Silencing of pkm2 increases the efficacy of docetaxel in human lung cancer xenografts in mice

Abstract

Tumor aerobic glycolysis, or the Warburg effect, plays important roles in tumor survival, growth, and metastasis. Pyruvate kinase isoenzyme M2 (PKM2) is a key enzyme that regulates aerobic glycolysis in tumor cells. Recent research has shown that PKM2 can be used as a tumor marker for diagnosis and, in particular, as a potential target for cancer therapy. We investigated the effects of combining shRNA targeting PKM2 and docetaxel on human A549 lung carcinoma cells both in vivo and in vitro. We observed that the shRNA can significantly downregulate the expression level of PKM2. The decrease of PKM2 resulted in a decrease in ATP synthesis, which caused intracellular accumulation of docetaxel. Furthermore, the combination of pshRNA‐pkm2 and docetaxel inhibited tumor growth and promoted more cancer cell apoptosis both in vivo and in vitro. Our findings suggest that targeting tumor glycolysis can increase the efficacy of chemotherapy. In particular, the targeting of PKM2 could, to some extent, be a new way of reversing chemotherapy resistance to cancer therapy. (Cancer Sci 2010)

Tumor glycolysis is different from that in many normal adult organizations in metabolism; and the tumor glycolysis plays an important role in tumor energy metabolism.^{( 1} , ^{2 )} Cancer cells take up glucose at higher rates than normal tissue but are prone to produce energy through glycolysis, rather than through mitochondrial oxidation of pyruvate, even when the supply of oxygen is not limited. This effect, called aerobic glycolysis or the Warburg effect, is very important to tumor growth. In addition to providing a rapid rate of ATP production, glycolysis increases lactate production resulting in an acidification of the extracellular milieu, which is believed to facilitate cell invasion and metastasis and bestow a resistance to chemotherapy.^{( 3} , ⁴ , ^{5 )} A high level of glycolysis will also provide an increased supply of the precursors needed for the synthesis of nucleotides, proteins, and lipids in tumor cells. Cancer cells generally show signs of increased glycolysis for ATP generation, due in part to mitochondrial respiration injury and hypoxia, which are frequently associated with resistance to therapeutic agents. Increasing evidence has shown that inhibition of glycolysis signaling is a promising approach for cancer treatment.^{( 3} , ⁶ , ⁷ , ⁸ , ⁹ , ^{10 )}

Previous studies have shown that glycolytic genes comprise some of the most unregulated genes in cancer.^{( 11} , ^{12 )} Among them, pyruvate kinase (PK) plays a crucial role in regulating the rate‐limiting final step of glycolysis, catalyzing the formation of pyruvate and ATP from phosphoenolpyruvate and ADP.^{( 13} , ^{14 )} Four isoforms of PK have been found in mammals, designated L, R, M1, and M2. Each is differentially expressed in different cell types.^{( 14 )} The pyruvate kinase M2 isoenzyme (PKM2) is expressed in several differentiated tissues, for example, lung, fat tissue, pancreatic islets, and especially tumor cells.^{( 15} , ¹⁶ , ¹⁷ , ^{18 )} During multistep carcinogenesis, the first step is the loss of the tissue‐specific isoenzymes, followed by subsequent expression of PKM2.^{( 19 )} Knockdown of PKM2 expression or the replacement of PKM2 with PKM1 has been shown to reduce the ability of human tumor cell lines to form tumors.^{( 6 )} Normal cells use mitochondrial oxidative phosphorylation for glucose metabolism. Therefore, PKM2 can be used as a relatively specific target for cancer therapy without more cytotoxicity. Furthermore, PKM2 isoforms have been found to have a unique ability to interact with tyrosine‐phosphorylated proteins, which might promote tumor growth.^{( 20 )} Previous investigations have shown that glycolysis interference increases the efficacy of chemotherapy in vivo.^{( 3} , ^{8 )} Therefore, we further hypothesize that inhibition of aerobic glycolysis of tumor cells through the knockdown of PKM2 might sensitize PKM2‐positive tumor cells to chemotherapy.

Lung cancer is a leading cause of death worldwide. Non‐small‐cell lung cancer (NSCLC) accounts for approximately 85% of all lung cancer cases. At this advanced stage, the 5‐year survival rate is <15%.^{( 21} , ²² , ^{23 )} More than 50% of patients with advanced NSCLC need to receive chemotherapy in spite of frequent failure. Previous investigations have shown that PKM2 is expressed extensively in lung cancer and is believed to be an important biomarker in lung cancer.^{( 6} , ²⁴ , ^{25 )} In this study, we investigate whether silencing of PKM2 through systemic administration of shRNA can sensitize human lung carcinoma xenografts to chemotherapy both in vitro and in vivo. We used docetaxel, a model chemotherapeutic drug that is a second‐line strategy for NSCLC, according to guidelines of the National Comprehensive Cancer Network. The positive findings support the concept that PKM2 can be used as an important target to increase the efficiency of chemotherapy.

Materials and Methods

Plasmid construction and amplification.  The targeting sequence of shRNA for PKM2 was adopted as described previously.^{( 6 )} An shRNA with high pyruvate kinase knockdown efficiency was used (5′‐CCGGGCTGTGGCTCTAGACACTA‐AACTCGAGTTTAGTGTCTAGAGCCACAGCTTTTTG‐3′), and an shRNA with no effect on pyruvate kinase levels was used as a control (5′‐CCGGGAGGCTTCTTATAAGTGTTTACTCGAGTAAACACTTATAAGAAGCCTCTTTTTG‐3′). The eukar‐yotic expression vector pGenesil‐2 (Genesil Biotechnology, Wuhan, China) was used to construct the shRNA expressing plasmid (pshRNA‐pkm2 and pshRNA‐Con). Plasmids were extracted using a Qiagen Plasmid Mega Kit (Qiagen, Hilden, Germany) and stored at −20°C.

Animals and cell lines.  Female nude BALB/c mice were purchased from the West China Experimental Animal Center (Chendgu, China) and were kept in a pathogen‐free isolator. Human pulmonary adenocarcinoma A549 cell line, human hepatocellular liver carcinoma HepG2 cell line, and murine Lewis lung carcinoma LL/2 cell line were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured according to the supplier’s protocols.

Western blot analysis of PKM2 expression.  The reconstructed plasmids or control plasmid vector were transfected into A549 cells using LipofectAMINE 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Forty‐eight hours after transfection, the expression of PKM2 protein in A549 cells was detected with an anti‐PKM2 antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Detection of cellular ATP.  Levels of ATP were assessed using an ATP‐Lit assay kit (Sigma, St Louis, MO, USA). Briefly, A549 cells were planted in a 6‐well plate and transfected as previously described in this article. After 48 h, both attached and floating cells were harvested; cells were lysed with lysis buffer then centrifuged at 1620 g for 30 s, and cell supernatants were collected. Each 5 μL sample was added to 50 μL luciferin–luciferase assay mixture then the ATP quantitative were detected. Standard curves were determined for ATP to facilitate quantification of the nucleotides in each sample.

Detection of intracellular chemotherapeutics concentrations. A549, HepG2, and LL/2 cells were planted in a cell culture flask and transfected as mentioned before in this article. Twelve hours after transfection, docetaxel (HengRui Medicine, Jiangsu, China) was added. Thirty‐six hours later, cells were washed with PBS and lysed on ice with radioimmunoprecipitation assay(RIPA) buffer for 10 min. Cell debris was cleared by centrifugation at 12 000 rpm for 10 min at 4°C. The supernatant was collected and drug concentrations detected by HPLC (Waters, WA, USA).

Cell viability analysis by MTT assay.  Cells were seeded at a density of 1 × 10⁴ per well in 100 μL culture medium into a 96‐well plate. When cultured to 70% confluence, cells were transfected with pshRNA‐pkm2 (0.2 μg), pshRNA‐Con (0.2 μg), docetaxel (2 μg/mL), pshRNA‐pkm2 (0.2 μg) + docetaxel (2 μg/mL), or left untreated. After the cells were incubated for 48 h, MTT assay was carried out. Untreated cells served as the indicator of 100% cell viability. The absorbance was measured at 570 nm by a SpectraMAX microplate reader (SpectraMax L; Molecular Devices, Sunnyvale, CA, USA).

Apoptosis analysis by flow cytometry.  A549 cells were seeded in a 6‐well plate. After 48 h, both attached and floating cells were harvested and washed twice with PBS. The cells were then resuspended and stained with an annexin V–FITC kit (Beckman‐Coulter, Brea, CA, USA). Apoptosis of cells was analyzed by a flow cytometer (Beckman‐Coulter).

Therapy of established A549 tumor models.  A549 cells (5 × 10⁶) were implanted s.c. into the right flanks of female nude mice. When tumor diameters reached approximately 100 mm³ (15 days after inoculation), animals were randomly divided into four groups with five mice per group and treated with pshRNA‐pkm2, pshRNA‐Con, docetaxel, pshRNA‐pkm2 + docetaxel, or normal saline (NS) through the caudal vein. pshRNA‐pkm2 and pshRNA‐Con plasmids were injected every 2 days in a volume of 100 μL NS to a total of 10 times. Control injections in a volume of 100 μL NS were carried out at the same time points. Docetaxel was given once a week for 3 weeks. Tumor volume was observed and tumor size was determined by caliper measurement once every 3 days as described previously ⁸ .

Detection of PKM2 expression within tumors.  Immuno‐histochemical analysis was carried out to explore whether pshRNA‐pkm2 could effectively downregulate the expression of PKM2 in vivo. Tumor tissues were removed form tumor‐bearing nude 48 h after the last treatment. An anti‐PKM2 antibody (1:100; Santa Cruz Biotechnology) was used to determine the expression of PKM2.

Detection of cell proliferation in vivo with a Ki67 antibody.  To explore whether the combined treatment with pshRNA‐pkm2 and docetaxel could effectively inhibit cell proliferation in vivo, Ki67 protein was detected in tumor tissues. Tumor tissues were removed from tumor‐bearing nude mice 48 h after the last treatment. An anti‐Ki67 antibody (Abcam, Cambridge, MA, USA) was used to determine cellular proliferation.

Terminal deoxynucleotidyl transferase‐mediated dUTP nick end labeling assay in tumors in situ.  Cell apoptosis in vivo was determined using a TUNEL assay according to the manufacturer’s instructions (Promega, San Luis Obispo, CA, USA). Three tumors per group were analyzed 48 h after the last treatment.

Statistical analysis.  Statistical software SPSS version 11.5 (SPSS, Wacker Drive, IL, USA) was used for statistical analysis. The statistical significance of results in all of the experiments was determined by Student’s t‐test and anova. The findings were regarded as significant if P < 0.05.

Results

pshRNA‐pkm2 downregulates expression of PKM2 in A549 cells.  We first tested the possibility that these endogenous shRNAs could regulate the level of PKM2 protein in A549 cells. Western blot analysis of total cellular extracts 48 h after transfection revealed a markedly reduced PKM2 protein expression in A549 cells transfected with pshRNA‐pkm2 compared with that in non‐transfected and pshRNA‐Con‐transfected A549 cells (Fig. 1A). Densitometric analysis showed a 78.8 ± 3.5% reduction of PKM2 protein expression at 48 h (Fig. 1B). The results clearly indicated that pshRNA‐pkm2 was highly specific and efficient for pkm2 gene silencing in A549 cells in vitro.

Figure 1.

 Plasmid expressing shRNA targeting pyruvate kinase isoenzyme M2 (pshRNA‐pkm2) downregulated the expression of PKM2 in human A549 lung carcinoma cells. (A) pshRNA‐pkm2 (PKM2) and pshRNA‐Con (Control) were transfected for 48 h, then Western blot analysis was used to detect PKM2 protein. pshRNA‐pkm2 effectively diminished PKM2 protein levels compared to pshRNA‐Con and blank groups. (B) The level of PKM2 in the pshRNA‐pkm2 group was 19.7 ± 3.5% that of the pshRNA‐Con group and 21.2 ± 4.1% of the blank group. β‐actin was used to normalize for any differences in protein loading between lanes. Bars, SD; columns, mean.

Knockdown of PKM2 increases concentration of drugs in A549 and HepG2 cells.  The low concentration of chemotherapeutic drugs in cancer cells is an important reason for insensitivity and even resistance of tumors to these drugs. This may be attributed to a powerful ATP‐dependent “pump” comprised of ATP‐binding cassette transporters, including the g‐pg protein encoded by genes such as the multidrug resistance gene MRP1 or ABCG2.^{( 26} , ^{27 )} In the current study, we found that the concentration of docetaxel in A549 and HepG2 cells in the pshRNA‐pkm2 + docetaxel group was significantly higher than that of other groups (Fig. 2A). However, these results were not shown in LL/2 cells. This may be attributed to differences in gene sequences and target sequences. Knockdown of PKM2 could change the energy metabolism of cancer cells from aerobic glycolysis to oxidative phosphorylation,^{( 6} , ^{28 )} which might mean that more ATP would be produced in pshRNA‐pkm2 treated A549 and HepG2 cells. Therefore, we further assessed the ATP levels in A549 cells. Following the directions given in Standard Curve, substituting ATP‐containing samples for the ATP standard solutions, A549 cells treated with pshRNA‐Con, docetaxel, pshRNA‐pkm2, or pshRNA‐pkm2 + docetaxel for 48 h. Unexpectedly, the ATP levels per 10⁶ cells significantly decreased in pshRNA‐pkm2 and pshRNA‐pkm2 + docetaxel groups compared with that of the other groups (Fig. 2B). Although the underlying mechanism for the findings is unknown, the decreased ATP levels might account for the decreased concentration of docetaxel in A549 cells.

Figure 2.

 (A) Detection of intracellular chemotherapeutics in human pulmonary adenocarcinoma A549, human hepatocellular liver carcinoma HepG2, and murine Lewis lung carcinoma LL/2 cell lines. Data showed that treatment with plasmid expressing shRNA targeting pyruvate kinase isoenzyme M2 (pshRNA‐pkm2) + docetaxel (PKM2 + DOX) increased the content of docetaxel in A549 and HepG2 cells compared to other treatment groups (both P < 0.05), but there was no obvious difference in LL/2 cells. (B) Detection of ATP in A549 cells. After transfection with pshRNA‐pkm2 and pshRNA‐Con (CONTROL) for 24 h, 2 μg/mL docetaxel was added. The ATP content was detected after a further 24 h. Data shows the ATP content of 10⁶ cells. The pshRNA‐pkm2 group showed a significant decrease compared with control groups (P = 0.0136). Bars, SD; columns, mean. NS, normal saline.

Effects of combined treatment on A549 cells in vitro.  Cellular proliferation was monitored by MTT assay. Compared with untransfected A549 cells and the other control groups, cellular proliferation were significantly inhibited in the pshRNA‐pkm2 + docetaxel group on day 3 (P = 0.0058; Fig. 3A). Although obvious inhibition was observed in both the pshRNA‐pkm2 and docetaxel alone groups, there were no significant differences between the two groups. The quantitative assessment of apoptotic cells by flow cytometry was further used to estimate the number of apoptotic cells. There was a striking sub‐G₁ peak observed in the pshRNA‐pkm2 + docetaxel group (data not shown). The quantitative data revealed the significant increase of apoptotic cells (Fig. 3B). These findings suggest that the combined treatment with pshRNA‐pkm2 + docetaxel produced dual effects: the inhibition of proliferation, and the induction of apoptosis in cancer cells in vitro.

Figure 3.

 Flow cytometry analysis and MTT assay of human A549 lung carcinoma cells in vitro. (A) To measure the effects on cell proliferation, cells were transfected with plasmid expressing shRNA targeting pyruvate kinase isoenzyme M2 (pshRNA‐pkm2) (PKM2) and pshRNA‐Con (CONTROL) for 24 h, then 2 μg/mL docetaxel (DOX) was added. After 24 h, viable cells were determined by MTT assay. Data are presented as the absorbance of each group. The pshRNA‐pkm2 + docetaxel (PKM2 + DOX) group showed a significant decrease compared with control groups (P = 0.0057), PKM2 alone (P = 0.0012), or DOX alone (P = 0.0127). (B) A549 cells were treated as before, then apoptosis was determined by flow cytometry. Data are expressed as percentages. The PKM2 + DOX group showed a significant decrease in apoptosis compared with control groups (P = 0.0011), PKM2 alone (P = 0.0008), or DOX alone (P = 0.0015). Bars, SD; columns, mean. NS, normal saline.

Effects of combined treatment on A549 cell xenografts in vivo. The expression of PKM2 within tumors was detected by immunohistochemical analysis. Tumors from the NS (Fig. 4A) and pshRNA‐Con (data not shown) groups showed obvious evidence of expression. However, the expression levels of PKM2 were significantly downregulated within tumors from pshRNA‐pkm2 groups (Fig. 4). Furthermore, we tested the antitumor efficacy of the combined treatment in a nude mice model. The results showed that combined treatment with pshRNA‐pkm2 + docetaxel resulted in a significantly increased regression of established tumors compared with treatment with docetaxel alone, pshRNA‐pkm2 alone, or control (P < 0.05; Fig. 5A). The average tumor volume in the pshRNA‐pkm2 + docetaxel group was stable for the rest time until the mice were killed after injection, but the average tumor volume in the docetaxel alone and pshRNA‐pkm2 alone groups had a certain degree of growth. The inhibition rate of the combined treatment group reached approximately 35% compared with the docetaxel and pshRNA‐pkm2 single treatment groups. The results support the idea that the combination of pshRNA‐pkm2 with docetaxel can enhance antitumor activity in vivo.

Figure 4.

 Detection of expression levels of pyruvate kinase isoenzyme M2 (PKM2) in vivo in human A549 lung cancer cells implanted into female nude mice. Staining of PKM2 in cancer cells was clearly positive in the group treated with normal saline (NS). Weak cancer cell staining was observed in the group treated with pshRNA‐pkm2. Magnification, ×400.

Figure 5.

  In vivo effects of plasmid expressing shRNA targeting pyruvate kinase isoenzyme M2 (pshRNA‐pkm2) (PKM2) combined with docetaxel (DOX). (A) Antitumor effects. Tumor‐bearing mice were treated with NS (♦), PKM2 alone (▮), DOX alone (), or PKM2 + DOX (*). There was a significant difference in tumor volume (P = 0.0049) between NS treated mice and other groups. There was also a difference between the PKM2 + DOX group and the PKM2 (P = 0.0347) and DOX (P = 0.0296) groups. Bars, SD; points, mean (n = 5). (B) Inhibition of proliferation activity in A549 lung cancer cells. Proliferated tumor cells were detected by an antibody to Ki67 and the positive cell densities were quantified by counting the number of cells per high power field (×400). (a) Normal saline (NS) group, (b) PKM2 group, (c) DOX group, (d) PKM2 + DOX group. (e) Ki67 positive cells in each group. The PKM2 + DOX group showed a significant decrease compared with the control group (P = 0.0063). Bars, SD; columns, mean (five high power fields/slide).

Following the in vitro findings, the inhibition of proliferation and induction of apoptosis were detected through immunohistochemical staining and TUNEL assay. Tumor sections of each group were stained with anti‐Ki67 antibody in order to evaluate proliferation activity (Fig. 5B). Tumors from the control groups showed high proliferation activity of A549 tumor cells, whereas those in the pshRNA‐pkm2 and docetaxel groups had decreased values (P < 0.05), and treatment with pshRNA‐pkm2 + docetaxel resulted in significant inhibition to cellular proliferation (P < 0.01). Furthermore, the combination of pshRNA‐pkm2 + docetaxel also showed decreased values in comparison to the pshRNA‐pkm2 and docetaxel alone groups (P < 0.05). A large area of necrosis was also found in the section from the pshRNA‐pkm2 + docetaxel treated group (data not shown).

The TUNEL assay revealed that more apoptotic cells (with green nuclei) in tumor tissues were observed in the combination treated mice than in pshRNA‐pkm2, docetaxel, or NS treated mice (P < 0.05; Fig. 6). These data suggest that both the increased inhibition of proliferation and apoptosis‐inducing activity were involved in the antitumor effects of the combination treatment.

Figure 6.

 Detection of apoptotic A549 lung cancer cells using TUNEL analysis. The percentage of apoptosis was determined by counting the number of apoptotic cells and dividing by the total number of cells in the field (five high power fields/slide). (A) Normal saline group; (B) plasmid expressing shRNA targeting pyruvate kinase isoenzyme M2 (pshRNA‐pkm2) (PKM2) group; (C) docetaxel (DOX) group; (D) PKM2 + DOX group. (E) Percent apoptosis in each group. The combined treatment with PKM2 + DOX resulted in significantly increased apoptosis compared to that of other groups (P < 0.05). Bars, SD; columns, mean.

Discussion

Deregulation of gene expression and the resulting biological changes are distinct features of cancer cells. The deregulation of glycolytic genes is a frequent event in many cancers.^{( 11} , ^{12 )} As an important glycolytic gene, PK has four isoforms in mammals, M1, M2, L, and R, which are differentially expressed in different cell types.^{( 14 )} During tumorigenesis, the original tissue‐specific pyruvate kinase (i.e., type L, R, and M1) is replaced by PKM2. The switch could help tumor cells to adapt in low glucose and low oxygen environments and facilitate tumor invasion.^{( 29 )} PKM2 upregulation has been observed in numerous cancers including cervical, colorectal, gastric, skin, and lung cancers.^{( 6} , ²⁴ , ³⁰ , ³¹ , ^{32 )}

The expression of the PKM gene is controlled by SP1, SP3 and HIF‐1, ras, insulin, and the transcription factors, as well as specific miRNA.^{( 15} , ³³ , ^{34 )} In contrast to PKM1, which usually occurs in a highly active tetrameric form, PKM2 may present not only in a tetrameric form but also as a dimer. More of the pyruvate made in PKM2‐expressing cells is converted to lactate, whereas more of the pyruvate generated in PKM1 cells is metabolized in the mitochondria. The shift to aerobic glycolysis in the PKM2‐expressing cells is attributed to differential activities of lactate dehydrogenase, pyruvate dehydrogenase, and/or pyruvate dehydrogenase kinase, or proteins involved in oxidative phosphorylation.^{( 6 )} A recent study has also shown PKM2 isoforms have the unique ability to interact with tyrosine‐phosphorylated proteins.^{( 20 )} The multiple functions of PKM2 promote aerobic glycolysis and tumor growth. In another study, the association between PKM2 and multidrug resistance was analyzed, and the results showed that they could contribute considerably to cisplatin resistance in ovarian cancer cells.^{( 35 )} PKM2 can therefore be used as an important target for adjuvant cancer therapy. Knockdown PKM2 might induce antitumor effects,^{( 36} , ^{37 )} but more importantly, knockdown PKM2 might simultaneously target glycolysis and the interaction with tyrosine‐phosphorylated proteins. This could enhance the antitumor activity of chemotherapeutic drugs.

Docetaxel is a chemotherapeutic drug that acts on microtubules or the tubulin system, blocks cells in the G₂ and M phases, and inhibits cancer cell mitosis and proliferation. Compared with the traditional drug cisplatin, docetaxel has a different mechanism of action, with the advantages of no cross‐resistance of medicine, and the ability to produce effects in patients with platinum‐resistant disease. Currently, docetaxel is recommended by the National Comprehensive Cancer Network for the treatment of patients with locally advanced or metastatic NSCLC after failure of standard first‐line platinum‐based chemotherapy. However, the activity of docetaxel is far from satisfactory. In this study, we investigated whether knockdown of the expression of PKM2 can enhance the sensitivity of tumor cells to docetaxel. Our study showed that the reduced expression of PKM2 protein in tumors could effectively inhibit tumor growth and survival both in vitro and in vivo. Antitumor activity could be enhanced by combined treatment with pshRNA‐pkm2 and docetaxel. In the present study, the downregulation of PKM2 expression significantly suppressed A549 cell growth and proliferation. The combination treatment with pshRNA‐pkm2 and docetaxel not only significantly inhibited the growth of A549 cells, but also induced more apoptosis of A549 cells.

High levels of glycolysis provide ATP for the tumor cells’ high bioenergetic demands.^{( 38} , ^{39 )} PKM2 is correlated with the levels of ADP and ATP, which are generally correlated with a high degree of malignancy.^{( 34 )} Tumor treatment involves a chemotherapeutic scheme, but each patient responds differently to the same scheme, with varying influence on the curative effect. The ATP–tumor chemosensitivity assay is routinely applied to improve curative effects and decrease side‐effects. The ATP–tumor chemosensitivity assay has been studied for many years; it is considered to be a sensitive and stable method for testing tumor chemosensitivity.^{( 40} , ⁴¹ , ⁴² , ^{43 )} To explore the mechanism of growth inhibition in our study, we detected the ATP content of A549 cells in each group. The results showed that downregulation of PKM2 could decrease the content of ATP in A549 cells. Because tumor cells need ATP to discharge chemotherapeutic drugs,^{( 44} , ⁴⁵ , ^{46 )} a decrease in ATP might be one of the mechanisms through which pshRNA‐pkm2 could enhance tumor chemosensitivity to docetaxel. However, the mechanism underlying the lowering of the level of ATP is unknown. One explanation is that the upregulation of PKM2 in cancer cells results in a series of changes in pyruvate levels, fructose–bisphosphate levels, or other upstream metabolites in the glycolytic pathway that mediate the switch to aerobic glycolysis from oxidative phosphorylation in PKM2‐expressing cells.^{( 6} , ⁴⁷ , ^{48 )} As such, the knockdown of PKM2 might not reverse oxidative phosphorylation but only downregulate glycolysis during the observation time, and this might cause a collapse in the energy metabolism of PKM2‐expressing cells. A previous investigation reported that ATP depletion plays an important role in determining cellular fate. ATP depletion by approximately 15–25% of normal represented a threshold that determines whether cells die by necrosis or apoptosis; depletion by between approximately 25% and 70% of normal indicated that all cells died by apoptosis.^{( 49 )} In our study, the detected decrease of ATP may result in increased intracellular uptake of docetaxel. It might also generate direct effects by ATP depletion, which may aggravate the docetaxel‐induced cytotoxicity.

Furthermore, TUNEL stain assays indicated that pshRNA‐pkm2 + docetaxel induced the increased apoptosis of A549 cells. ATP is not only related to resistance of chemotherapeutic drugs, but also related to apoptosis of tumor cells. A certain degree of ATP content is a necessary condition for tumor cells to escape apoptosis.^{( 50 )} A decrease in ATP is not the only reason for RNAi of PKM2, in that the reduction of PKM2 could decrease the overall metabolic rate of cells. Taken together, the inhibition of discharge of chemotherapeutic drugs from tumor cells and the increase in apoptosis of tumor cells could be part of the mechanism by which pshRNA‐pkm2 enhances the chemotherapy sensitivity of tumor cells.

The advent of RNAi‐directed knockdown has shown its superiority in the field of cancer therapy and it might be exploited for gene therapy. For further clinical applications, plasmids expressing shRNA have the advantage that they can be easily amplified at low cost and are more stable to intracellular metabolism compared to synthetic iRNA. In this article, we adopted shRNA technology to decrease the expression of mRNA and protein of PKM2 in order to achieve the purpose of preventing the unique metabolism of tumor cells. In our study, we found that pshRNA‐pkm2 also had significant antitumor effects both in vitro and in vivo. We showed that the plasmids endogenously expressing shRNA could successfully deplete up to 80% of pkm2 expression in A549 cells 48 h after transfection. Furthermore, the reduction of PKM2 protein levels by shRNA of PKM2 could significantly inhibit the growth rate of A549 cells. The remarkable effect in growth inhibition supported the effectiveness of this treatment.

Molecular targeting therapy is the future direction for tumor therapy. The shRNA targeting pkm2 can inhibit the growth of A549 lung cancer cells and increase chemotherapy sensitivity to docetaxel. Our findings validate PKM2 as a promising, generally relevant target for the development of gene therapy combined with chemotherapy. New therapeutic methods targeting energy metabolism in the treatment of human cancer are suggested by this study.

Acknowledgments

Grant support was provided by the National 973 Basic Research Program of China grant 2006CB504303, NsFc grant 30801358, and National Major Project 2009ZX09503‐005.