Abstract
Activating mutations of EGFR are found frequently in a subgroup of patients with non‐small cell lung cancer (NSCLC) and are highly correlated with the response to gefitinib and erlotinib. In the present study, we searched for mutations of EGFR, HER2 and KRAS in 264 resected primary NSCLC from Japanese patients and determined whether there is a correlation between genetic alterations of these genes and clinicopathological factors, together with 85 tumors that we reported previously. EGFR mutations were found in 102 of the total 349 tumors, and seven tumors had two missense mutations. Reverse transcription–polymerase chain reaction of EGFR and subsequent subcloning analyses identified that the double mutations occurred in the same allele. Furthermore, in 202 NSCLC analyzed by Southern blotting, we identified 11 tumors with gene amplification of EGFR, with eight tumors containing a mutation in EGFR. Sequence analysis detected only weak or no signals of the wild‐type allele in the eight tumors, strongly suggesting that the mutated allele was amplified selectively. These findings indicate that a dual genetic change of EGFR can occur in the same allele either with a possible second‐hit mutation or with amplification, which may imply a more selective growth advantage in a cancer cell. Meanwhile, HER2 mutations and amplifications were found in six of 349 tumors and three of 202 tumors, respectively, and KRAS mutations in 21 of 349 tumors. Mutations of the EGFR and HER2 genes were more frequently found in female never or light‐smoking patients with adenocarcinoma, and there were no tumors that had two or more mutations simultaneously among EGFR, HER2 and KRAS. The current study further demonstrates that a double genetic event in EGFR can occasionally occur in lung cancer, thus providing new clues for understanding the involvement of epidermal growth factor receptor signaling cascades in the pathogenesis of NSCLC. (Cancer Sci 2006; 97: 753–759)
Abbreviations:
- EGFR
epidermal growth factor receptor
- FISH
fluorescence in situ hybridization
- NSCLC
non‐small cell lung cancer
- PCR
polymerase chain reaction
- RT‐PCR
reverse transcription–polymerase chain reaction
- SSCP
single‐strand conformation polymorphism
- TK
tyrosine kinase
- TKI
tyrosine kinase inhibitor.
Non‐small cell lung cancer is one of the leading causes of death from cancer in Japan and Western countries.( 1 , 2 ) Although the prognosis for patients with advanced NSCLC has not improved in the last 20 years,( 3 ) the molecular and biological characteristics of lung cancer have been studied intensively( 4 , 5 ) and many molecules associated with the pathogenesis of lung cancer have been identified as promising new targets for lung cancer therapy.( 6 ) Among these molecules, EGFR, one of the ERBB family of receptors, is thought to be a promising target because of its frequent overexpression (range 40–80%) in NSCLC( 7 ) and its relationship with poor prognosis.( 8 ) Small molecules of EGFR‐TKI, such as gefitinib and erlotinib, have been developed, examined for the treatment of NSCLC, and shown to have antitumor activity.( 9 ) Several clinical studies have revealed that Japanese female never‐smoking patients with adenocarcinoma have a higher response rate to gefitinib.( 10 , 11 ) Recently, activating mutations of the TK domain of EGFR were found in a unique subgroup of NSCLC and were highly correlated with the response to EGFR‐TKI.( 12 , 13 , 14 ) Subsequent analyses using a large series of NSCLC confirmed somatic mutations in the similar subgroup of patients as known clinical predictors of EGFR‐TKI sensitivity.( 15 , 16 , 17 , 18 ) Moreover, recent studies have shown that increased copy numbers of the EGFR gene are associated with a better response to EGFR‐TKI.( 17 , 19 ) HER2, another member of the ERBB family, can heterodimerize with EGFR and has also been shown to have somatic mutations in the TK domain in several cancers including NSCLC.( 20 , 21 ) However, the involvement of HER2 alterations in the pathogenesis of NSCLC is not clearly understood.
After earlier reporting 17 mutations of EGFR in 85 NSCLC,( 22 ) we further extended our analysis with another 264 NSCLC. In a total of 349 tumors, we found 102 with EGFR mutation, six with HER2 mutation, and 21 with KRAS mutation. We also identified seven tumors with double mutations of EGFR and eight tumors with both mutation and amplification of EGFR. We therefore investigated the double genetic event of EGFR in detail. Our results provide new insights into the involvement of alterations of the receptor TK family in NSCLC development.
Materials and Methods
Samples
Primary lung tumor tissues were obtained from 349 randomly selected patients with NSCLC who underwent potentially curative pulmonary resection at Nagoya University Hospital, Nagoya First Red Cross Hospital, Nagoya Second Red Cross Hospital, Kasugai Municipal Hospital and Social Insurance Chukyo Hospital in Japan from August 1999 through to November 2003. In each case, tumor and corresponding normal lung tissue samples (taken as far as possible from the neoplastic area) were snap frozen and stored at −80°C. Ethical approval was obtained from each of the five hospitals and fully informed written consent was obtained from all patients prior to tissue collection.
The clinicopathological characteristics of the 349 primary NSCLC patients are summarized in Table 1. The study population consisted of 226 men and 123 women, with a mean age of 65 years (range 29–85 years). Histological type was determined according to the third World Health Organization/International Association for the Study of Lung Cancer classifications, with 242 adenocarcinomas, 89 squamous cell carcinomas, seven large cell carcinomas, three adenosquamous carcinomas, one pleomorphic carcinoma, one mucoepidermoid carcinoma, and six unclassified NSCLC. Smoking history was obtained by anamnesic data at admission or first outpatient visit. There were 107 never smokers, 24 light smokers (pack‐year < 20) and 201 heavy smokers (pack‐year 20), with 17 patients of undetermined smoking status. P‐stage was determined according to the TNM staging system. One hundred and eighty patients were classified at stage I, 46 at stage II, 88 at stage III and nine at stage IV. The P‐stage of 26 patients was not determined.
Table 1.
Clinicopathological characteristics of 349 primary non‐small cell lung carcinoma patients
| Parameters | n | % |
|---|---|---|
| Age (years) | ||
| Mean | 65 (range 29–85) | |
| Sex | ||
| Male | 226 | 65 |
| Female | 123 | 35 |
| Histology | ||
| Adenocarcinoma | 242 | 69 |
| Squamous cell carcinoma | 89 | 26 |
| Large cell carcinoma | 7 | 2 |
| Adenosquamous carcinoma | 3 | 0.9 |
| Pleomorphic carcinoma | 1 | 0.2 |
| Mucoepidermoid carcinoma | 1 | 0.2 |
| Unclassified non‐small cell carcinoma | 6 | 1.7 |
| Smoking history | ||
| Never or light smokers† | 131 | 38 |
| Heavy smokers | 201 | 57 |
| Undetermined | 17 | 5 |
| P‐stage | ||
| I or II | 226 | 65 |
| III or IV | 97 | 28 |
| Undetermined | 26 | 7 |
Pack‐year < 20.
DNA extraction and direct sequencing
Genomic DNA was prepared from portions of frozen tumors or non‐cancerous lung tissues by a standard technique.( 23 ) Genomic DNA (20 ng) was amplified by PCR. The first four (exons 18–21) of seven exons (exons 18–24) encoding the TK domain of EGFR were examined. The primer sequences were 5′‐GGCACTGCTTTCCAGCATGG‐3′ and 5′‐CAGCTTGCAAGGACTCTGGG‐3′ for exon 18, 5′‐CATGTGGCACCATCTCACAA‐3′ and 5′‐CCTGAGGTTCAGAGCCATGG‐3′ for exon 19, 5′‐ATGCGAAGCCACACTGACGT‐3′ and 5′‐GTATCTCCCTTCCCTGATTA‐3′ for exon 20, and 5′‐GGCATGAACATGACCCTGAA‐3′ and 5′‐ACAGCTAGTGGGAAGGCAGC‐3′ for exon 21. Mutations in exon 20 of HER2 and codons 12 and 13 of KRAS were examined by direct sequencing. The primer sequences were 5′‐GCCATGGCTGTGGTTTGTGATGG‐3′ and 5′‐ATCCTAGCCCCTTGTGGACATAGG‐3′ for exon 20 of HER2, and 5′‐GGCCTGCTGAAAATGACTGA‐3′ and 5′‐GTCCTGCACCAGTAATATGC‐3′ for codons 12 and 13 of KRAS.
The PCR products were sequenced using ABI PRISM 3100 (Applied Biosystems, Foster City, CA, USA) with a PCR primer and a BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems) as described previously.( 24 )
Mutation‐specific PCR and SSCP analyses for L858R EGFR mutation
Mutation‐specific PCR analysis for the L858R mutation was carried out using a forward primer with T substituted to G at the 3′ end (5′‐AAGATCACAGATTTTGGGCG‐3′) and a reverse primer (5′‐ACAGCTAGTGGGAAGGCAGC‐3′). Genomic DNA (20 ng) was amplified by touch‐down PCR. The conditions used were 10 cycles at 95°C for 30 s, 67–57°C (decreasing 1°C/cycle) for 30 s, and 72°C for 30 s, followed by 20 cycles at 95°C for 30 s, 57°C for 30 s and 72°C for 30 s, and a 7‐min extension at 72°C. The PCR products were then applied to a 3% agarose gel, and the band of expected size detected by ultraviolet light was defined as positive.
Single‐strand conformation polymorphism analysis was carried out for exon 21 to cover the L858R mutation on mutation detection enhancement gels (FMC Bioproducts, Rockland, ME, USA) containing 10% glycerol with a primer set of 5′‐CAGGGCATGAACTACTTGGA‐3′ and 5′‐TTGCCTCCTTCTGCATGGTA‐3′, as described previously.( 25 )
Cloning of EGFR cDNA
Total RNA was extracted from tumor samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First‐strand cDNA was generated using SuperScript II (Invitrogen) and random primers (Takara Bio, Tokyo, Japan) according to the manufacturer's instructions. RT‐PCR was carried out using the primer set 5′‐TAAGATCCCGTCCATCGCCA‐3′ and 5′‐TTGCCTCCTTCTGCATGGTA‐3′, covering exons 18–21 of EGFR. Amplified products were subcloned into pGEM‐T Easy Vectors (Invitrogen) using XL‐1 and XL‐1 mutS strains (Stratagene, La Jolla, CA, USA) as competent cells. More than 25 clones were picked up for each sample, plasmids were purified using QIAprep Spin Miniprep KIT (Qiagen, Valencia, CA, USA), and the inserts were sequenced bidirectionally.
Southern blot analysis
A total of 7 µg of genomic DNA digested with EcoRI endonuclease (New England Biolabs, Beverly, MA, USA) was electrophoresed on a 0.7% agarose gel, transferred to Hybond N+ membranes (Amersham Pharmacia Biotech, Buckinghamshire, UK), hybridized with 32P‐labeled probes synthesized with random primers, and subjected to autoradiography after washing, as described previously.( 24 ) The DNA probes of EGFR, HER2 and β‐actin were prepared by PCR with primers set of 5′‐GGCACTGCTTTCCAGCATGG‐3′ and 5′‐CCTGAGGTCAGAGCCATGG‐3′ for EGFR, 5′‐GCCATGGCTGTGGTTTGTGATGG‐3′ and 5′‐ATCCTAGCCCCTTGTGGACATAGG‐3′ for HER2, and 5′‐CTGTGGCATCCACGAAACTA‐3′ and 5′‐AGGAAAGACACCCACCTTGA‐3′ for β‐actin.
Hybridized membranes were exposed to scientific imaging films (Eastman Kodak, Rochester, NY, USA) or BAS‐IP (Fuji Photo Film, Tokyo, Japan), which were analyzed using a BAS 2500 image analyzer (Fuji Photo Film) to quantify the intensity of signals. The samples with EGFR copies more than 3.5‐fold the normal lung DNA were defined as gene amplification positive.
Statistical analyses
The variables evaluated in the present study were investigated for association with mutation status of EGFR, HER2 and KRAS using Fisher's exact test or the χ2‐test. To identify which independent variables had a significant influence on EGFR mutation, a logistic regression model was used. P < 0.05 was regarded as statistically significant. All analyses were carried out using StatView version 5 software (SAS Institute, Cary, NC, USA).
Results
EGFR mutations in Japanese NSCLC
We previously reported that 17 tumors had EGFR mutations identified by direct sequencing of exons 18, 19 and 21 among 85 resected Japanese NSCLC.( 22 ) In the present study, we first carried out direct sequencing of exon 20 for the 85 tumors and detected another four tumors with mutations (Fig. 1). Taken together, we identified 21 tumors with EGFR mutations and further extended our analysis using another 264 tumors. We then identified 72 tumors with EGFR mutations in exons 18–21. In total, we found that 93 (27%) of 349 tumors had EGFR mutations by direct sequencing (Fig. 1).
Figure 1.
A schematic representation of mutation analysis of the epidermal growth factor receptor (EGFR) gene. We previously reported 17 tumors with EGFR mutation detected by direct sequencing of exons 18, 19 and 21 among 85 non‐small cell lung carcinomas (NSCLC; as indicated in parentheses), and further carried out direct sequencing of exon 20. Direct sequencing analysis of a further 264 NSCLC revealed 93 tumors with EGFR mutation among a total of 349 NSCLC. As the L858R mutation was then detected by mutation‐specific polymerase chain reaction (PCR) in another nine tumors, we identified a total of 102 tumors with EGFR mutations (95 tumors with a single mutation and seven tumors with double mutations of EGFR).
As some recent reports suggest that SSCP or mutation‐specific PCR analysis may be more sensitive than direct sequencing,( 18 ) we used mutation‐specific PCR to search for the mutation L858R in exon 21, which is one of the most frequent EGFR mutations, in 349 NSCLC. After confirming that all tumors with L858R detected by direct sequencing were positive for the mutation, we found another nine with the L858R mutation in 349 tumors. In total, we detected 102 (29%) EGFR‐mutated tumors (95 tumors with a single mutation and seven with double mutations) among 349 NSCLC, with the overall number of mutations being 109 (Fig. 1; Table 2). The mutations consisted of three different types: in‐frame deletions, single‐nucleotide substitutions, and in‐frame duplications or insertions. Forty‐four tumors had an in‐frame deletion at codons 746–750 in exon 19, with eight of these deletions being accompanied by a point mutation or insertion. Fifty‐three tumors had missense mutations in exons 18, 20 or 21, and the L858R mutation was the most common missense mutation. Five tumors had an in‐frame duplication or insertion of one or three amino acids at codons 769–776 in exon 20. None of the mutations were present in the corresponding normal lung tissue, indicating that these mutations were somatic. Single‐nucleotide polymorphisms were identified at 2361 (G/A) and 2457 (G/A) in exon 20 (data not shown).
Table 2.
One hundred and two tumors with epidermal growth factor receptor gene mutations among 349 non‐small cell lung carcinomas
| Mutation type | Exon | Nucleotide change | Amino acid change | n † |
|---|---|---|---|---|
| In‐frame deletion | 19 | del(2236–2250) | E746‐A750 del | 18 |
| 19 | del(2235–2249) | E746‐A750 del | 15 | |
| 19 | del(2240–2254) | L747‐T751 del | 3 | |
| 19 | del(2240–2257) | L747‐P753 del S ins | 3 | |
| 19 | del(2237–2251) | E746‐T751 del A ins | 2 | |
| 19 | del(2237–2254)2255C > T | E746‐S752 del V ins | 1 | |
| 19 | del(2239–2247)2248G > C | L747‐A750 del P ins | 1 | |
| 19 | del(2240–2257)2261A > C | L747‐K754 del ST ins | 1 | |
| Total | 44 | |||
| Single‐nucleotide substitution | 21 | 2573 T > G | L858R | 43 |
| 20 | 2303 G > T | S768I | 2 | |
| 18 + 21 | 2125 G > A + 2573 T > G | E709K + L858R | 1 | |
| 18 + 21 | 2126 A > G + 2573 T > G | E709G + L858R | 1 | |
| 18 + 21 | 2126 A > C + 2573 T > G | E709A + L858R | 1 | |
| 18 + 20 | 2155 G > A + 2303 G > T | G719S + S768I | 1 | |
| 18 + 20 | 2155 G > T + 2303 G > T | G719C + S768I | 1 | |
| 20 + 20 | 2303 G > T + 2305 G > T | S768I + V769L | 1 | |
| 20 + 20 | 2303 G > T + 2320 G > A | S768I + V774M | 1 | |
| 21 | 2582 T > G | L861Q | 1 | |
| Total | 53 | |||
| In‐frame duplication and/or insertion | 20 | 2304–2312 ins TGTGGCCAG | VAS 769–771 ins | 1 |
| 20 | 2308–2316 ins GACAACGTG | DNV 770–772 ins | 1 | |
| 20 | 2311–2319 ins GCACCGTGG | APW 771–773 ins | 1 | |
| 20 | 2314–2316 ins/dup AAC | N 772 ins | 1 | |
| 20 | 2320–2328 ins/dup AACCCCCAC | NPH 774–776 ins | 1 | |
| Total | 5 | |||
| Overall tumors | 102 | |||
| Overall mutations | 109 |
Includes 17 cases reported previously:( 22 ) one of G719S, six of del(2235–2249), three of del(2236–2250), one of del(2240–2254), one of del(2237–2254)2255C > T, and five of L858R. del, deletion; dup, duplication; ins, insertion.
Double mutations of EGFR on the same allele
To determine whether the double point mutations of EGFR, which were identified in the same sample, resulted from mutational events on the same allele or different alleles, we carried out cDNA cloning analysis. After extraction of total RNA from five samples available among the seven tumors that had double mutations, we carried out RT‐PCR and TA‐cloning using transformation into XL‐1 bacteria, picked up at least five to 10 subclones for each sample, and sequenced the inserts bidirectionally. To avoid unsolicited mismatch repairs of PCR heteroduplex products during transformation, we also used the XL‐1 mutS strain of bacteria. Collectively, over 30% clones were double‐mutation positive, whereas most of the rest were wild type, possibly from RNA of contaminated normal cells or from the remaining wild‐type allele (Table 3). Thus, the subcloning analyses revealed that all five tumors had mRNA containing both mutations, indicating that the mutations were localized in the same allele.
Table 3.
Analysis of five tumors with double mutations of the epidermal growth factor receptor gene
| Sample | 5′ mutation | 3′ mutation | No. colonies | Same allele | |
|---|---|---|---|---|---|
| Total | 5′ Mt/3′ Mt | ||||
| KD641 | G719S | S768I | 52 | 16 (31%) | Yes |
| KD826 | G719C | S768I | 40 | 38 (95%) | Yes |
| KD530 | S768I | V769L | 26 | 14 (54%) | Yes |
| KD514 | E709A | L858R | 28 | 14 (50%) | Yes |
| KD921 | E709G | L858R | 36 | 16 (44%) | Yes |
Mt, mutation.
Gene amplification of EGFR
We carried out Southern blotting analysis of 202 tumors and found that 11 (5.4%) tumors had amplification of the EGFR gene. Among them, amplification was found in eight (8%) of 96 patients with EGFR mutations and three (3%) of 106 patients without EGFR mutations. The characteristics of tumors with amplification of EGFR are summarized in Table 4. Because sequence analysis demonstrated that the mutation signals of these tumors were dominant, with five being completely lost for wild‐type signal, the amplification was suggested to have originated from the mutant allele (data not shown).
Table 4.
Clinicopathological features and mutation status of 11 non‐small cell lung carcinoma with epidermal growth factor receptor (EGFR) gene amplification
| Sample | Histology | Sex | Age (years) | Smoking (pack‐years) | P‐stage | EGFR amplification | EGFR mutation | HER2 mutation | KRAS mutation |
|---|---|---|---|---|---|---|---|---|---|
| KD190 | Ad | M | 63 | 45 | IIIA | + | – | – | – |
| KD215 | Ad | M | 71 | 8 | IA | + | NPH 774–776 ins | – | – |
| KD280 | Sq | M | 73 | 50 | IIIB | + | – | – | – |
| KD284 | Ad | M | 51 | 0 | IIIA | + | E746‐A750 del | – | – |
| KD377 | Sq | F | 77 | 57 | IIIA | + | – | – | – |
| KD534 | Ad | F | 70 | 0 | ND | + | L858R | – | – |
| KD564 | Ad | F | 75 | 0 | IA | + | APW 771–773 ins | – | – |
| KD566 | Ad | M | 72 | 0 | IB | + | E746‐A750 del | – | – |
| KD587 | Ad | F | 75 | 0 | IIIA | + | L747‐P753 del S ins | – | – |
| KD591 | Ad | M | 50 | 0 | IIIA | + | L858R | – | – |
| KD938 | Ad | M | 78 | 20 | IB | + | L858R | – | – |
Ad, adenocarcinoma; del, deletion; F, female; ins, insertion; M, male; ND, not determined; Sq, squamous cell carcinoma.
Alteration of HER2 and KRAS mutations
To determine whether alterations of other molecules involved in the EGFR signaling cascades may have accounted for the pathogenesis of NSCLC, we analyzed mutation and amplification of HER2 and mutation of KRAS. We found six (1.7%) mutations in exon 20 in the TK domain of HER2 among 349 NSCLC (Table 5). Four tumors had YVMA 776–779 insertion mutations and two had G776V C (cystein) insertions. The corresponding normal lung tissues did not have the same mutations as the tumors, indicating that these alterations were somatic. We carried out Southern blotting analysis of 202 tumors including five tumors with HER2 mutation and found amplification of HER2 in three tumors without HER2 mutation (data not shown). Meanwhile, KRAS mutations at codons 12 and 13 were present in 21 (6%) of the 349 NSCLC. There were no tumors that had two or more mutations simultaneously among the EGFR, HER2 and KRAS mutations.
Table 5.
Clinicopathological features of six tumors with HER2 mutations among 349 non‐small cell lung carcinomas
| Sample | Histology | Sex | Age (years) | Smoking (pack‐years) | P‐stage | Nucleotide change | Amino acid change |
|---|---|---|---|---|---|---|---|
| KD318 | Ad | F | 68 | 0 | IA | 2325–2336 ins ATACGTGATGGC | YVMA 776–779 ins |
| KD583 | Ad | F | 36 | 2 | IIIA | 2337–2339 ins TGT | G776V C ins |
| KD617 | Ad | M | 60 | 4 | IB | 2325–2336 ins ATACGTGATGGC | YVMA 776–779 ins |
| KD1007 | Ad | F | 54 | 0 | IA | 2325–2336 ins ATACGTGATGGC | YVMA 776–779 ins |
| KD1024 | Ad | F | 71 | 0 | IB | 2337–2339 ins TGG | G776V C ins |
| KD1027 | Ad | M | 67 | 45 | IIA | 2325–2336 ins ATACGTGATGGC | YVMA 776–779 ins |
Ad, adenocarcinoma; F, female; ins, insertion; M, male.
Relationship between clinicopathological features and genetic alterations
In univariate analysis of the correlation with clinicopathological features, EGFR mutations were significantly more frequent in women than in men (54 vs 15%; P < 0.0001), in patients with adenocarcinoma than in other histological subtypes (42 vs 1%; P < 0.0001), in never or light smokers (pack‐year < 20) than in heavy smokers (pack‐year 20) (54 vs 14%; P < 0.0001), and in patients with early stage (I or II) than in advanced stage (III or IV) (33 vs 21%; P = 0.024) (Table 6). HER2 mutations were more frequent in female never or light smokers, and in early stage patients with adenocarcinoma, but did not reach statistical significance except in those with a lower smoking history. KRAS mutations were more frequent in heavy smoking and early stage patients with adenocarcinoma. In multivariate analysis, EGFR mutations were found to be independently associated with women, a lower smoking history and adenocarcinoma histology (Table 7).
Table 6.
Univariate analysis of the relationship between clinicopathological features and epidermal growth factor receptor (EGFR), HER2 and KRAS gene mutations
| Variable | EGFR mutation | HER2 mutation | KRAS mutation | ||||||
|---|---|---|---|---|---|---|---|---|---|
| n | % | P‐value* | n | % | P‐value* | n | % | P‐value* | |
| Total (n = 349) | 102 | 29 | 6 | 1.7 | 21 | 6 | |||
| Sex | <0.0001 | NS (0.19) | NS (0.85) | ||||||
| Male (n = 226) | 35 | 15 | 2 | 0.9 | 14 | 6 | |||
| Female (n = 123) | 67 | 54 | 4 | 3.2 | 7 | 6 | |||
| Histology | <0.0001 | NS (0.18) | 0.0061 | ||||||
| Adenocarcinoma (n = 242) | 101 | 42 | 6 | 2.5 | 20 | 8 | |||
| Non‐adenocarcinoma (n = 107) | 1 | 1 | 0 | 0.0 | 1 | 1 | |||
| Smoking history † | <0.0001 | 0.037 | NS (0.14) | ||||||
| Never or light smoker ‡ (n = 131) | 71 | 54 | 5 | 3.8 | 4 | 3 | |||
| Heavy smoker (n = 201) | 29 | 14 | 1 | 0.5 | 15 | 7 | |||
| Undetermined (n = 17) | 2 | 12 | 0 | 0.0 | 2 | 12 | |||
| P‐stage † | 0.024 | NS (0.67) | NS (0.07) | ||||||
| I or II (n = 226) | 75 | 33 | 5 | 2.2 | 17 | 8 | |||
| III or IV (n = 97) | 20 | 21 | 1 | 1.0 | 2 | 2 | |||
| Undetermined (n = 26) | 7 | 27 | 0 | 0.0 | 2 | 8 | |||
Patients whose smoking history (n = 17) and P‐stage (n = 26) could not be determined were excluded from the analyses.
Pack‐years < 20.
*Fisher's exact test. NS, not significant.
Table 7.
Logistic regression analysis of the association † between epidermal growth factor receptor (EGFR) gene mutation and clinicopathological features
| Variable | Odds ratio | 95% CI | P‐value |
|---|---|---|---|
| Female | 2.68 | 1.34–5.39 | 0.0056 |
| Adenocarcinoma | 18.4 | 4.32–78.4 | <0.0001 |
| Smoking history | |||
| <20 pack‐years | 2.52 | 1.25–5.08 | 0.0098 |
| Undetermined | 3.5 | 0.58–21.3 | 0.17 |
| P‐stage | |||
| I or II | 1.81 | 0.92–3.56 | 0.088 |
| Undetermined | 1.07 | 0.33–3.46 | 0.91 |
Subjects without information on smoking and P‐stage were assigned dummy variables, and lack of information was adjusted in a model. CI, confidence interval.
Discussion
In the present report, we searched for mutations in the EGFR, HER2 and KRAS genes in primary NSCLC resected from Japanese patients. Among the 349 NSCLC tumors, we found 109 EGFR mutations in 102 tumors, with seven tumors harboring two missense mutations, six HER2 mutations in six tumors and 21 KRAS mutations in 21 tumors. Notably, all the double missense mutations of EGFR were in the same allele, and both mutation and amplification of EGFR were detected in eight tumors, indicating that two genetic events that target EGFR occasionally occur in NSCLC.
Previous studies showed that in‐frame deletional mutations in exon 19 and L858R mutation in exon 21 account for approximately 90% of EGFR mutations.( 12 , 13 , 14 , 15 , 16 , 17 , 18 ) Although the direct sequencing method is accurate and can pick up various kinds of mutation within target regions, it is an expensive and complicated examination tool. Moreover, it may yield a false‐negative result when the genomic DNA used is extracted directly from frozen tissues, which sometimes may be contaminated with a significant amount of genomic DNA from non‐malignant cells. In this regard, Marchetti et al. reported that SSCP analysis was more sensitive than direct sequencing, especially for missense mutations of EGFR.( 18 ) We used a mutation‐specific PCR method for detecting the L858R mutation and still found another nine mutations in 349 tumors. We also used SSCP analysis for the nine tumors with L858R mutation detected only by mutation‐specific PCR, as well as 94 tumors that included 20 EGFR‐mutated and 74 wild‐type tumors, and detected the L858R mutation in all but one of the nine tumors. Thus, there were several tumors with the L858R mutation that were detected only by mutation‐specific PCR or SSCP analyses, indicating that these two methods are more sensitive than the direct sequencing method and may be equally useful for the first‐step screening of L858R mutation.
We identified seven tumors harboring double missense mutations of EGFR that have been reported by other groups.( 15 , 16 , 26 ) However, no report thus far has analyzed how the double mutations occur and whether they are involved in NSCLC development. We analyzed these tumors with the cloning method and found that all of the tumors had mRNA with two mutations. This indicates that EGFR was mutated at two different positions in the same allele, although we could not determine whether the two mutations occur sequentially or at one time. However, it may well be that a second‐hit mutation of EGFR occurred in the same allele, which might give a greater growth advantage than a cancer cell with only a first‐hit mutation of EGFR. To determine this, an experiment should be conducted to show whether transfectants made using an expression construct with an EGFR double mutation can induce more active biological properties than with a single mutation.
Gene amplification of EGFR has also been shown to be a good predictor of EGFR inhibitor response.( 17 , 19 , 27 ) In the present study, the frequency of gene amplification was 5.4%, which seems to be consistent with previous reports using Southern blotting analysis,( 28 ) although other studies using FISH analysis have indicated more frequent amplification.( 17 , 29 ) Considering the contamination by genomic DNA from normal cells, FISH may be more sensitive than Southern blotting for detecting amplification, although reagents for detection and criteria of definition of amplification levels of EGFR vary among researchers, which seem to have caused confusion in the comparison of EGFR studies using FISH. Together with EGFR mutation status, we identified eight (8%) amplifications among 96 tumors with EGFR mutation and three (3%) among 106 without EGFR mutations. As sequence analysis demonstrated that the mutation signals of all of these eight tumors were dominant, of which five completely lost the wild‐type signal, it suggested strongly that the mutated allele was amplified selectively.
Overexpression and amplification of HER2 have been found frequently in several tumors such as breast cancer,( 30 , 31 ) and mutations of HER2 have also been reported in lung adenocarcinomas.( 20 , 21 ) In the present study, we found six (1.7%) in‐frame duplication or insertion mutations in 349 NSCLC and three (1.5%) amplifications of HER2 in 202 tumors. KRAS is a downstream molecule of EGFR/HER2 in the signaling cascades, and we found 21 (6%) mutations of KRAS among 349 tumors. In agreement with a previous report,( 21 ) there were no tumors with two or more simultaneous mutations among EGFR, HER2 and KRAS, suggesting that the mutations are mutually exclusive.
In the present study, EGFR mutations were significantly more frequent in women and in lighter smokers with adenocarcinoma by multivariate analysis. Although HER2 mutation and amplification were infrequent, at least one genetic alteration of EGFR or HER2 was found in 64 (68%) out of 94 tumors categorized as female, adenocarcinoma, and light smoking history. These results indicated that constitutive activation of the EGFR signaling cascades is a key event in the pathogenesis of this subset of lung cancer. Furthermore, we demonstrated that a double genetic event of EGFR, containing a possible second‐hit mutation or amplification, occasionally occurs on the same allele. Hence, we speculate that the second genetic event for EGFR might provide a greater growth advantage to one of the cancer cells with a single mutation. Taken together, our findings may provide new clues to understand the multistep activation mechanisms of EGFR that are involved in the pathogenesis of NSCLC and sensitivity and resistance to EGFR‐TKI.
Acknowledgments
This research was supported by a Grant‐in‐Aid for Scientific Research from the Japan Society for the Promotion of Science and a grant from the Aichi Cancer Research Foundation. We would like to thank Dr Koichi Fujita and Dr Norio Mukoyama for the surgical specimens, Dr Keitaro Matsuo, Division of Epidemiology and Prevention, Aichi Cancer Center Research Institute, for advice on statistical analyses and Ms Hiroko Kaga for her skillful technical support.
References
- 1. Statistics and Information Department. Labour and Welfare of Japan. Vital Statistics of Japan 2003. Tokyo: Health and Welfare Statistics Association, 2003. [Google Scholar]
- 2. Parkin DM. Global cancer statistics in the year 2000. Lancet Oncol 2001; 2: 533–43. [DOI] [PubMed] [Google Scholar]
- 3. Schiller JH, Harrington D, Belani CP et al. Comparison of four chemotherapy regimens for advanced non‐small‐cell lung cancer. N Engl J Med 2002; 346: 92–8. [DOI] [PubMed] [Google Scholar]
- 4. Sekido Y, Fong KM, Minna JD. Progress in understanding the molecular pathogenesis of human lung cancer. Biochim Biophys Acta 1998; 1378: 21–59. [DOI] [PubMed] [Google Scholar]
- 5. Sekido Y, Fong KM, Minna JD. Molecular genetics of lung cancer. Annu Rev Med 2003; 54: 73–87. [DOI] [PubMed] [Google Scholar]
- 6. Fong KM, Sekido Y, Gazdar AF, Minna JD. Lung cancer. 9: Molecular biology of lung cancer: clinical implications. Thorax 2003; 58: 892–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Rusch V, Baselga J, Cordon‐Cardo C et al. Differential expression of the epidermal growth factor receptor and its ligands in primary non‐small cell lung cancers and adjacent benign lung. Cancer Res 1993; 53: 2379–85. [PubMed] [Google Scholar]
- 8. Nicholson RI, Gee JM, Harper ME. EGFR and cancer prognosis. Eur J Cancer 2001; 37: S9–15. [DOI] [PubMed] [Google Scholar]
- 9. Wakeling AE, Guy SP, Woodburn JR et al. ZD1839 (Iressa): an orally active inhibitor of epidermal growth factor signaling with potential for cancer therapy. Cancer Res 2002; 62: 5749–54. [PubMed] [Google Scholar]
- 10. Fukuoka M, Yano S, Giaccone G et al. Multi‐institutional randomized phase II trial of gefitinib for previously treated patients with advanced non‐small‐cell lung cancer (The IDEAL 1 Trial). J Clin Oncol 2003; 21: 2237–46. [DOI] [PubMed] [Google Scholar]
- 11. Kris MG, Natale RB, Herbst RS et al. Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non‐small cell lung cancer: a randomized trial. JAMA 2003; 290: 2149–58. [DOI] [PubMed] [Google Scholar]
- 12. Lynch TJ, Bell DW, Sordella R et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non‐small‐cell lung cancer to gefitinib. N Engl J Med 2004; 350: 2129–39. [DOI] [PubMed] [Google Scholar]
- 13. Paez JG, Janne PA, Lee JC et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004; 304: 1497–500. [DOI] [PubMed] [Google Scholar]
- 14. Pao W, Miller V, Zakowski M et al. EGF receptor gene mutations are common in lung cancers from ‘never smokers’ and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci USA 2004; 101: 13 306–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Kosaka T, Yatabe Y, Endoh H, Kuwano H, Takahashi T, Mitsudomi T. Mutations of the epidermal growth factor receptor gene in lung cancer: biological and clinical implications. Cancer Res 2004; 64: 8919–23. [DOI] [PubMed] [Google Scholar]
- 16. Shigematsu H, Lin L, Takahashi T et al. Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst 2005; 97: 339–46. [DOI] [PubMed] [Google Scholar]
- 17. Cappuzzo F, Hirsch FR, Rossi E et al. Epidermal growth factor receptor gene and protein and gefitinib sensitivity in non‐small‐cell lung cancer. J Natl Cancer Inst 2005; 97: 643–55. [DOI] [PubMed] [Google Scholar]
- 18. Marchetti A, Martella C, Felicioni L et al. EGFR mutations in non‐small‐cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol 2005; 23: 857–65. [DOI] [PubMed] [Google Scholar]
- 19. Takano T, Ohe Y, Sakamoto H et al. Epidermal growth factor receptor gene mutations and increased copy numbers predict gefitinib sensitivity in patients with recurrent non‐small‐cell lung cancer. J Clin Oncol 2005; 23: 6829–37. [DOI] [PubMed] [Google Scholar]
- 20. Stephens P, Hunter C, Bignell G et al. Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature 2004; 431: 525–6. [DOI] [PubMed] [Google Scholar]
- 21. Shigematsu H, Takahashi T, Nomura M et al. Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res 2005; 65: 1642–6. [DOI] [PubMed] [Google Scholar]
- 22. Kondo M, Yokoyama T, Fukui T et al. Mutations of epidermal growth factor receptor of non‐small cell lung cancer were associated with sensitivity to gefitinib in recurrence after surgery. Lung Cancer 2005; 50: 385–91. [DOI] [PubMed] [Google Scholar]
- 23. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. [Google Scholar]
- 24. Uchiyama M, Usami N, Kondo M et al. Loss of heterozygosity of chromosome 12p does not correlate with KRAS mutation in non‐small cell lung cancer. Int J Cancer 2003; 107: 962–9. [DOI] [PubMed] [Google Scholar]
- 25. Mori S, Ito G, Usami N et al. p53 apoptotic pathway molecules are frequently and simultaneously altered in non‐small cell lung carcinoma. Cancer 2004; 100: 1673–82. [DOI] [PubMed] [Google Scholar]
- 26. Huang SF, Liu HP, Li LH et al. High frequency of epidermal growth factor receptor mutations with complex patterns in non‐small cell lung cancers related to gefitinib responsiveness in Taiwan. Clin Cancer Res 2004; 10: 8195–203. [DOI] [PubMed] [Google Scholar]
- 27. Hirsch FR, Varella‐Garcia M, McCoy J et al. Increased epidermal growth factor receptor gene copy number detected by fluorescence in situ hybridization associates with increased sensitivity to gefitinib in patients with bronchioloalveolar carcinoma subtypes: a Southwest Oncology Group Study. J Clin Oncol 2005; 23: 6838–45. [DOI] [PubMed] [Google Scholar]
- 28. Reissmann PT, Koga H, Figlin RA, Holmes EC, Slamon DJ. Amplification and overexpression of the cyclin D1 and epidermal growth factor receptor genes in non‐small‐cell lung cancer. Lung Cancer Study Group. J Cancer Res Clin Oncol 1999; 125: 61–70. [DOI] [PubMed] [Google Scholar]
- 29. Hirsch FR, Varella‐Garcia M, Bunn PA et al. Epidermal growth factor receptor in non‐small cell lung carcinomas: correlation between gene copy number and protein expression and impact on prognosis. J Clin Oncol 2003; 21: 3798–807. [DOI] [PubMed] [Google Scholar]
- 30. Pauletti G, Dandekar S, Rong H et al. Assessment of methods for tissue‐based detection of the HER‐2/neu alteration in human breast cancer: a direct comparison of fluorescence in situ hybridization and immunohistochemistry. J Clin Oncol 2000; 18: 3651–64. [DOI] [PubMed] [Google Scholar]
- 31. Cox G, Vyberg M, Melgaard B, Askaa J, Oster A, O’Byrne KJ. Herceptest: HER2 expression and gene amplification in non‐small cell lung cancer. Int J Cancer 2001; 92: 480–3. [DOI] [PubMed] [Google Scholar]