose PA, Raj D. Gut microbiota in hypertension. Curr Opin Nephrol Hypertens 2015; 24:403–409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Andrade-Oliveira V, Amano MT, Correa-Costa M, Castoldi A, Felizardo RJ, de Almeida DC, et al. Gut bacteria products prevent AKI induced by ischemia-reperfusion. J Am Soc Nephrol 2015; 26:1877–1888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Peng K, Lu X, Wang F, Nau A, Chen R, Zhou SF, et al. Collecting duct (Pro)renin receptor targets ENaC to mediate angiotensin ii-induced hypertension. Am J Physiol Renal Physiol 2017; 312:F245–F253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Song K, Stuart D, Abraham N, Wang F, Wang S, Yang T, et al. Collecting duct renin does not mediate DOCA-salt hypertension or renal injury. PloS One 2016; 11:e0159872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Khan S, Jena G. Sodium butyrate, a HDAC inhibitor ameliorates eNOS, iNOS and TGF-beta1-induced fibrogenesis, apoptosis and DNA damage in the kidney of juvenile diabetic rats. Food Chem Toxicol 2014; 73:127–139. [DOI] [PubMed] [Google Scholar]
  • 43.Shimazu T, Hirschey MD, Newman J, He W, Shirakawa K, Le Moan N, et al. Suppression of oxidative stress by b-hydroxybutyrate, an endogenous histone deacetylase inhibitor. Science 2013; 339:211–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Brilli LL, Swanhart LM, de Caestecker MP, Hukriede NA. HDAC inhibitors in kidney development and disease. Pediatr Nephrol 2013; 28:1909–1921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Cardinale JP, Sriramula S, Pariaut R, Guggilam A, Mariappan N, Elks CM, et al. HDAC inhibition attenuates inflammatory, hypertrophic, and hypertensive responses in spontaneously hypertensive rats. Hypertension 2010; 56:437–444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kim MH, Kang SG, Park JH, Yanagisawa M, Kim CH. Short-chain fatty acids activate GPR41 and GPR43 on intestinal epithelial cells to promote inflammatory responses in mice. Gastroenterology 2013; 145:396–406. [DOI] [PubMed] [Google Scholar]

RESOURCES