Steroid and xenobiotic receptor in human esophageal squamous cell carcinoma: A potent prognostic factor

Abstract

Steroid and xenobiotic receptor (SXR) is a nuclear receptor activated by diverse exogenous and endogenous compounds and has been demonstrated to play a pivotal role in detoxification through its regulation of various metabolizing enzymes and transporters. Recent studies also demonstrated the potential roles of SXR in the regulation of apoptosis and inflammation in various carcinoma cells, but the status of SXR in human esophageal squamous cell carcinoma (ESCC) has not been examined. Therefore, in this study, we performed immunohistochemical and quantitative RT‐PCR evaluations in human ESCC in order to clarify its biological and clinical significance. We first immunolocalized SXR in 73 human ESCC cases. SXR immunoreactivity was detected in the nuclei, or in both nuclei and cytoplasm of carcinoma cells (98%, 20% of cases, respectively). The status of nuclear SXR immunoreactivity was inversely correlated with histological grade, lymph node status, ki67/MIB1 labeling index, and positively correlated with retinoid X receptor α status. In addition, high nuclear SXR expression was significantly correlated with favorable clinical outcome of the patients. Multivariate analysis further demonstrated SXR status in carcinoma cells as an independent favorable prognostic factor of the patients. Results of quantitative RT‐PCR study demonstrated that SXR mRNA expression was detected in three of five cases, and was marked higher in the cancerous tissue than non‐neoplastic tissue of these patients. This is the first study to demonstrate the status of SXR in human ESCC and the results suggest that SXR is a potent favorable prognostic factor of human ESCC. (Cancer Sci 2009)

Esophageal squamous cell carcinoma (ESCC) is one of the most lethal malignancies in some parts of the world including Japan, despite recent advances in therapeutic strategies including surgery, chemotherapy, radiotherapy, and combined therapies. Therefore, identifying and targeting factors associated with progression or chemotherapeutic efficacy of individual patients is required to improve the survival of ESCC patients.

Steroid and xenobiotic receptor (SXR; also called as human pregnane X receptor) is a member of the nuclear receptor superfamily of ligand‐dependent transcription factors.^{( 1} , ^{2 )} In humans, SXR is expressed mainly in the liver and small intestine, and plays a cardinal role in protecting tissues from potentially toxic exogenous and endogenous compounds. SXR is activated by structurally diverse ligands,^{( 3} , ^{4 )} forms heterodimers with retinoid X receptor (RXR) α, and subsequently regulates transcription of its target genes.^{( 5 )} Major target genes of SXR in human are drug‐metabolizing enzymes and drug transporters such as cytochrome p450 (CYP) 3A4^{( 1} , ² , ^{6 )} and multidrug resistance gene 1 (MDR1).^{( 7} , ^{8 )} CYP3A4 is a major phase I drug‐metabolizing enzyme involved in the biotransformation of more than 50% of all known clinically used medications.^{( 9 )} The MDR1 gene encodes P‐glycoprotein which is a member of ATP binding cassette transporter, and is considered to play an important role in developing the resistance of tumor cells to chemotherapy by exporting anticancer agents from intracellular to extracellular components.^{( 10 )}

SXR has been reported to be expressed also in various human malignant tissue such as breast,^{( 11} , ¹² , ^{13 )} endometrial,^{( 14 )} prostate,^{( 15 )} and ovarian^{( 16 )} cancer. Expression of SXR in carcinoma cells is usually associated with decreased sensitivity to anticancer drugs,^{( 15} , ¹⁶ , ¹⁷ , ^{18 )} and drug–drug interactions.^{( 19 )} In addition to these roles in metabolism, SXR has been also demonstrated to be involved in regulation of cell proliferation,^{( 16 )} anti‐apoptosis effect,^{( 20 )} pro‐apoptosis effect,^{( 21} , ^{22 )} or inflammation.^{( 23 )} Therefore, SXR has also been proposed to play a pivotal role in tumor progression in addition to these drug metabolism/efflux and drug–drug interactions described above.

In our previous study, SXR mRNA was not detected in the normal esophagus of the autopsy specimen.^{( 24 )} However, a possible role of SXR in ESCC has not been examined. Therefore, in this study, we performed immunohistochemical study and quantitative RT‐PCR in order to clarify the clinical or biological significance of SXR expression in patients with ESCC.

Materials and Methods

Patients and tissue preparation.  Seventy‐three specimens of thoracic ESCC were obtained from Japanese patients who underwent potentially curative esophagectomy with lymph node dissection from 1998 to 2003 at the Second Department of Surgery at Tohoku University Hospital (Sendai, Japan). These patients had not received any chemotherapy or irradiation prior to surgery. Sixteen specimens of non‐neoplastic epithelium were obtained from these 73 cases. For immunohistochemistry, these specimens were fixed with 10% formalin and embedded in paraffin wax. Freshly frozen specimens were also available for RT‐PCR analysis in some cases. Non‐neoplastic esophageal mucosa and carcinoma tissues were obtained respectively from five ESCC patients who underwent esophagectomy in 2007 and these specimens were snap‐frozen and stored at −80°C until examination. These five patients were all advanced cases. The depth of tumor invasion in these cases corresponded to either pT2 or pT3, and lymph node metastasis was detected in all five cases. No patients had received any chemotherapy or irradiation prior to surgery. Relevant clinical data were retrieved from careful review of the patient’s charts. All tumors were reviewed by three of the authors (D.T., F.F., and H.S.). The pathological stage of each cancer was defined according to the TNM system and each lesion was graded histologically according to the World Health Organization classification. The median follow‐up time was 72 months (range, 2–133 months). The Ethics Committee at the Tohoku University School of Medicine approved the research protocols, and informed consent was obtained from each patient before surgery.

Antibodies.  Mouse monoclonal antibody for SXR (PXR1) was kindly provided by Perseus Proteomics (Tokyo, Japan), and the antibody has been previously described in detail.^{( 12 )} Verma et al. presented an immunoblotting analysis using the same monoclonal antibody and demonstrated its specificity.^{( 22 )} Rabbit polyclonal antibody for RXRα was kindly provided by Professor Sugawara.^{( 25 )} Other antibodies used in this study were as follows: mouse monoclonal antibodies for MDR1 (6C4.2), Ki‐67 (MIB1), and p53 (DO‐7) were purchased from Chemicon International (Temecula, CA, USA), Dako Cytomation (Kyoto, Japan), and Novocastra (Newcastle, UK), respectively. Rabbit polyclonal antibody for CYP3A4 was purchased from Chemicon.

Immunohistochemistry.  Serial 3‐μm thick tissue sections were deparaffinized with xylene and ethanol. Endogenous peroxidase activity was blocked by immersing the slides in 0.3% hydrogen peroxidase for 30 min at room temperature. Antigen retrieval was performed by heating the slides in an autoclave at 121°C for 5 min in citric acid buffer (2 mmol/L citric acid and 9 mmol/L trisodium citrate dehydrate, pH6.0) or instant antigen retrieval H buffer (Mitsubishi Kagaku Iatron, Tokyo, Japan). Sections were then incubated with 10% normal rabbit serum for the monoclonal antibodies, or normal goat serum for polyclonal antibody to reduce nonspecific background immunostaining. The reacted sections were then incubated for 16 h at 4°C with primary antibodies. The dilutions of primary antibodies were as follows: SXR, 1:400; RXRα, 1:3500; CYP3A4, 1:1000; MDR1, 1:40; Ki‐67, 1:100; and p53, 1:200. The sections were subsequently incubated with biotinylated rabbit antimouse IgG or goat antirabbit IgG (Histofine Kit; Nichirei, Tokyo, Japan), and with horseradish peroxidase–conjugated streptoavidin (Nichirei). The antigen–antibody complex was then visualized with 3.3′‐diaminobenzidine (1 mmol/L, in 50 mol/L Tris–HCl buffer, pH 7.6, and 0.006% H₂O₂) and counterstained with hematoxylin. Normal small intestine was used as a positive control for SXR. As a negative control, normal mouse or rabbit IgG was used instead of the primary antibodies and no specific immunoreactivity was detected.

Immunohistochemical analysis.  Immunoreactivity for SXR was detected in the nuclei or in the nuclei and cytoplasm. For semiquantitative analysis of nuclear SXR immunoreactivity, the H score was used in this study.^{( 26 )} Briefly, more than 1000 tumor cells were counted in three different representative areas corresponding to the invasive front of the tumor in each case, and the H score was derived from the formula: H score = (percentage of strongly stained nuclei × 3) + (percentage of moderately stained nuclei × 2) + (percentage of weakly stained nuclei × 1). This formula gives a possible range of 0–300. The staining intensity of SXR in the cytoplasm was classified in two categories: negative or positive. Immunoreactivity for RXRα, Ki67, and p53 were detected in the nuclei. These immunoreactivities were evaluated in more than 1000 carcinoma cells in each case, and were counted, and the percentage of immunoreactivity (i.e. labeling index [LI]) was determined. Scoring was done independently by two of the authors (D.T. and F.F.). Interobserver differences were less than 5%, and the mean of the value was obtained as a final value of LI. For p53 immunohistochemistry, cases with an LI of more than 10% were determined to be positive according to the results of previous report.^{( 27 )}

For analysis evaluating the possible correlation between SXR status and clinical outcome of individual patients, the cases were classified into two groups according to SXR H score (high SXR, >100 H score; low SXR, 0–99 H score), because SXR H scores were distributed in two peaks on the boundary of approximately 100. In addition, the median value of the SXR H score was 98.1, near the value of 100. The selection of the median value as the cut‐off point is usually considered to secure objectivity because it is not determined as an “optimal” cut‐off point.^{( 28 )}

Real‐time RT‐PCR.  Total RNA was carefully extracted from the specimens of carcinoma and non‐neoplastic tissues from five ESCC patients and two human ESCC cell lines (TE10, obtained from the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan; EC‐GI‐10, obtained from RIKEN BioResource Center, Ibaraki, Japan) using the TRIzol (Invitrogen Life Technologies, Gaithersburg, ND) method. The QuantiTect Reverse Transcription kit (Qiagen, Hilden, Germany) was employed in the synthesis of cDNA. Real‐time PCR was carried out using the LightCycler System and FastStat DNA Master SYBR Green I (Roche Diagnostics, Mannheim, Germany). The PCR primer sequences for SXR and PRL13A used in this analysis were as follows: SXR, forward 5′‐CCCAGTGTCAACGCAGATGAG‐3′, reverse 5′‐GTTGCGTTTCATGGCCCTC‐3′; RPL13A, forward 5′‐ CCTGGAGGAGAAGAGGAAAGAGA‐3′, reverse 5′‐TTGAGGACCTCTGTGTATTTGTCAA‐3′. An initial denaturing step of 95°C for 10 min was followed by 40 cycles for SXR, 35 cycles for PRL13A at 95°C for 10 s; 15 s annealing at 75°C (SXR), 68°C (PRL13A); and extension for 15 s at 72°C. RNA from cultured human liver cells (HuH7; human hepatocellular carcinoma obtained from the Cell Resource Center for Biomedical Research) were used as a positive control for SXR. Negative controls, in which the reaction mixture lacked cDNA template, were included to check for the possibility of exogenous contaminant DNA. cDNA of known concentration for SXR and the housekeeping gene RPL13A was used generate standard curves for real‐time quantitative PCR in order to determine the quantity of target cDNA transcripts. The mRNA level in each case was represented as a ratio of RPL13A and was evaluated as a ratio (%) compared with that of positive control.^{( 12} , ^{29 )}

Statistical analysis.  Values for SXR H score, patient age, tumor size, Ki67/MIB1 LI, and RXRα LI were demonstrated as mean ± SEM. The statistical analyses between SXR H score and clinicopathological parameters were evaluated using the Mann–Whitney U‐test, Kruskal–Wallis test, a correlation coefficient (r), and regression equation when appropriate. The statistical analyses between the status of cytoplasmic SXR immunoreactivity and clinicopathological parameters were evaluated using the χ²‐test or Mann–Whitney U‐test when appropriate. Overall survival (OS) and disease‐free survival (DFS) curves of the patients examined were generated according to the Kaplan–Meier method and statistical significance was calculated using the log‐rank test. Cox’s proportional hazard model was used for both univariate and multivariate analyses. Statistical differences were examined using StatView 5.0 J software (SAS Institute, Cary, NC, USA) and values of P < 0.05 were considered statistically significant.

Results

Immunohistochemical staining.  SXR immunoreactivity was detected in the nuclei in non‐neoplastic epithelial cells of the esophagus (Fig. 1a). Immunoreactivity was abundant in the suprabasal layer (mean H score = 67.2 ± 3.2) compared with the basal layer (mean H score = 28.4 ± 3.1). SXR immunoreactivity in non‐neoplastic epithelial cells was relatively low compared to that in carcinoma cells. In 72 out of 73 cases, SXR immunoreactivity was detected in the nuclei of carcinoma cells with a variety of the immunointensity (Fig. 1b–d). The mean value of the SXR H score in 73 ESCC was 94.6 ± 5.1 (range, 0–211). In only one case, SXR immunoreactivity was not detected in both nuclei and cytoplasm, but no clinicopathological characteristics specific to this particular case were identified. In 15 out of 73 cases examined, SXR immunoreactivity was detected in both the nuclei and cytoplasm of carcinoma cells (Fig. 1e). There was no significant association between SXR immunmoreactivity in the nucleus and cytoplasm. The mean SXR H score was 76.9 ± 5.6 in cytoplasmic SXR positive cases, and 98.4 ± 11.3 in cytoplasmic SXR negative cases (P = 0.1405). RXRα immunoreactivity was detected in the nuclei of non‐neoplastic epithelial cells and carcinoma cells (Fig. 1f,g). CYP3A4 and MDR1 immunoreactivity was not detected in carcinoma cells, although CYP3A4 immunoreactivity was detected only in esophageal glands, and MDR1 in some capillary vessels (Fig. 1h,i).

Figure 1.

 Representative illustrations of immunohistochemistry in human esophageal squamous cell carcinoma. (a) Immunoreactivity for steroid and xenobiotic receptor (SXR) was detected in the nuclei of non‐neoplastic epithelial cells. (b–d) Immunoreactivity for SXR was detected in the nuclei of carcinoma cells. (b) Weakly, (c) moderately, and (d) strongly stained patterns of SXR immunoreactivity. (e) Immunoreactivity for SXR was detected in both the nuclei and cytoplasm of the carcinoma cells. (f) Immunoreactivity for retinoid X receptor α was detected in the nuclei of non‐neoplastic esophageal epithelial cells (g) and carcinoma cells. (h) Immunoreactivity for cytochrome p450 3A4 was detected in esophageal glands (arrow), but not in carcinoma cells. (i) Immunoreactivity for MDR1 was detected in capillary vessels (arrow head), but not in carcinoma cells. Bar, 100 μm.

Correlation between the status of SXR immunoreactivity and clinicopathological variables in 73 ESCC patients.  Associations between SXR status and clinicopathological variables of the patients examined are summarized in Table 1. There was a significant inverse association between the SXR H score and tumor differentiation (P = 0.0301), but cytoplasmic SXR immunoreactivity was positively associated with tumor differentiation (P = 0.0032). There was an inverse significant association between the SXR H score and presence of lymph node metastasis (P = 0.0199). There was a positive significant correlation between the SXR H score and RXRα LI (P = 0.0009, r = 0.382). Ki67/MIB1 LI was inversely correlated with the SXR H score (P = 0.0419, r = −0.238), but was positively correlated with the status of cytoplasmic SXR immunoreactivity (P = 0.0049). No significant association was detected between SXR immunoreactivity and age, gender, tumor size, TNM stage, lymphatic invasion, or venous invasion, and the p53 status of the patients examined.

Table 1.

 Correlation between steroid and xenobiotic receptor and clinicopathological variables in 73 esophageal squamous cell carcinoma patients

Variable	n or mean ± SEM (range)	Nuclear SXR		Cytoplasmic SXR
		H score (mean ± SEM)	P‐values	Negative (n = 58)	Positive (n = 15)	P‐values
				n (%)	n (%)
Age (years)
<65	36	95.4 ± 7.8	0.9084	27 (75.0)	9 (25.0)	0.3975
≥65	37	93.7 ± 6.8		31 (83.8)	6 (16.2)
Gender
Men	61	91.1 ± 5.3	0.2005	47 (77.0)	14 (23.0)	0.4385
Women	12	112.1 ± 14.9		11 (91.7)	1 (8.3)
Tumor size (mm)
<50	39	90.1 ± 7.5	0.4324	31 (79.5)	8 (20.5)	>0.9999
≥50	34	99.6 ± 6.7		27 (79.4)	7 (20.6)
TNM‐pT
pT1	34	96.9 ± 8.4	0.5481	28 (82.4)	6 (17.6)	0.8163
pT2	10	100.0 ± 15.9		8 (80.0)	2 (20.0)
pT3	29	89.9 ± 6.4		22 (75.8)	7 (24.2)
TNM‐pN
pN0	33	107.1 ± 8.3	0.0199	27 (81.8)	6 (18.2)	0.6495
pN1	40	84.2 ± 5.9		31 (77.5)	9 (22.5)
TNM‐pM
pM0	67	95.5 ± 5.4	0.4947	55 (82.1)	12 (17.9)	0.0968
pM1(LYM)	6	83.7 ± 15.6		3 (50.0)	3 (50.0)
TNM‐pStage
I	24	104.6 ± 10.3	0.5394	19 (79.2)	5 (20.8)	0.2271
II	25	91.2 ± 9.3		22 (88.0)	3 (12.0)
III	18	89.3 ± 7.2		14 (77.8)	4 (22.2)
IV	6	83.7 ± 15.6		3 (50.0)	3 (50.0)
Differentiation
Well	13	109.5 ± 10.3	0.0301	12 (92.3)	1 (7.7)	0.0032
Moderately	50	96.9 ± 6.1		42 (84.0)	8 (16.0)
Poorly	10	63.5 ± 12.9		4 (40.0)	6 (60.0)
Lymphatic invasion
Negative	30	92.5 ± 8.8	0.9196	24 (80.0)	6 (20.0)	0.9229
Positive	43	96.0 ± 6.2		34 (79.1)	9 (20.9)
Venous invasion
Negative	33	97.5 ± 8.6	0.6336	27 (81.8)	6 (18.1)	0.6495
Positive	40	92.2 ± 6.2		31 (77.5)	9 (22.5)
RXRα LI (%)	36.5 ± 2.2 (0–76.2)		0.0009 (r = 0.382)	37.3 ± 2.5 (0–76.2)	33.2 ± 4.9 (0–65.8)	0.4834
Ki67/MIB1 LI (%)	40.7 ± 1.4 (19.1–69.6)		0.0419 (r = −0.238)	38.6 ± 1.3 (19.1–69.6)	48.8 ± 3.6 (22.9–69.3)	0.0049
p53 immunoreactivity
Negative	25	108.0 ± 8.7	0.0663	21 (84.0)	4 (16.0)	0.4877
Positive	48	87.5 ± 6.2		37 (77.1)	11 (22.9)

Data are presented as mean ± SEM. All other values represent the number of cases. P‐values less than 0.05 were considerd significant, and are shown in bold. LI, labeling index; RXR, retinoid X receptor; SXR, steroid and xenobiotic receptor.

Correlation between SXR status and clinical outcome in the 73 ESCC patients.  OS and DFS curves of the patients examined are illustrated in Figure 2. The statistical analysis demonstrated that high nuclear SXR expression in ESCC patients was significantly associated with better survival or favorable clinical outcome of the patients examined in this study (log‐rank test: OS, P = 0.0026; DFS, P = 0.0027). Significant correlation was not detected between SXR status in the cytoplasm and prognosis of the patients. The results of univariate analysis (2, 3) demonstrated that pathological stage (OS, P = 0.0002; DFS, P < 0.0001), SXR status in the nucleus of carcinoma cells (OS, P = 0.0041; DFS, P = 0.0045), presence of venous invasion (OS, P = 0.0139; DFS, P = 0.0239), tumor size (OS, P = 0.0294; DFS, P = 0.0078), gender (OS, P = 0.0392; DFS, P = 0.0270), presence of lymphatic invasion (OS, P = 0.0465), and RXRα status (DFS, P = 0.0332) all turned out to be significant prognostic factors for OS and/or DFS in the 73 ESCC patients examined. A subsequent multivariate analysis, however, demonstrated that only SXR status in the nucleus (OS, P = 0.0151; DFS, P = 0.0252) was an independent prognostic factor for OS and DFS, as well as pathological stage (OS, P = 0.0042; DFS, P = 0.0052) and tumor size (OS, P = 0.0414; DFS, P = 0.0106).

Figure 2.

 Overall and disease‐free survival (OS and DFS) curves of 73 patients with esophageal squamous cell carcinoma examined in this study according to the status of steroid and xenobiotic receptor (SXR) immunoreactivity (Kaplan–Meier method). Significant difference in survival of the patients was detected between patients with high and low SXR nuclear expression (a,b), but significant difference was not detected according to the status of SXR cytoplasmic expression (c,d). Cases were classified into two groups according to SXR H score in the nucleus: high SXR, >100 H score; low SXR, 0–99 H score. High SXR status was significantly associated with favorable clinical outcome.

Table 2.

 Univariate and multivariate analysis of overall survival in 73 esophageal squamous cell carcinoma patients

Variable	Univarate		Multivariate
	P‐values	Relative risk (95% CI)	P‐values	Relative risk (95% CI)
Gender (men/women)	0.0392	4.537 (1.078–19.097)	0.2931	2.189 (0.508–9.428)
Age, years (≥65/<64)	0.2147	1.545 (0.777–3.071)
Tumor size (≥50 mm/<49 mm)	0.0294	2.152 (1.079–4.290)	0.0414	2.346 (1.034–5.326)
Histological grade (poor/well, moderate)	0.8627	1.087 (0.421–2.812)
Lymphatic invasion (positive/negative)	0.0465	2.131 (1.012–4.439)	0.8131	1.108 (0.473–2.599)
Venous invasion (positive/negative)	0.0139	2.556 (1.210–5.400)	0.5381	1.302 (0.562–3.016)
TNM‐pStage (III, IV/I, II)	0.0002	4.039 (1.934–8.435)	0.0042	3.298 (1.457–7.464)
Nuclear SXR status (low/high)	0.0041	2.956 (1.409–6.203)	0.0151	2.817 (1.222–6.495)
p53 status (positive/negative)	0.7997	0.913 (0.451–1.847)
Ki67 status†	0.5376	1.009 (0.981–1.038)
RXRα status†	0.0546	0.983 (0.967–1.000)

†Data were evaluated as continuous values. Data considered significant (P < 0.05) in the univariate analysis are shown in bold and were examined in the multivariate analysis. CI, confidence interval; RXR, retinoid X receptor; SXR, steroid and xenobiotic receptor.

Table 3.

 Univariate and multivariate analysis of disease‐free survival in 73 esophageal squamous cell carcinoma patients

Variable	Univarate		Multivariate
	P‐values	Relative risk (95% CI)	P‐values	Relative risk (95% CI)
Gender (men/women)	0.0270	5.027 (1.201–21.040)	0.0939	3.416 (0.811–14.381)
Age, years (≥65/<64)	0.3652	1.353 (0.703–2.600)
Tumor size (≥50 mm/<49 mm)	0.0078	2.397 (1.235–4.652)	0.0106	2.512 (1.239–5.091)
Histological grade (poor/well, moderate)	0.1414	1.855 (0.814–4.230)
Lymphatic invasion (positive/negative)	0.1667	1.563 (0.794–3.077)
Venous invasion (positive/negative)	0.0239	2.231 (1.112–4.475)	0.1602	1.716 (0.808–3.646)
TNM‐pStage (III, IV/I, II)	<0.0001	4.331 (2.206–8.503)	0.0052	2.891 (1372–6.091)
Nuclear SXR status (low/high)	0.0045	2.792 (1.374–5.671)	0.0252	2.371 (1.113–5.050)
p53 status (positive/negative)	0.7406	1.123 (0.564–2.237)
Ki67 status†	0.4878	1.010 (0.982–1.040)
RXRα status†	0.0332	0.982 (0.966–0.999)	0.5582	0.994 (0.976–1.013)

†Data were evaluated as continuous values. Data considered significant (P < 0.05) in the univariate analysis are shown in bold and were examined in the multivariate analysis. CI, confidence interval; RXR, retinoid X receptor; SXR, steroid and xenobiotic receptor.

Quantitative RT‐PCR analysis.  The results of quantitative RT‐PCR of SXR are summarized in Figure 3. SXR mRNA expression was detected in three of five carcinoma tissues of ESCC patients examined in this study. SXR mRNA levels ranged from 0% to 10% of the positive controls with an average ± SD of 3.89 ± 5.17%. In two carcinoma tissues in which SXR mRNA was below the detection limit, PCR products for SXR appeared as a faint but definitive band in gel electrophoresis. In non‐neoplastic mucosa, SXR mRNA expression was detected in three of five cases and SXR mRNA levels ranged from 0% to 0.13% with an average ± SD of 0.03 ± 0.05%. No correlation was identified between SXR mRNA level and the clinicopathological variables of the patients examined. In three cases in which SXR mRNA was detected in carcinoma tissues, SXR immunoreactivity tended to be higher than the two cases in which SXR mRNA was not detected. In non‐neoplastic epithelium of these five cases, SXR immunoreactivity was detected in a similar fashion. SXR mRNA expression in non‐neoplastic mucosa was marked low compared to the level of cancerous tissue. SXR mRNA was not detected in two human ESCC cell lines examined in this study.

Figure 3.

 Result of quantitative RT‐PCR for steroid and xenobiotic receptor (SXR) of carcinoma and non‐neoplastic esophageal mucosa in esophageal squamous cell carcinoma cases. SXR mRNA was detected in three out of five cases in carcinoma tissue (cases #1, #2, #3) and non‐neoplastic esophageal mucosa (cases #1, #2, #5), respectively. Cases #4 and #5 were associated with a faint but definitive band in carcinoma tissues, although in quantitative PCR SXR mRNA was below the detection limit (SXR, 0.001 pg/μL). The expression level in non‐neoplastic mucosa was very low compared with that of carcinoma tissue. SXR mRNA level is represented as a ratio of housekeeping gene the ribosomal protein L13A (RPL13A), and was evaluated as ratio (%) compared with that of positive control. arrowhead, 0.01%; M, marker; NC, negative control; nd, undetectable level; PC, positive control.

Discussion

To the best of our knowledge, this is the first study to demonstrate expression of SXR in ESCC. We previously reported that SXR mRNA was not detected in an esophagus obtained from autopsy,^{( 24 )} but only one autopsy specimen was examined by RT‐PCR in this reported analysis. In our present study, we demonstrated the expression of both SXR protein and SXR mRNA in the non‐neoplastic esophagus as well as in ESCC. Results of our present study demonstrated that the expression of SXR protein and mRNA was markedly higher in carcinoma tissue compared with non‐neoplastic esophagus. SXR was not detected in normal tissue of the breast^{( 12 )} and endometrium,^{( 14 )} and SXR was weakly expressed in normal prostate tissue compared with cancerous tissue.^{( 15 )} Results from our present study and previous studies above all suggest that SXR was more abundantly expressed in carcinoma cells than in their normal counterparts. SXR immunoreactivity in the nuclei was detected in almost all cases, although in some cases SXR immunoreactivity was detected in both the nuclei and cytoplasm of the carcinoma cells in ESCC. SXR is localized in the cytoplasm of mouse liver and is translocated into the nucleus following administration of its ligands.^{( 30 )} In addition, SXR forms a heterodimer with RXRα upon binding to specific repeats in the promoter regions of its target genes.^{( 5 )} In our present study, SXR immunoreactivity in the nucleus was positively correlated with RXRα immunoreactivity. Therefore, SXR expression in the nucleus is considered to play a more functional role than cytoplasmic SXR expression. In our present study, CYP3A4 and MDR1, which are both well‐known target genes regulated by SXR in the liver or other tissues, were not detected at all in ESCC cells. Therefore, SXR is considered to regulate some other drug‐metabolizing enzyme or transporter genes in the esophagus. However, SXR may also contribute to cancer progression or development through regulating genes other than drug‐metabolizing enzymes or transporters in ESCC cells. Further investigations are required to identify the potential target genes of SXR in ESCC.

The SXR H score in carcinoma cells was inversely correlated with the presence of lymph node metastasis, and subsequent prognostic analysis revealed that a relatively high nuclear SXR expression of ESCC cells was significantly associated with favorable clinical outcome and was an independent favorable prognostic factor in this group of ESCC patients examined. These findings are in disagreement with the previous report by Conde that high SXR expression is a poor prognostic factor in breast cancer.^{( 13 )} Conde et al. reported that SXR expression was inversely correlated with estrogen receptor, and the SXR pathway may contribute to potential poor response to the endocrine adjuvant therapy. In vitro, some studies, however, demonstrated that SXR activation is involved in the processes of anti‐apoptotic ^{( 20} , ^{31 )} and proliferative effects to the carcinoma cells.^{( 16} , ^{32 )} In contrast, Verma et al. reported a pro‐apoptotic effect of SXR activation in breast cancer cells in conjunction with wild‐type p53.^{( 22 )} They demonstrated that SXR activation by xenobiotic ligands resulted in the up‐regulation of inducible nitric oxicide synthase (iNOS) and calmodulin, which subsequently caused local production of nitric oxide (NO) and NO‐dependent up‐regulation of p53, with eventual cell arrest or apoptosis of carcinoma cells. These discrepancies in SXR functions between an anti‐apoptotic effect in some tissues and a pro‐apoptotic effect in others may be due to its tissue‐specific or ligand‐promoter‐dependent manner.^{( 33} , ^{34 )} SXR was reported to regulate iNOS gene expression through the DR4‐mediated activation of human iNOS promoter activity,^{( 35 )} and iNOS was expressed abundantly in carcinoma cells of human ESCC.^{( 36} , ^{37 )} In our present study, the p53‐negative group tended to be associated with higher SXR H score but this association did not reach statistical significance. This may be due to the fact that the p53 phenotype was not necessarily correlated with the p53 genotype,^{( 38 )} and the apoptosis pathway through p53 is known to be very complicated.^{( 39 )} In addition, NO is well known to process cytostatic effects through directly influencing the levels of cyclin D1, independent of the p53 pathway.^{( 40 )} Therefore, the SXR–iNOS–NO pathway may be involved in the pro‐apoptotic effect in ESCC cells, independently of p53 status.

Nuclear factor‐kappa B (NF‐κB) is also one of transcription factors involved in regulation of inflammation and immune responses. Activation of NF‐κB results in an elevated expression of cell cycle genes, inhibitor of apoptosis, and protease which subsequently promote the process of invasion of carcinoma cells, and play an important role in malignant behavior.^{( 41 )} Recently, mutual repression between SXR and NF‐κB was also reported.^{( 23 )} These results suggest that an activation of SXR inhibits the activity of NF‐κB, which may result in inhibition of cell proliferation, anti‐apoptosis, invasive property, and angiogenesis. Therefore, results of these in vitro studies and our present study suggest that high nuclear SXR expression may contribute to the lower proliferative activity of carcinoma cells, diminished invasive and metastatic potentials, and favorable clinical outcome of the patients.

In our present study, positive SXR immunoreactivity in the cytoplasm tended to be associated with a poor prognosis, but this association did not reach statistical significance. The opposite correlation between nuclear and cytoplasmic SXR status in this study suggests that SXR may be translocated into the nucleus from the cytoplasm in vitro. Another possible explanation is the nongenomic action of nuclear receptor. For example, estrogen receptor can mediate signaling cascades at the membrane and in the cytoplasm via various second messengers, such as receptor‐mediated protein kinases.^{( 42 )} In lung cancer cells, the proliferative effects of estrogen were mediated primarily by the nongenomic action of ERβ.^{( 43 )} In addition, Conde et al. reported that cytoplsmic localization of SXR represented poor prognosis as well as nuclear localization of SXR.^{( 13 )} Nongenomic action has not been reported in SXR mediated actions, to the best of our knowledge, but nongenomic action with extranuclear SXR may play important roles in modulating the proliferation of esophageal cancer cells. However, further investigations are required to clarify the possible role of SXR in the biological behavior of ESCC.

In summary, we demonstrated expression of SXR using immunohistochemistry and quantitative RT‐PCR in human ESCC. The status of SXR immunoreactivity in carcinoma cells was correlated with several favorable clinicopathological parameters associated with a better clinical outcome for patients.

Disclosure Statement

This research was supported by Risk Analysis Research on Food and Pharmaceuticals for Health and Labor Science Research Grants (H19‐Chemicals‐004).