Abstract
Telomeres play a key role in the maintenance of chromosome integrity and stability. There is growing evidence that short telomeres induce chromosome instability and thereby promote the development of cancer. We investigated the association of telomere length and the risk of lung cancer. Relative telomere length in peripheral blood lymphocytes was measured by quantitative polymerase chain reaction in 243 lung cancer patients and 243 healthy controls that were frequency‐matched for age, sex and smoking status. Telomere length was significantly shorter in lung cancer patients than in controls (mean ± standard deviation: 1.59 ± 0.75 versus 2.16 ± 1.10, P < 0.0001). When the subjects were categorized into quartiles based on telomere length, the risk of lung cancer was found to increase as telomere length shortened (P trend < 0.0001). In addition, when the median of telomere length was used as the cutoff between long and short telomeres, individuals with short telomeres were at a significantly higher risk of lung cancer than those with long telomeres (adjusted odds ratio = 3.15, 95% confidence interval = 2.12–4.67, P < 0.0001). When the cases were categorized by tumor histology, the effect of short telomere length on the risk of lung cancer was more pronounced in patients with small cell carcinoma than in those with squamous cell carcinoma and adenocarcinoma (P = 0.001, test for homogeneity). These findings suggest that shortening of the telomeres may be a risk factor for lung cancer, and therefore, the presence of shortened telomeres may be used as a marker for susceptibility to lung cancer. (Cancer Sci 2008; 99: 1385–1389)
Telomeres are nucleoprotein complexes composed of non‐coding TTAGGG repeats and associated telomere binding proteins. The main function of telomeres is to cap the ends of chromosomes and to protect chromosomes from degradation, end‐to‐end fusion and atypical recombination.( 1 ) Telomeres are approximately 10–15 kb in human somatic cells, and they shorten by 50–200 bp with each cell division,( 2 ) primarily as a result of incomplete replication of linear chromosomes by conventional DNA polymerases (known as the end replication problem).( 3 , 4 , 5 ) This progressive shortening of the telomere limits the replicative capacity of human somatic cells to 50–80 cell divisions and serves as a ‘mitotic clock’ that defines the lifespan of somatic cells.( 6 , 7 ) When the telomeres reach a critical length, cells undergo either irreversible growth arrest, called cellular senescence, or apoptosis.( 8 , 9 )
In addition to the role of telomere shortening in organismal aging, it has been proposed that short telomeres suppress tumor formation by limiting the proliferation of transformed cells.( 8 , 10 , 11 ) However, in contrast to this hypothesis, it has also been reported that cancer risk sharply increases in response to telomere shortening during aging and chronic illness.( 12 ) Moreover, several studies have demonstrated that cancer cells have shorter telomeres than the surrounding non‐malignant cells.( 13 , 14 ) Additionally, studies of telomerase knockout mice found that telomere shortening induces chromosome instability, which is perpetuated through fusion–bridge–breakage cycles that increase the risk of cancer development.( 15 , 16 , 17 , 18 )
Several studies have documented considerable variation in the length of telomeres of peripheral blood lymphocytes among normal individuals of the same age.( 19 , 20 , 21 ) In addition, a few case‐control studies have observed that individuals with shorter telomeres are at an increased risk for the development of human cancers.( 22 , 23 , 24 ) To further verify the role of the telomere length on the risk of lung cancer, we investigated the association between telomere length and lung cancer risk in a case‐control study.
Materials and Methods
Study population. This case‐control study included 243 lung cancer cases and 243 healthy controls. Detailed description of subject enrollment has been published.( 25 , 26 ) Briefly, the cases were newly diagnosed with primary lung cancer between January 2005 and July 2005 at Kyungpook National University Hospital, Daegu, Korea. There were no sex, histological or stage restrictions in this study; however, those patients that were 70 years of age or older, or had a prior history of cancer, were excluded from this study. All patients included agreed to participate in this study. The cases included 94 (38.7%) squamous cell carcinomas (SQ), 110 (45.3%) adenocarcinomas (AD), 31 (12.8%) small cell carcinomas (SCLC) and eight (3.3%) large cell carcinomas. The control subjects were randomly selected from a pool of healthy volunteers who visited the general health check‐up center at Kyungpook National University Hospital during the same period. In total, 1303 of 2324 healthy subjects agreed to participate in this study (participation rate, 56.1%). From 1303 healthy volunteers, we randomly selected 243 control subjects that were frequency matched (1:1) to the cases based on sex, age (±5 years) and smoking status. All of the cancer patients and the controls were ethnic Koreans that resided in Daegu City or the surrounding regions. A detailed questionnaire that included information on the average number of cigarettes smoked daily and the number of years the subjects had smoked was completed for each patient and control by a trained interviewer. For smoking status, a person who had smoked at least once a day for >1 year in his or her lifetime was regarded as a smoker. A former smoker was defined as one who had stopped smoking for at least 1 year before either the diagnosis of lung cancer (cases) or the date the informed consent form had been signed (controls). The cumulative cigarette dose (pack‐years) was calculated using the following formula: pack‐years = (packs per day) × (years smoked). This study was approved by the institutional review board of the Kyungpook National University Hospital and written informed consent was obtained from each participant.
Telomere length assessment. Genomic DNA from peripheral blood cells was extracted using a QuickGene DNA whole blood kit (Fujifilm, Tokyo, Japan). Telomere length was measured using quantitative polymerase chain reaction (Q‐PCR) method as described previously.( 23 , 27 ) Briefly, the relative telomere length was determined by PCR through two steps of relative quantification. In the first step, the relative ratio of the telomere (T) repeat copy number to a single gene (S) copy number (T/S ratio) was established for each sample using standard curves. This ratio is proportional to the average telomere length. In the second step, the ratio of each sample was normalized to a reference DNA to standardize the differences between runs. The human β‐globin gene was used as the single‐copy gene. Telomere PCR and β‐globin PCR were always conducted in separate 384 wells and each sample run in triplicate. The PCR primers for the telomeres and the human β‐globin were as follows: Tel.1b, 5′‐CGG TTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT‐3′; Tel.2b, 5′‐GGCTTGCCTT ACCCTTACCCTTACCCTTACCCTTACCCT‐3′; hbg1, 5′‐GCTTCTGACACAACTGTG TTCACTAGC‐3′; and hbg2, 5′‐CACCAACTTCATCCACGTTCACC‐3′. Primers were used at final concentrations of Tel.1b, 100 nM; Tel.2b, 900 nM; hbg1, 300 nM; and hbg2, 700 nM. An aliquot of 3.75 ng (3 µL) of template DNA was added to each reaction, which contained 5 µL of SYBR Green PCR Master Mix (QuantiTect SYBR Green PCR, QIAGEN, Seoul, Korea) and 2 µL of a primer mixture. The DNA quantity standards were serial dilutions of a reference DNA sample (the same DNA sample for all runs) to produce five final concentrations (0.4, 0.8, 1.6, 3.2 and 6.4 ng/µL). In each run, a standard curve and a negative control (water) were included. The PCR was performed using a real time PCR instrument (LightCycler 480, Roche, Basel, Switzerland). The thermal cycling profile for the telomere amplification consisted of initial denaturation at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 56°C for 1 min and the profile used for the β‐globin amplification was 95°C for 10 min followed by 50 cycles of 95°C for 15 s and 58°C for 1 min. Following amplification, a melting curve was created to confirm the specificity of the reaction. The R 2 for each standard curve was >0.98. The assay was conducted by laboratory personnel blinded to the subject's case‐control status. In addition, 10% of the samples were repeated on different plates to assess the T/S reproducibility. The Pearson and Spearman correlation coefficients were 0.89 (P < 0.01) and 0.87 (P < 0.01), respectively. The interbatch and intrabatch coefficients of variation (CV) were 7.5% and 1.7%, respectively.
Statistical analysis. Telomere length was analyzed as a continuous variable and as a categorical variable. ANOVA or t‐test was used to evaluate the differences in telomere length as a continuous variable by case‐control status, age, sex, smoking history (never‐, former‐ and current‐smoker), and smoking pack‐years in ever‐smokers. As a categorical variable, the quartile value of telomere length, according to its distribution in control subjects, was used to compare the differences between the cases and controls. In addition, telomere length was dichotomized at the median value in control subjects. The categorized telomere length of the cases and controls were compared using the χ2 test. Unconditional logistic regression analysis was used to calculate the odds ratios (OR) and 95% confidence intervals (CI), with adjustment for possible confounders (sex as a nominal variable, age and pack‐years of smoking as continuous variables). The homogeneity test was conducted to compare the difference between telomere‐length‐related OR of different groups. All the analyses were performed using Statistical Analysis Software for Windows, ver. 8.12 (SAS institute, Cary, NC, USA).
Results
The demographics of the cases and controls enrolled in this study are shown in Table 1. There were no significant differences in the distribution of mean age, sex or smoking status between the cases and controls, which suggests that adequate matching was conducted based on these three variables. However, the number of pack‐years in ever‐smokers was significantly higher in the cases than in the controls (mean ± standard deviation [SD]: 37.7 ± 15.4 versus 31.2 ± 14.7 pack‐years; P < 0.001).
Table 1.
Characteristics of the study population
| Variable | Cases (n = 243) | Controls (n = 243) |
|---|---|---|
| Age (years) | 59.2 ± 6.6 | 59.0 ± 6.5 |
| Sex | ||
| Male | 167 (68.7)† | 167 (68.7) |
| Female | 76 (31.3) | 76 (31.3) |
| Smoking status | ||
| Current | 122 (50.2) | 120 (49.4) |
| Former | 49 (20.2) | 48 (19.8) |
| Never | 72 (29.6) | 75 (30.9) |
| Pack‐years*, ‡ | 37.7 ± 15.4 | 31.2 ± 14.7 |
P < 0.001.
Numbers in parenthesis, percentage.
In current and former smokers.
Telomere length was significantly shorter in lung cancer patients than in controls (mean ± SD: 1.59 ± 0.75 versus 2.16 ± 1.10, P < 0.0001). The effects of covariates on telomere length in the cases and controls are shown in Table 2. When the subjects were dichotomized by their median age, telomere length was significantly shorter in the older‐age group than in the younger‐age group among the controls (mean ± SD: 1.95 ± 1.02 versus 2.41 ± 1.14, P = 0.001), but not among the cases (mean ± SD: 1.55 ± 0.68 versus 1.64 ± 0.83, P = 0.35). However, no significant differences in telomere length according to sex, smoking status and pack‐years of smoking were found in either the case or the control group. When the telomere length of the case group was compared with that of the control group, it was significantly shorter in the cases than in the controls for each of the subgroups evaluated.
Table 2.
Effects of covariates on telomere length by case‐control status
| Variables | Cases | Controls | P * | ||
|---|---|---|---|---|---|
| n | Mean (SD † ) | n | Mean (SD) | ||
| Overall | 243 | 1.59 ± 0.75 | 243 | 2.16 ± 1.10 | <0.0001 |
| Age (years) | |||||
| <60 | 109 | 1.64 ± 0.83 | 113 | 2.41 ± 1.14 | <0.0001 |
| ≥60 | 134 | 1.55 ± 0.68 | 130 | 1.95 ± 1.02 | 0.0002 |
| P * | 0.35 | 0.001 | |||
| Sex | |||||
| Male | 167 | 1.55 ± 0.77 | 167 | 2.22 ± 1.05 | <0.0001 |
| Female | 76 | 1.66 ± 0.70 | 76 | 2.02 ± 1.20 | 0.02 |
| P * | 0.31 | 0.20 | |||
| Smoking status | |||||
| Never | 72 | 1.63 ± 0.62 | 75 | 1.95 ± 1.08 | 0.03 |
| Former | 49 | 1.58 ± 0.78 | 48 | 2.21 ± 1.15 | 0.002 |
| Current | 122 | 1.57 ± 0.81 | 120 | 2.28 ± 1.08 | <0.0001 |
| P * | 0.87 | 0.12 | |||
| Pack‐years | |||||
| <31 | 65 | 1.71 ± 0.90 | 91 | 2.30 ± 1.09 | 0.0006 |
| ≥31 | 106 | 1.49 ± 0.72 | 77 | 2.22 ± 0.84 | <0.0001 |
| P * | 0.10 | 0.64 | |||
P‐value using two‐sided one‐way ANOVA or t‐test.
Standard deviation.
Table 3 shows the lung cancer risk related to the telomere length. When the subjects were categorized into quartiles of telomere length based on the telomere length distribution of the controls, with the fourth (longest) quartile being used as the reference category, the adjusted OR for lung cancer were increased from 4.84 (95% CI = 2.22–10.55) to 9.82 (95% CI = 4.64–20.81) to 8.73 (95% CI = 4.08–18.71) as the telomere length shortened from the 3rd to the 1st quartile (P trend < 0.0001). When the median value of the telomere length of the control subjects was used as the cutoff between long and short telomeres, individuals with short telomeres were at a significantly increased risk of lung cancer compared with the subjects with long telomeres (adjusted OR = 3.15, 95% CI = 2.12–4.67, P < 0.0001).
Table 3.
Associations between telomere length and lung cancer risk
| Telomere status | Cases (n = 243) | Controls (n = 243) | P † | |
|---|---|---|---|---|
| n (%) | n (%) | OR (95% CI) † | ||
| Categorized by quartile in controls | ||||
| 4th quartile | 10 (4.1) | 60 (24.7) | 1.00 | |
| 3rd quartile | 48 (19.8) | 61 (25.1) | 4.84 (2.22–10.55) | <0.0001 |
| 2nd quartile | 101 (41.6) | 62 (25.5) | 9.82 (4.64–20.81) | <0.0001 |
| 1st quartile | 84 (34.6) | 60 (24.7) | 8.73 (4.08–18.71) | <0.0001 |
| P ‡ | <0.0001 | |||
| P trend | <0.0001 | |||
| Categorized by median in controls | ||||
| Long | 58 (23.9) | 121 (49.8) | 1.00 | |
| Short | 185 (76.1) | 122 (50.2) | 3.15 (2.12–4.67) | <0.0001 |
| P ‡ | <0.0001 | |||
Odds ratios (95% confidence intervals) and corresponding P‐values were calculated by unconditional logistic regression, adjusted for age, sex and pack‐years of smoking.
χ2 test for distribution between the cases and controls.
The effect of telomere length on the risk of lung cancer was further examined after stratifying the subjects according to age, sex, smoking status and tumor histology. In all subgroups, a short telomere was associated with a significantly increased risk of lung cancer (Table 4). In addition, when stratified by the median age, the effect of telomere length on the risk of lung cancer was more pronounced in younger subjects than in older subjects (adjusted OR = 4.23, 95% CI = 2.36–7.56 versus adjusted OR = 2.47, 95% CI = 1.42–4.15; P = 0.05, test for homogeneity). However, when stratified by sex and smoking status, the effect of a short telomere on the risk of lung cancer was similar in males and females, as well as in never‐ and ever‐smokers. In addition, we did not observe statistically significant evidence of interactions between telomere length and smoking in the multivariate logistic regression analysis (P = 0.42 for the interaction term between telomere length and smoking status [never‐/ever‐smokers]). When the analysis was stratified by tumor histology, the effect of a short telomere on the risk of lung cancer was more pronounced in SCLC than in SQ and AD (adjusted OR = 15.75, 95% CI = 3.60–68.96 for SCLC versus adjusted OR = 2.74, 95% CI = 1.56–4.81 for SQ and adjusted OR = 2.74, 95% CI = 1.65–4.54 for AD; P = 0.001, test for homogeneity).
Table 4.
Lung cancer risk estimates for telomere length by selected variables
| Variables | Cases (n = 243) | Controls (n = 243) | OR (95% CI)† for short telomere | P † | P H ‡ | ||
|---|---|---|---|---|---|---|---|
| Long | Short | Long | Short | ||||
| Age (years) | |||||||
| <61 | 27 (24.8) | 82 (75.2) | 66 (58.4) | 47 (41.6) | 4.23 (2.36–7.56) | <0.0001 | |
| ≥61 | 31 (23.1) | 103 (76.9) | 55 (42.3) | 75 (57.7) | 2.47 (1.42–4.15) | 0.0010 | 0.05 |
| Sex | |||||||
| Male | 40 (24.0) | 127 (76.0) | 86 (51.5) | 81 (48.5) | 3.40 (2.09–5.54) | <0.0001 | |
| Female | 18 (23.7) | 58 (76.3) | 35 (46.1) | 41 (53.9) | 2.93 (1.44–5.97) | 0.0030 | 0.28 |
| Smoking status | |||||||
| Never | 17 (23.6) | 55 (76.4) | 33 (44.0) | 42 (56.0) | 2.52 (1.24–5.15) | 0.0100 | |
| Ever | 41 (24.0) | 130 (76.0) | 88 (52.4) | 80 (47.6) | 3.61 (2.24–5.80)* | <0.0001 | 0.21 |
| Pack‐years | |||||||
| <31 | 19 (29.2) | 46 (71.8) | 51 (56.0) | 40 (44.0) | 3.36 (1.66–6.83) | 0.0009 | |
| ≥31 | 22 (20.8) | 84 (79.0) | 37 (48.1) | 40 (51.9) | 3.84 (1.97–7.40) | <0.0001 | 0.70 |
| Histological type | |||||||
| Squamous cell c. | 25 (26.6) | 69 (73.4) | 121 (49.8) | 122 (50.2) | 2.74 (1.56–4.81) | 0.0004 | |
| Adenoca. | 29 (26.4) | 81 (73.6) | 121 (49.8) | 122 (50.2) | 2.74 (1.65–4.54) | <0.0001 | |
| Small cell c. | 2 (6.4) | 29 (93.6) | 121 (49.8) | 122 (50.2) | 15.75 (3.60–68.96) | 0.0003 | 0.001 |
P = 0.42 for interaction term between telomere length and smoking status in the multivariate model.
Odds ratios (OR; 95% confidence intervals) and corresponding P‐values were calculated using unconditional logistic regression analysis, adjusted for age, sex and pack‐years of smoking when appropriate.
Test for homogeneity.
Discussion
In the present study, we investigated the association between the telomere length of peripheral blood lymphocytes and the risk of lung cancer. We found that a short telomere was associated with a significantly increased risk of lung cancer, and that the risk of lung cancer increased as the telomere shortened. These findings suggest that telomere dysfunction caused by the shortening of telomeres may be a risk factor for lung cancer and that measurement of the age‐adjusted relative telomere length of peripheral blood lymphocytes could be used to predict the risk of lung cancer. The results of several studies have shown that telomere shortening is associated with an increased risk of head, neck, bladder and breast cancers; therefore, telomere length may be helpful for predicting the susceptibility to lung cancer and other human cancers.
There is growing evidence indicating that telomere shortening plays a dual role in epithelial carcinogenesis. During the early phase of cancer development, short telomeres induce chromosome instability and thereby enhance cancer initiation. However, after telomerase is re‐activated and the telomere attrition is stabilized, short telomeres inhibit tumor progression and the development of macroscopic advanced tumors.( 9 , 28 , 29 ) Our finding of an association of the presence of a short telomere with an increased risk for the development of lung cancer also suggests that shortening of the telomere is involved in the early phase of the multistep process of carcinogenesis.
It has been argued that genetic instability primarily occurs during the early stages of carcinogenesis, and that it is required for the generation of the multiple mutations that underlie cancer.( 30 , 31 ) This genetic instability exists at two distinct levels: the nucleotide level and the chromosomal level. In a small subset of epithelial tumors that have mutations or inactivation of mismatch repair genes, instability is observed at the nucleotide level and results in microsatellite instability. By contrast, most human cancers, including lung cancer, exhibit chromosomal instability such as alterations in chromosome number (gains and losses of chromosomes; aneuploidy) and chromosome translocation.( 30 , 31 , 32 ) Although the molecular mechanisms by which this chromosomal instability occurs remain undefined, there are several possibilities, including alterations in mitotic checkpoint genes or genes involved in centromere function or chromosomal aggregation.( 30 , 31 ) Another possible mechanism is that chromosomal instability is generated in cells at senescence when chromosomes have severe telomere attrition. Shortening of the telomere can lead to chromosomal rearrangement via fusion–bridge–breakage cycles, thereby generating the numerical and structural changes of chromosomes needed for epithelial carcinogenesis.( 9 , 14 , 15 , 16 , 17 , 18 , 29 , 33 ) Our finding of an association between short telomeres and the risk of lung cancer is comparable with the telomere‐driven chromosomal instability theory, and suggests that individuals with constitutionally short telomeres may be more prone to acquiring chromosome instability, and therefore be at an increased risk for lung cancer development. In addition, recent studies have shown that telomere shortening causes impairment of immune cell function and accelerates immune senescence.( 34 , 35 , 36 ) Therefore, it is possible that individuals with short telomeres may be prone to premature immune senescence, and thus at an increased risk for lung cancer. However, future studies are necessary to determine the mechanism by which shortened telomere length increases the risk of lung cancer.
Our findings are also consistent with those of a previous lung cancer study in which an increased risk of lung cancer was found in individuals with shorter telomeres.( 22 ) Wu et al.( 22 ) assessed telomere length of peripheral blood lymphocytes by quantitative fluorescence in situ hybridization in 54 lung cancer cases and 54 controls. They observed that telomere length was significantly shorter in patients with lung cancer than in control subjects (P = 0.006). In addition to lung cancer study, a few studies have found that individuals with shorter telomeres have a higher risk of head, neck, bladder and breast cancers.( 22 , 23 , 24 ) It has been also reported that short telomeres were associated with an increased risk of hepatoma and esophageal cancer.( 14 , 37 )
An interesting finding of the present study is that short telomeres had a more pronounced association with SCLC than SQ and AD of the lung. Although the reason for the observed difference in risk conferred by telomere shortening is unclear, this difference might have occurred as a result of differences in the pathways of carcinogenesis among the different histological types of lung cancer.( 38 , 39 ) Hiyama et al.( 40 ) assessed telomerase activity in surgically resected SCLC and non‐small cell lung cancer (NSCLC) tissues and found that telomerase activity was more frequently increased in SCLC than NSCLC and that the level of telomerase activity was also significantly higher in SCLC than NSCLC. Considering that critically short telomeres lead to chromosomal instability that drives tumor formation both through the activation of telomerase and through the generation of other mutations necessary for tumor progression, this observation may indicate that telomere shortening and telomerase re‐activation has a more pronounced association with the development of SCLC, which is consistent with our finding that shortening of the telomere plays an important role in determining the susceptibility to SCLC. However, it is possible that our finding is due to chance because of the relatively small number of subjects in the subgroups, particularly in the SCLC group. Therefore, larger studies should be conducted to confirm these results.
We also evaluated the effect of age, sex and smoking on telomere length. In the present study, telomere length was significantly shorter in the older‐age group than in the younger‐age group among the controls. This finding indicates a contribution of age to telomere length, which is consistent with previous observations.( 20 , 24 ) Although it has been reported that telomere length decreases in a dose‐dependent manner as the amount of cigarettes smoked increases,( 41 , 42 ) we did not observe inverse relationship between telomere length and smoking (smoking status and smoking exposure level).
In the present study, telomere length was measured in a surrogate tissue, peripheral blood lymphocytes. The use of a surrogate tissue is reasonable because studies of monozygotic and dizygotic twins have shown that the majority of the interindividual variation in telomere length is genetically determined.( 21 , 43 ) In addition, the importance of the genetic component in the regulation of telomere length comes from studies of cells with different origin, such as skin fibroblasts and peripheral blood cells, which have different microenvironment and replicative histories, but show a good intraindividual correlation for telomere length.( 44 )
The standard method for the measurement of telomere length is the Southern blot based terminal restriction fragment assay. However, a large amount of DNA is required for Southern blot analysis with selected restriction enzymes to be conducted, and contributions of individual subtelomeric DNA fragments limit the ability of this method to accurately show the telomeric length. The Q‐PCR method, developed by Cawthon,( 27 ) and used in the present study, has the advantages of high throughput and high sensitivity. In addition, although the values are not absolute amounts, the relative T/S ratio has been confirmed to be highly consistent with the results given by the Southern blot assay.( 27 ) Taken together, these results suggest that the Q‐PCR method is reliable and useful in large‐scale epidemiologic studies. To minimize the variation among different batches, we performed triplicate assays in the present study.
In conclusion, we found that individuals with constitutionally short telomeres were at a significantly increased risk of lung cancer. The present study is an important addition to a small case‐control study,( 22 ) in which an association of short telomeres with lung cancer risk was observed. It is interesting to note that, in this study, we found that the effect of short telomere length on the risk of lung cancer was more pronounced in patients with SCLC. Our findings suggest that telomere dysfunction caused by telomere shortening may be a risk factor for lung cancer.
Acknowledgments
This study is supported in part by a grant from the national R & D Program for Cancer Control Ministry of Health & Welfare, Republic of Korea (0720550‐2), and in part by the Brain Korea 21 Project in 2006.
References
- 1. Blasco MA. Telomeres and human disease: aging, cancer and beyond. Nat Rev Genet 2005; 6: 611–22. [DOI] [PubMed] [Google Scholar]
- 2. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE. Telomere shortening is proportional to the size of the 3′G‐rich telomeric overhanging. J Biol Chem 2000; 275: 19719–22. [DOI] [PubMed] [Google Scholar]
- 3. Levy MZ, Allsopp RC, Futcher AB, Greider CW, Harley CB. Telomere end‐replication problem and cell aging. J Mol Biol 1992; 225: 951–60. [DOI] [PubMed] [Google Scholar]
- 4. Allsopp RC, Chang E, Kashefi‐Aazam M et al . Telomere shortening is associated with cell division in vitro and in vivo . Exp Cell Res 1995; 220: 194–200. [DOI] [PubMed] [Google Scholar]
- 5. Gilley D, Tanaka H, Herbert BS. Telomere dysfunction in aging and cancer. Int J Biochem Cell Biol 2005; 37: 1000–13. [DOI] [PubMed] [Google Scholar]
- 6. Allsopp RC, Vaziri H, Patterson C et al . Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci USA 1992; 89: 10114–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Blackburn EH. Switching and signaling at the telomere. Cell 2001; 106: 661–73. [DOI] [PubMed] [Google Scholar]
- 8. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990; 345: 458–60. [DOI] [PubMed] [Google Scholar]
- 9. Londono‐Vallejo JA. Telomere instability and cancer. Biochimie 2008; 90: 73–82. [DOI] [PubMed] [Google Scholar]
- 10. Wright WE, Shay JW. The two‐stage mechanism controlling cellular senescence and immortalization. Exp Gerontol 1992; 27: 383–9. [DOI] [PubMed] [Google Scholar]
- 11. Campisi J. Cellular senescence as a tumor‐suppressor mechanism. Trends Cell Biol 2001; 11: S27–31. [DOI] [PubMed] [Google Scholar]
- 12. Djojosubroto MW, Choi YS, Lee HW, Rudolph KL. Telomeres and telomerase in aging, regeneration and cancer. Mol Cell 2003; 15: 164–75. [PubMed] [Google Scholar]
- 13. Plentz RR, Wiemann SU, Flemming P et al . Telomere shortening of epithelial cells characterizes the adenoma‐carcinoma transition of human colorectal cancer. Gut 2003; 52: 1304–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Plentz RR, Caselitz M, Bleck JS et al . Hepatocellular telomere shortening correlates with chromosomal instability and the development of human hepatoma. Hepatology 2004; 40: 80–6. [DOI] [PubMed] [Google Scholar]
- 15. Blasco MA, Lee HW, Hande MP et al . Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997; 91: 25–34. [DOI] [PubMed] [Google Scholar]
- 16. Rudolph KL, Chang S, Lee HW et al . Longevity, stress response, and cancer in aging telomerase deficient mice. Cell 1999; 96: 701–12. [DOI] [PubMed] [Google Scholar]
- 17. Rudolph KL, Millard M, Bosenberg MW, DePinho RA. Telemere dysfunction and evolution of intestinal carcinoma in mice and humans. Nat Genet 2001; 28: 155–9. [DOI] [PubMed] [Google Scholar]
- 18. Artandi SE, Chang S, Lee SL et al . Telomere dysfunction promotes non‐reciprocal translocations and epithelial cancers in mice. Nature 2000; 406: 641–5. [DOI] [PubMed] [Google Scholar]
- 19. Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK, Allshire RC. Telomere reduction in human colorectal carcinoma and with ageing. Nature 1990; 346: 866–8. [DOI] [PubMed] [Google Scholar]
- 20. Iwama H, Ohyashiki K, Ohyashiki JH et al . Telomere length and telomerase activity with age in peripheral blood cells obtained from normal individuals. Hum Genet 1998; 102: 397–402. [DOI] [PubMed] [Google Scholar]
- 21. Flenck RW, Blackburn EH, Shannon KM. The rate of telomere sequence loss in human leukocytes varies with age. Proc Natl Acad Sci USA 1998; 95: 5607–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Wu X, Amos CI, Zhu Y et al . Telomere dysfunction: a potential cancer predisposition factor. J Natl Cancer Inst 2003; 95: 1211–18. [DOI] [PubMed] [Google Scholar]
- 23. McGrath M, Wong JYY, Michaud D, Hunter DJ, De Vivo I. Telomere length, cigarette smoking, and bladder cancer risk in men and women. Cancer Epidemiol Biomark Prev 2007; 16: 815–19. [DOI] [PubMed] [Google Scholar]
- 24. Shen J, Terry MB, Gurvich I, Liao Y, Denie RT, Santella RM. Short telomere length and breast cancer risk: a study in sister sets. Cancer Res 2007; 67: 5538–44. [DOI] [PubMed] [Google Scholar]
- 25. Park JY, Park JM, Jang JS et al . Caspase 9 promoter polymorphisms and risk of primary lung cancer. Human Mol Genet 2006; 15: 1963–71. [DOI] [PubMed] [Google Scholar]
- 26. Park SH, Choi JE, Kim EJ et al . Polymorphisms in the FAS and FasL genes and risk of lung cancer in a Korean population. Lung Cancer 2006; 54: 303–8. [DOI] [PubMed] [Google Scholar]
- 27. Cawthon RM. Telomere measurement by quantitative PCR. Nucleic Acids Res 2002; 30: e47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Hackett JA, Greider CW. Balancing instability: dual roles for telomerase and telomere dysfunction in tumorigenesis. Oncogene 2002; 21: 619–26. [DOI] [PubMed] [Google Scholar]
- 29. Ju Z, Rudolph KL. Telomeres and telomerase in cancer stem cells. Eur J Cancer 2006; 42: 1197–203. [DOI] [PubMed] [Google Scholar]
- 30. Lengauer C, Kinzler KW, Vogelstein B. Genetic instabilities in human cancers. Nature 1998; 396: 643–9. [DOI] [PubMed] [Google Scholar]
- 31. Loeb LA. A mutator phenotype in cancer. Cancer Res 2001; 61: 3230–9. [PubMed] [Google Scholar]
- 32. Mertens F, Johansson B, Hoglund M, Mitelman F. Chromosomal imbalance maps of malignant solid tumors: a cytogenetic survey of 3185 neoplasms. Cancer Res 1997; 57: 2765–80. [PubMed] [Google Scholar]
- 33. Hahn W. Role of telomeres and telomerase in the pathogenesis of human cancer. J Clin Oncol 2003; 21: 2034–43. [DOI] [PubMed] [Google Scholar]
- 34. Miller RA. Telomere diminution as a cause of immune failure in old age: an unfashionable demurral. Biochem Soc Trans 2000; 28: 241–5. [DOI] [PubMed] [Google Scholar]
- 35. Knudson M, Kulkarni S, Ballas ZK, Bessler M, Goldman F. Association of immune abnormalities with telomere shortening in autosomal‐dominant dyskeratosis congenital. Blood 2005; 105: 682–8. [DOI] [PubMed] [Google Scholar]
- 36. Damjanovic AK, Yang Y, Glaser R et al . Accelerated telomere erosion is associated with a declining immune function of caregivers of Alzheimer's disease patients. J Immunol 2007; 179: 4249–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Risques RA, Vaughan TL, Li X et al . Leukocyte telomere length predicts cancer risk in Barrett's esophagus. Cancer Epidemiol Biomakers Prev 2007; 12: 2649–55. [DOI] [PubMed] [Google Scholar]
- 38. Sekido Y, Fong KM, Minna JD. Molecular genetics of lung cancer. Annu Rev Med 2003; 54: 73–87. [DOI] [PubMed] [Google Scholar]
- 39. Girard L, Zochbauer‐Muller S, Virmani AK, Gazdar AF, Minna JD. Genome‐wide allelotyping of lung cancer identifies new regions of allelic loss, differences between small cell lung cancer and non‐small cell lung cancer, and loci clustering. Cancer Res 2000; 60: 4894–906. [PubMed] [Google Scholar]
- 40. Hiyama K, Hiyama E, Ishioka S et al . Telomerase activity in small‐cell and non‐small cell lung cancers. J Natl Cancer Inst 1995; 87: 895–901. [DOI] [PubMed] [Google Scholar]
- 41. Valdes AM, Andrew T, Gardner JP et al . Obesity, cigarette smoking, and telomere length in women. Lancet 2005; 366: 662–4. [DOI] [PubMed] [Google Scholar]
- 42. Morla M, Busquests X, Pons J, Sauleda J, MacNee W, Agusti AGN. Telomere shortening in smokers with and without COPD. Eur Respir J 2006; 27: 525–8. [DOI] [PubMed] [Google Scholar]
- 43. Slagboom PE, Droog S, Boomsma DI. Genetic determination of telomere size in humans: a twin study of three age groups. Am J Human Genet 1994; 55: 876–82. [PMC free article] [PubMed] [Google Scholar]
- 44. Von Zglinicki T, Serra V, Lorenz M et al . Short telomeres in patients with vascular dementia: an indicator of low antioxidative capacity and a possible risk factor? Lab Invest 2000; 80: 1739–47. [DOI] [PubMed] [Google Scholar]