Effect of methotrexate treatment on expression levels of multidrug resistance protein 2, breast cancer resistance protein and organic anion transporters Oat1, Oat2 and Oat3 in rats

Abstract

The ATP binding cassette (ABC) transporters, multidrug resistance protein 2 (Mrp2; Abcc2) and breast cancer resistance protein (Bcrp; Abcg2), and organic anion transporters (Oats) mediate excretion of methotrexate (MTX) and many other drugs. However, it is not known whether MTX treatment leads to any changes in the expression of these transporters. We examined the effect of MTX treatment on expression of Mrp2, Bcrp and Oats in rats. MTX was single injected intraperitoneally at doses of 10, 50 and 150 mg/kg, and then Western blot analysis was performed. The levels of Mrp2, Oat1 and Oat2 on day 1 after the treatment showed no significant change. Four days after injection of 150 mg/kg MTX, the Mrp2 levels in the liver and ileum, but not in the kidney, were markedly down‐regulated to 20 ± 3.6% and 8.9 ± 3.8% (mean ± SEM) of controls, respectively. Renal Oat1 and Oat3 were also down‐regulated to 56.4 ± 4.3% (Oat1) and 54.3 ± 5.5% (Oat3) of controls. These effects of MTX were almost recovered by leucovorin which rescues normal cells from MTX toxicity. MTX treatment also decreased mRNA levels of constitutive androstane receptor (CAR) and pregnane X receptor (PXR) to 65.5 ± 17.9% and 59.6 ± 14.5% of controls in the liver, respectively. MTX treatment has no apparent effect on expression levels of Bcrp, cytochrome P450 2B6 and 3A1. In conclusion, these data indicate that MTX treatment down‐regulates expression levels of Mrp2, Oat1 and Oat3, and its effects are recovered by leucovorin. (Cancer Sci 2006; 97: 1260–1266)

Abbreviations:

ALP

alkaline phasphatase

ALT

alanine aminotransferase

AST

aspartate aminotransferase

Bcrp

breast cancer resistance protein

CAR

constitutive androstane receptor

CYP

cytochrome P450

FXR

farnesoid X receptor

GAPDH

glyceraldehyde‐3‐phosphate dehydrogenase

HDMTX

high‐dose methotrexate

LV

leucovorin

LPS

lipopolysaccharide

Mrp2

multidrug resistance protein 2

Oat

organic anion transporter

PXR

pregnane X receptor

RXR–α

retinoid X receptor α.

The folate antagonist methotrexate (MTX) is widely used in anticancer chemotherapy. High‐dose MTX (HDMTX) treatment with the folate derivative leucovorin (LV) has been used as a therapeutic strategy in oncology for more than 20 years. LV is administered after HDMTX treatment to rescue normal cells from the toxicity of MTX.^{( 1 )} Avoiding the occurrence of MTX toxicity is important for effective HDMTX chemotherapy. Delayed MTX clearance has been identified as one of the major factors responsible for MTX toxicity. Renal excretion is the primary route of MTX elimination.^{( 2 )} Recent studies have revealed that MTX is excreted by drug transporters, which are expressed in the kidney and many tissues.^{( 3} , ⁴ , ^{5 )}

Some membrane proteins mediating the ATP‐dependent transport of lipophilic substances and conjugates with glutathione, glucuronic acid, or sulfate have been identified as members of the multidrug resistance protein (Mrp) family. A Mrp isoform, Mrp2 has functions in the terminal excretion of cytotoxic and carcinogenic substances, and plays an important role in detoxification and chemoprevention.^{( 6 )} An ATP binding cassette transporter, breast cancer resistance protein (Bcrp, Abcg2) also plays an important role in the transport of cytotoxic and carcinogenic substances. It has been demonstrated that Mrp2 and Bcrp excretes MTX.^{( 5} , ^{7 )} Mrp2 is important clinically as it modulates the pharmacokinetics of many drugs, and its expression and activity are also altered by certain drugs and disease states.^{( 8 )} Alterations in Mrp2 expression and/or function could have a variety of clinically important effects. First, decreased Mrp2 function can impair normal hepatic function including the capacity to excrete endogenous compounds. Next, altered Mrp2 function can change the clearance of many clinically important drugs, including cancer chemotherapeutics (methotrexate, irinotecan and vinblastine), antibiotics (ampicillin, ceftriaxone, and rifampin), antihyperlipidemics, and angiotesin‐converting enzyme inhibitor, as well as many toxins and their conjugates.^{( 8 )} Recent studies have revealed a certain mechanism for the regulation of Mrp2 gene expression. Constitutive androstane receptor (CAR), pregnane X receptor (PXR), farnesoid X receptor (FXR) and retinoid X receptor (RXR‐) act as a transcription factor of Mrp2 gene expression. Mrp2 is activated through binding of heterodimers of those nuclear receptors.^{( 9} , ¹⁰ , ¹¹ , ^{12 )}

The organic anion transporter (Oat) family also plays important roles in the elimination of a variety of endogenous substances, xenobiotics and their metabolites from the body. Oats are membrane proteins with 12 putative membrane‐spanning domains and function as sodium‐independent exchangers or facilitators.^{( 13 )} So far, six Oat isoforms (Oat1, Oat2, Oat3, Oat4, Oat5 and Oat6) have been identified in mammals.^{( 14} , ¹⁵ , ^{16 )} It has been reported that MTX is transported by Oat1, Oat2 and Oat3.^{( 17} , ¹⁸ , ^{19 )}

There is accumulated evidence that medical drugs and health care supplements affect the expression levels of Mrp2.^{( 20} , ²¹ , ²² , ^{23 )} However, there is little evidence about the inducing properties of Oats expression – only that endotoxin lipopolysaccharide decreased Oat3 in rats.^{( 24 )} It is not clear yet whether MTX treatment affects the expression level of these transporters. We examined the effect of MTX treatment on expression levels of Mrp2, Bcrp, Oat1, Oat2 and Oat3 in rats. We also examined the effect of LV rescue after MTX injection on the levels of these expressions. Furthermore, the effect of MTX treatment on the expression levels of the nuclear receptors, drug‐metabolizing enzymes cytochrome P450 (CYP) 2B6 and 3A1 was investigated.

Materials and Methods

Reagents.  A mouse monoclonal antibody was used to test against the following proteins: multidrug resistance‐related protein cMOAT/MRP2 (M₂III‐6) (SANBIO, AM Uden, the Netherlands); antibreast cancer resistance protein Bcrp (bxp‐21) (Kamiya Biomedical, Seattle, WA, USA); and antiglyceraldehyde‐3‐phosphate dehydrogenase GAPDH (6C5) (Ambion Japan, Tokyo, Japan). Rabbit polyclonal antibodies for organic anion transporters and cytochrome P450s (2B6 and 3A1) were purchased from Trans Genic (Kumamoto, Japan) and BIOMOL (Butler pike, PA, USA). Goat antimouse and antirabbit IgG antibody conjugated with horseradish peroxidase (HRP) as a second antibody was purchased from Santa Cruz Biotechnology (San Francisco, CA, USA). Nitrocellulose membranes, ECL Western Blotting detection system and Hyperfilm ECL were purchased from Amersham Pharmacia Biotech (Buckinghamshire, UK). Protease inhibitor cocktail tablets (Complete^®, EDTA free) were purchased from Roche diagnostics GmbH (Basel, Switzerland). Leucovorin^® (calcium leucovorin, LV) was purchased from Wyeth Japan Ltd (Tokyo, Japan). Lipopolysaccharide from Salmonella typhimurium (LPS) was purchased from Sigma (St. Louis, MO, USA). TaKaRa RT‐PCR kit AMV Ver. 3 and RNAlater ^TM were purchased from TaKaRa biomedicals (Otsu, Japan). TRIzol^® Reagent was purchased from Invitrogen (Carlsbad, CA, USA). All other reagents were purchased from Wako Pure Chemical Industries (Osaka, Japan).

Animals and treatment.  Male Wistar rats (body weight; 216 ± 2 g, mean ± SEM, Kyudo, Japan) were housed under standard conditions (21 ± 2°C, ventilated rooms, 12 h light/dark cycle). The animals were fed rat chow and allowed free access to water over the experimental period. Sodium bicarbonate (NaHCO₃) was dissolved in distilled water before use (pH 8.0). MTX was dissolved in 0.3 M NaHCO₃ (25 mg/mL, pH 8.0). Rats were treated as follows: vehicle group, single injection with 0.3 M NaHCO₃ (i.p., 6 mL/kg); MTX treated groups, single injection with MTX solution at doses of 10, 50 and 150 mg/kg (i.p); LV group, single injection with 0.3 M NaHCO₃ (i.p., 6 mL/kg) and five LV (i.p., 5 mg/kg) injections after the 0.3 M NaHCO₃ injection on 0, 8, 16, 24 and 48 h; MTX + LV group, single injection with MTX solution (i.p., 150 mg/kg) and five LV (i.p., 5 mg/kg) injections after the MTX injection on 0, 8, 16, 24 and 48 h. The doses of MTX and LV referred to our preliminary experiment. As a positive control, three rats were treated with intraperitoneal injection of lipopolysaccharide (LPS, 4 mg/kg) diluted in saline once daily for three consecutive days.^{( 22 )} At each experimental time point, rats were anesthetized with diethyl ether, and collection of whole blood from the heart was performed. The rats were killed by exsanguinations after the blood collection. Target tissues were promptly removed and stored at −30°C until Western blot analysis. To analyze mRNA levels, the rat tissues were stored in RNA stabilization solution, RNAlater ^TM, at −30°C until RT‐PCR. The serum prepared from each rat was stored at 4°C until analysis. The hemolysate samples were excluded from samples for analysis. Animal experiments were performed in accordance with the criteria of Kagoshima University for the use and care of experimental animals.

Assay and data analysis.  The biochemical parameters were determined by a clinical chemistry analyzer, TBA‐80FR NEO (Toshiba Medical Systems, Tokyo, Japan). Bilirubin concentration in serum was determined with bilirubin BII test Wako (Wako pure chemical, Osaka, Japan). MTX concentrations in the serum were determined by the fluorescence polarization immunoassay (Abbott Japan, Tokyo, Japan). Protein concentration was determined by DC protein assay (Bio‐Rad Japan, Tokyo, Japan). Optical densities (ODs) were measured by the public domain program NIH Image 1.60 (developed by the US National Institutes of Health and available on the Internet at http://rsb.info.nih.gov/nih‐image/) on a Macintosh computer (Power Macintosh 7100/66AV). Individual exposures were scanned into TIFF images with a GT9000 color scanner (Seiko Epson, Tokyo, Japan). Overall differences among treatments were evaluated by one‐way analysis of variance (ANOVA), with differences between individual treatments and groups evaluated using the Tukey‐Kramer post hoc test. Statistical analyzes for paired two samples were performed by two‐tailed Student's t‐test.

Isolation of tissue crude plasma membranes.  Crude plasma membranes were prepared from rat kidney, liver and ileum. Tissues obtained from individual animals of each group were cryopreserved and homogenized in a buffer containing 250 mM sucrose and 5 mM N‐2‐hydroxyethylpiperazine‐N′‐2‐ethanesulfonic acid (HEPES)‐tris(hydroxymethyl)‐aminomethane (Tris, pH 7.4) with an ultrasonic homogenizer. The whole cell homogenates were centrifuged at 3000g for 10 min. The supernatants were then centrifuged at 13 500g for 30 min, and the pellets containing the crude plasma membranes were resuspended in 10 mM Tris‐HCl, pH 7.4, including 250 mM sucrose.^{( 25 )} Protease inhibitor tablets were dissolved in the above‐mentioned homogenizing buffer at appropriate concentrations.

Detection of Mrp2, Bcrp, Oat1, Oat2 and Oat3.  Protein samples were mixed with an equal volume of sodium dodecyl sulfate (SDS) sample buffer containing 125 mM Tris‐HCl (pH 6.8), 4% SDS, 20% glycerol and 0.005% bromophenol blue. Electrophoresis on SDS polyacrylamide gels (SDS‐PAGE) was performed according to the method of Laemmli without sample heat treatment. Protein samples for Mrp2 detection (Liver, 20 µg of whole cell homogenate; kidney and ileum, 20 µg of crude plasma membranes) were separated by 7.5% SDS‐PAGE. Protein samples for Bcrp, glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), CYP2B6 and 3A1 detection (Bcrp liver, 20 µg of whole cell homogenate; Bcrp ileum, 20 µg of crude plasma membranes; GAPDH, CYP3A1 liver, 10 µg of whole cell homogenate; CYP2B6, 50 µg of whole cell homogenate) were separated by 12% SDS‐PAGE. SDS‐PAGE (10%) for Oat1, Oat2 and Oat3 were performed using 50 µg of crude plasma membranes protein. After SDS‐PAGE separation, proteins were transferred to a nitrocellulose membrane. After transfer, the membranes were incubated with 3% skim milk in buffer A (0.35 M NaCl, 10 mM Tris‐HCl, pH 8.0, 0.05% Tween 20) for 1 h at room temperature for blocking. The membranes were then incubated with antibody M₂III‐6 (400‐fold dilution), bxp‐21 (500‐fold dilution), 6C5 (100 000‐fold dilution), anti‐Oat1, 2 and 3 (250‐fold dilution), anti‐CYP2B6 (1000‐fold dilution), anti‐CYP3A1 (3000‐fold dilution) in a same condition of blocking. After washing three times with buffer A, the membranes were further incubated with 1000‐fold diluted secondary antibody conjugated with HRP. Finally, membranes were rinsed once for 15 min and four more times for 5 min with buffer A. For the detection, the ECL Western blotting detection system was used.

RNA isolation and reverse‐transcriptase‐PCR.  Total RNAs were isolated from tissues using TRIzol Reagent according to the manufacturer's instructions. Single‐stranded cDNA was synthesized by reverse‐transcriptase (RT) using TaKaRa RNA PCR kit (AMV) ver. 3.0. The RT was performed for 10 min at 30°C and for 30 min at 42°C, and the samples were subsequently heated for 5 min at 95°C to terminate the RT reaction. The next PCR was performed by using a PC‐801 machine (ASTEC, Fukuoka, Japan). Briefly, the synthesized cDNAs were incubated at 95°C for 5 min to denature the primers and cDNA, and next PCR was performed by the following cycling program. The reaction was repeated for 22–34 cycles depending on the samples for 30 s denaturing at 94°C, 30 s of annealing at 55°C and 90 s of primer extension at 72°C. This was determined to be halfway through the exponentially amplifying phase (Fig. 5). The annealing temperature and PCR cycling numbers were dependent on which target gene was amplifying. For example, 55°C annealing temperature and 22 cycles for GAPDH (glyceraldehyde‐3‐phosphate dehydrogenase); 55°C and 34 cycles for Mrp2 in kidney and ileum, Bcrp in liver; 55°C and 30 cycles for Mrp2 in liver; 55°C and 37 cycles for Bcrp in ileum; 59°C and 34 cycles for PXR; 59°C and 34 cycles for FXR; 60°C and 37 cycles for RXR‐α. The sequence of sense and reverse primers and amplified target genes information are listed in Table 1. The primers are described in the literature: GAPDH;^{( 26 )} Mrp2;^{( 27 )} CAR;^{( 28 )} PXR, FXR and RXR‐.^{( 29 )} For every PCR reaction, GAPDH as an internal control and sterile water as negative control were used. Ten micro litres of PCR product was loaded on a 2% agarose gel and stained with ethidium bromide to visualize the amount of the amplified gene.

Figure 5.

Reverse‐transcription polymerase chain reaction (RT‐PCR) analysis for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), Mrp2, Bcrp, CAR, PXR, RXR‐α and FXR mRNA expressions of methotrexate (MTX) treatment. RT‐PCR was performed as described in Materials and Methods with specific paired primers for respective GAPDH, Mrp2, Bcrp, CAR, PXR, RXR‐α and FXR genes with appropriate annealing temperature and numbers of cycles. During three cycles for each target gene, amplification was exponential. To determine the effect of MTX, rats were killed after 16 h after an i.p. injection of MTX at a dose of 150 mg/kg.

Table 1.

Several information of target genes and specific primers for polymerase chain reaction

Gene	Forward primer (5′‐3′)	Reverse primer (5′‐3′)	Product size (bp)	Accession number
Gapdh	CCATCACCATCTTCCAGGAG	CCTGCTTCACCACCTTCTTG	576	M17701
Mrp2	ACCTTCCACGTAGTGATCCT	GATTTCCCAGAGCCTACAGT	1084	NM_012833
Bcrp	CAATGGGATCATGAAACCTG	GAGGCTGGTGAATGGAGAA	536	AB105817
CAR	CAGCCTGCAGGTTGCAGAAG	TTCCACAGCCGCTCCCTTGA	410	NM_022941
PXR	CCATGTTGGCCTTGTACA	TCACTGTGAAACACCGCA	509	NM_052980
FXR	GACAAAGAAGCCGCGAAT	GTGGTCCAGTGTCTGAAA	618	U18374
RXR‐α	TTTCCTGCCGCTCGACTT	GGTCTTTGCGTACTGTCC	500	NM_012805

Results

Effect of MTX treatment on Mrp2, Bcrp, Oat1, Oat2 and Oat3 expressions.  A typical Western blot analysis is shown in 1, 2. Mrp2, Bcrp and Oat2 proteins in the liver were detected as 190‐kDa, 70‐kDa and 60‐kDa bands, respectively. Oat1 and Oat3 in the kidney were also detected as 77‐kDa and 130‐kDa bands (Fig. 2). Treatment with LPS (4 mg/kg per day, single i.p. injection for three consecutive days) markedly down‐regulated the expression levels of Mrp2 in the liver (Fig. 1) as was previously described.^{( 22 )} The Mrp2, Bcrp, Oat1, Oat2 and Oat3 expression levels were described as a percentage of the corresponding vehicle treated group (1, 2). There was no significant difference in the transporter expressions on day 1 between MTX and vehicle treatments. Four days after the treatment, the effect of MTX was observed in a dose‐dependent manner in the liver. For example, after single injection of 150 mg/kg MTX, the Mrp2 levels in the liver and ileum, but not the kidney, were markedly down‐regulated to 20 ± 3.6% and 8.9 ± 3.8% (mean ± SEM) of controls, respectively. Renal Oat1 and Oat3 were also down‐regulated to 56.4 ± 4.3% (Oat1) and 51.2 ± 5.9% (Oat3) of controls. However, no significant changes on the expression level of Mrp2 in the kidney, Bcrp in the liver and ileum or Oat2 in the kidney and liver were observed in the same condition. MTX treatment had no apparent effect on expression levels of GAPDH in the liver.

Figure 1.

Effect of methotrexate (MTX) treatment on expression levels of Mrp2, Bcrp and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH). Rats were single intraperitoneally injected with 0.3 M sodium bicarbonate solution (vehicle) as a control, or MTX. Lipopolysaccharide (LPS) was used (4 mg/kg per day, for three consecutive days) as a positive control for down‐regulation of Mrp2. (a) Protein samples: vehicle, day 1, (1); vehicle, day 4, (2); MTX 10 mg/kg, day 1, (3); MTX 10 mg/kg, day 4, (4); MTX 50 mg/kg, day 1, (5); MTX 50 mg/kg, day 4, (6); MTX 150 mg/kg, day 1, (7); MTX 150 mg/kg, day 4, (8); and LPS 4 mg/kg (9). Mrp2, Bcrp and GAPDH were detected as 190 kDa, 70 kDa and 37 kDa proteins, respectively. Whole cell homogenate was prepared and loaded onto SDS‐PAGE for hepatic Mrp2, Bcrp and GAPDH, crude plasma membranes preparation was used for detection in the kidney and ileum. The detailed procedure for western blot analysis is described in Materials and Methods. (b) The relative expression levels of Bcrp in the liver and ileum after single injection with MTX. Rats were killed 4 days after MTX treatment. Values represent mean ± SEM (percentage) of normalized ODs, compared with vehicles, n = 6, Asterisk indicates significance from vehicle group (**P < 0.01). Vehicle group was treated 0.3 M sodium bicarbonate (6 mL/kg, i.p) only. (c) The relative expression levels of Mrp2 in the liver, ileum and kidney after single injection with MTX. Rats were killed four days after MTX treatment. Values represent mean ± SEM (percentage) of normalized ODs, compared with vehicles, n = 4–6, Asterisk indicates significance from vehicle group (**P < 0.01). Vehicle group was treated 0.3 M sodium bicarbonate (6 mL/kg, i.p.) only.

Figure 2.

Effect of methotrexate (MTX) treatment on expression levels of Oats. Rats were single intraperitoneally injected with 0.3 M sodium bicarbonate solution (vehicle) as a control, or MTX. (a) Protein samples: vehicle, day 1,(1); vehicle, day 4, (2); MTX 10 mg/kg, day 1, (3); MTX 10 mg/kg, day 4, (4); MTX 50 mg/kg, day 1,(5); MTX 50 mg/kg, day 4, (6); MTX 150 mg/kg, day 1, (7); MTX 150 mg/kg and day 4, (8); Oat1, Oat2 and Oat3 were detected as 77 kDa, 60 kDa and 130 kDa proteins, respectively. Crude plasma membranes preparation was used for detection of Oats. The images for Oat2 correspond to liver and that Oat1 and Oat3 correspond to kidney. The detailed procedure for western blot analysis is described in Materials and Methods. (b) The relative expression levels of Oats in the liver and kidney after single injection with MTX. Rats were killed 4 days after MTX treatment. Values represent mean ± SEM (percentage) of normalized ODs, compared with vehicles, n = 4–6, Asterisk indicates significance from vehicle group (*P < 0.05). Vehicle group was treated 0.3 M sodium bicarbonate (6 mL/kg, i.p.) only.

Effect of LV rescue on down‐regulation of Mrp2, Oat1 and Oat3. 3, 4 show the effect of LV rescue on the down‐regulation of several transporters’ expressions by MTX treatment (150 mg/kg). LV (5 mg/kg) was multiinjected intraperitoneally at the time points of 0, 8, 16, 24 and 48 h after MTX (MTX + LV group) or 0.3 M sodium bicarbonate (LV group) injection. The expression levels of Mrp2 (Fig. 3), Oat1 and Oat3 (Fig. 4) are expressed as a percentage of the corresponding vehicle group. Mrp2 and Oat3 expression on day 4 after MTX treatment were significantly decreased compared with vehicle or LV only treated group. The decreased Mrp2, Oat1 and Oat3 expression levels on day 4 after MTX injection were mostly rescued by LV treatment (3, 4).

Figure 3.

Reversal effect of leucovorin on suppression of Mrp2 expression in the liver and ileum four days after methotrexate (MTX) treatment. Vehicle group was treated with 0.3 M sodium bicarbonate (6 mL/kg, i.p. only). Leucovorin (LV; 5 mg/kg, i.p.) was injected 0, 8, 16, 24 and 48 h after the MTX (150 mg/kg, i.p.) or vehicle treatment. Rats were killed 4 days after treatment and preparation of samples for western blot analysis was similar to that described in Fig. 1. Bars represent mean values ± SEM (percentage) of normalized ODs, n = 6. Asterisk indicates significance from vehicle group (**P < 0.01; *P < 0.05).

Figure 4.

Reversal effect of leucovorin on Oat1 and Oat3 expressions in the kidney four days after methotrexate (MTX) treatment. Vehicle group was treated with 0.3 M sodium bicarbonate (6 mL/kg, i.p. only). Leucovorin (LV; 5 mg/kg, i.p.) was injected 0, 8, 16, 24 and 48 h after the MTX (150 mg/kg, i.p) or vehicle treatment. Rats were killed 4 days after treatment and preparation of samples for western blot analysis was similar to that described in Fig. 1. Bars represent mean values ± SEM (percentage) of normalized ODs, n = 6, Asterisk indicates significance from vehicle, LV and MTX + LV group (**P < 0.01; *P < 0.05).

Effects of MTX treatment on the biochemical parameters of serum.  The biochemical parameters of serum: aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), total protein, albumin, creatinine, total bilirubin and direct reacting bilirubin were measured to estimate general liver and kidney function. The parameters on day 1 after MTX treatment showed no significant change as compared with the vehicle group. The serum concentrations of MTX one day after i.p. single injection of either 50 mg/kg or 150 mg/kg were 0.05 ± 0.01 µmol/L and 0.03 ± 0.01 µmol/L (mean ± SEM), respectively. At a dose of 10 mg/kg MTX, the serum concentrations of MTX were undetectable (<0.02 µmol/L). At day 4 after MTX treatment, the high dose MTX (150 mg/kg, i.p) treatment significantly decreased ALT, ALP, total protein, albumin values and body weight (Table 2). MTX administration produced anorexia and diarrhea, so that the rats lost body weight. These decreases were recovered by LV treatment (Table 3). The serum concentrations for all dosages of MTX were not detectable on day 4.

Table 2.

Biochemical parameters of serum and body weight on day 4 after methotrexate (single injection, i.p) treatment in rats

Day 4	Vehicle	MTX (mg/kg)
		10	50	150
AST (IU/L)	145.0 ± 48.0	204.5 ± 39.5	137.3 ± 6.2	169.6 ± 21.4
ALT (IU/L)	49.7 ± 3.8	53.0 ± 2.5	35.3 ± 3.3	24.3 ± 1.8*
ALP (IU/L)	1902 ± 337	1454 ± 92	1153 ± 166	365 ± 93*
Total protein (g/dL)	5.81 ± 0.07	5.73 ± 0.09	5.33 ± 0.21	5.08 ± 0.14**
Albumin (g/dL)	2.50 ± 0.00	2.40 ± 0.00	2.25 ± 0.05	2.18 ± 0.06**
Creatinine (mg/dL)	0.20 ± 0.00	0.20 ± 0.00	0.15 ± 0.03	0.20 ± 0.00
Total bilirubin (mg/dL)	0.33 ± 0.05	0.15 ± 0.02	0.20 ± 0.04	0.43 ± 0.15
Direct reacting bilirubin (mg/dL)	0.21 ± 0.04	0.12 ± 0.02	0.18 ± 0.03	0.33 ± 0.15
Body weight (g)	216.9 ± 3.1	222.3 ± 2.7	217.5 ± 5.0	180.6 ± 4.8*

The biochemical parameters were determined with a clinical chemistry analyzer. ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase. Vehicle group was injected once with 0.3 M sodium bicarbonate only (6 mL/kg, i.p). Data represent mean ± SEM (n = 3–6). Asterisk indicates significance from vehicle group (*P < 0.01; **P < 0.05).

Table 3.

The biochemical parameters of serum and body weight on day 4 after the treatments of methotrexate (MTX) (150 mg/kg, i.p) alone, leucovorin (LV) alone and MTX plus LV in rats

	Vehicle	LV	MTX	MTX + LV
AST (IU/L)	148.3 ± 6.7	136.8 ± 5.9	149.3 ± 23.6	123.0 ± 5.5
ALT (IU/L)	45.5 ± 3.9	42.8 ± 2.7	25.7 ± 6.2[Link], [Link], [Link]	41.2 ± 2.1
ALP (IU/L)	1648 ± 205	1657 ± 155	700 ± 432	1755 ± 237
Total protein (g/dL)	5.81 ± 0.07	5.73 ± 0.09	5.20 ± 0.21[Link], [Link], [Link]	5.70 ± 0.05
Albumin (g/dL)	2.50 ± 0.00	2.40 ± 0.00	2.25 ± 0.05[Link], [Link], [Link]	2.46 ± 0.04
Creatinine (mg/dL)	0.20 ± 0.00	0.20 ± 0.00	0.15 ± 0.03	0.20 ± 0.00
Body weight (g)	216.9 ± 3.1	215.6 ± 5.8	179.3 ± 3.5[Link], [Link], [Link]	215.3 ± 4.8

The biochemical parameters were determined with a clinical chemistry analyzer. ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase. Vehicle group was single injected 0.3 M sodium bicarbonate (6 mL/kg, i.p). LV group was multi‐injected LV (5 mg/kg, i.p) 0, 8, 16, 24 and 48 h after the 0.3 M sodium bicarbonate single injection. MTX + LV group was multi‐injected LV (5 mg/kg, i.p) 0, 8, 16, 24 and 48 h after the MTX single injection. Data represent mean values ± SEM (n = 3–5). Significant differences were observed in the group: compared with vehicle, *P < 0.01, **P < 0.05; compared with LV, ^† P < 0.01, ^†† P < 0.05; compared with MTX + LV, ^‡ P < 0.01, ^‡‡ P < 0.05.

Effects of MTX treatment on mRNA expression of Mrp2, Bcrp, CAR, PXR, RXR‐α and FXR.  Expression levels of Mrp2, Bcrp, CAR, PXR, RXR‐α and FXR mRNA were investigated to reveal the mechanism of Mrp2 down‐regulation with MTX treatment. Semi‐quantitative RT‐PCR was performed with specific primers for gapgh, Mrp2, Bcrp, CAR, PXR, RXR‐α and FXR to analyze the expression levels of each gene in liver, ileum and kidney (Table 1). The PCR condition for each gene was described in ‘Materials and Methods’. Cherrington et al. reported that the expression of Mrp2 mRNA was down‐regulated at 16 h after LPS treatment.^{( 24 )} In the case of MTX, expression levels of Mrp2, CAR and PXR in the liver after 16 h of treatment were significantly down‐regulated to 21.2 ± 6.3%, 65.5 ± 17.9% and 59.6 ± 14.5% of controls, respectively. The expression levels of Mrp2 and CAR in the ileum were also significantly decreased to 37.1 ± 11.0% and 33.2 ± 5.0% of controls, respectively. The expression of Mrp2, CAR and PXR in the kidney, Bcrp, RXR‐α and FXR in all examined tissues were showed no significant difference (Fig. 6).

Figure 6.

The relative expression levels of Mrp2, Bcrp and nuclear receptors mRNAs in the liver, ileum and kidney after single injection with methotrexate (MTX). Rats were killed 16 h after MTX treatment. Values represent relative ratio of target gene per glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) mean ± SEM (percentage) of normalized ODs, compared to vehicles calculated from 5–6 independent experiments. Asterisk indicates significance from vehicle group (**P < 0.01; *P < 0.05). Vehicle group was treated with 0.3 M sodium bicarbonate (6 mL/kg, i.p.) only as a control.

Effects of MTX treatment on expression of CYP2B6, CYP3A1 and GAPDH.  To elucidate the reduced expression of the nuclear receptors to the reduced expression of Mrp2, expression levels of cytochrome P450 (CYP) 2B6 and 3A1 was evaluated. CYP2B6 and CYP3A1 are under the control of CAR and PXR, respectively.^{( 30 )} A typical Western blot analysis is shown in Fig. 7. CYP2B6, CYP3A1 and GAPDH proteins in the liver were detected as 56‐kDa, 58‐kDa and 37‐kDa bands, respectively. MTX treatment (day 4, 150 mg/kg) have no apparent effect on expression levels of CYP2B6, CYP3A1 and GAPDH.

Figure 7.

CYP2B6, CYP3A1 and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) expressions in the liver 4 days after methotrexate (MTX) treatment. Vehicle group was treated with 0.3 M sodium bicarbonate (6 mL/kg, i.p. only). MTX was injected intraperitoneally at a dose of 150 mg/kg. Rats were killed 4 days after treatment. Whole cell homogenate (CYP3A1 and GAPDH: 10 µg protein, CYP2B6: 50 µg protein) was prepared and loaded onto SDS‐PAGE.

Discussion

We analyzed the effects of MTX treatment on Mrp2, Bcrp, Oat1, Oat2 and Oat3 expressions in vivo in rats. In this study, rats received a single dose of MTX. In clinical HDMTX chemotherapy, MTX is administered by intravenous infusion. It is demonstrated that the typical human dose of HDMTX is 12 g/m² (MTX dose per body surface area).^{( 2 )} When body weight and height are 65 kg and 170 cm, respectively, the dose corresponds about 300 mg/kg. Additionally, regimens of HDMTX have been reported. It has been reported that the doses of commonly used HDMTX regimens were 1–33.6 g/m², which correspond to 26–880 mg/kg.^{( 1 )}

Methotrexate treatment reduced the expression levels of Mrp2 in the liver and ileum at 4 days after the treatments. MTX treatment had no apparent effect on renal Mrp2 expression, but MTX treatment markedly decreased Mrp2 expression in the liver and ileum (Fig. 1). In a Mrp2 deficient Eisai hyperbilirubinemic rat, decreased MTX clearance has been reported.^{( 31} , ^{32 )} The present study findings suggest that MTX could affect elimination and absorption of Mrp2 substrates from the liver and ileum.

Multidrug resistance protein 2 is expressed strongly in the liver and weakly in the kidney. Mrp2 is localized in the apical membrane.^{( 8 )} Mrp2 expression in response to carcinogens, anticancer drugs and other xenobiotics has been studied. It has been reported that drugs used for medical purposes induce Mrp2 expression in vitro. ^{( 20} , ²¹ , ²² , ^{23 )} Kubitz et al. reported that the bacterial endotoxin lipopolysaccharide (LPS) induces cholestasis due to early retrieval of Mrp2 from the canalicular membrane, whereas down‐regulation of mRNA expression of Mrp2 is a later event.^{( 22 )} In fact, LPS treatment (4 mg/kg per day, three days, i.p) down‐regulated the expression levels of hepatic Mrp2 (Fig. 1).

Recent studies have revealed the molecular mechanism of Mrp2 expression. Some reports indicate that there are nuclear receptors (constitutive androstane receptor: CAR, pregnane X receptor: PXR, farnesoid X‐activated receptor: FXR, retinoid X receptor: RXR‐) binding sites in the Mrp2 promoter region.^{( 9} , ¹⁰ , ¹¹ , ^{12 )} MTX treatment down‐regulated expression levels of Mrp2 mRNA (Fig. 6), suggesting that MTX induced reduction Mrp2 protein in liver and ileum, but not kidney, was due to down‐regulation of the Mrp2 mRNA levels. MTX treatment also down‐regulated expression levels of CAR and PXR mRNAs (Fig. 6). We examined expression levels of CYP2B6 and CYP3A1, which are under regulation of CAR and PXR, respectively. MTX treatment had no apparent effect on CYP2B6 and CYP3A1 (Fig. 7). Both or either alternations of CAR and/or PXR mRNA expressions treated with MTX can decrease transcription of the Mrp2 gene. However, it is not clear how MTX treatment down‐regulates Mrp2 expression.

Oat1 is expressed predominantly in the kidney and very weakly in the brain (Sekine et al. 2000). In contrast, Oat2 is expressed predominantly in the liver and very weakly in the kidney in male rats.^{( 13 )} On the other hand, Oat2 is expressed in the kidney in female rats.^{( 33 )} Oat3 is expressed in the liver, kidney and brain.^{( 34 )} Oats are localized in the basolateral membrane except for hepatic Oat2.^{( 13 )} To date, few studies have addressed down‐regulation of the Oat family. It was reported that LPS down‐regulated the expression level of Oat2 and Oat3 mRNA.^{( 24} , ^{35 )} Hydrogen peroxide, which is a source of reactive oxidant species, down‐regulates Oat1 and Oat3 functions.^{( 36 )} To our knowledge this is the first report describing changes in Oats protein levels by a therapeutic drug. This study shows that four days after MTX administration the levels of renal Oat1 and renal and hepatic Oat3 were down‐regulated, whereas Oat2 was unchanged. However, the relationship between MTX and regulation of Oats expressions is not clear.

Assessment of biochemical parameters revealed a number of changes which were specific to MTX treatment. Rofe et al. have reported that MTX treatment decreased ALT, ALP, serum total protein, serum albumin, plasma calcium and bilirubin.^{( 37 )} Likewise, MTX treatment decreased ALT, ALP, serum total protein and serum albumin in the present study. It is well known that clinical treatment with MTX causes liver and kidney abnormalities, so that toxic effects are monitored with hepatic enzymes, creatinine, serum albumin, etc.^{( 2 )} In the present study, abnormalities of the biochemical parameters were also observed. Serum creatinine is related to renal function, but no significant difference was found in this study (2, 3). Therefore, it was supposed that the MTX treatments had no effect on renal function in the present study. Bilirubin concentration in serum showed no change in this study. It was assumed that MTX treatment did not induce cholestasis in this study. It has been reported that cholestasis induced down‐regulation of Mrp2 expression.^{( 38 )}

A derivative of tetrahydrofolic acid, LV rescues normal cells from the toxic effects of MTX. LV has been administered in conjunction with high dose MTX therapy in an effort to control the duration of exposure of sensitive cells to MTX.^{( 1 )} MTX treatment significantly decreased the expression levels of Mrp2, Oat1, Oat3 and the biochemical parameters that indicate general liver function. The decrease of Mrp2, Oat1 and Oat3 expression and the biochemical parameters were recovered by LV rescue. Therefore, it is estimated that the decreases of Mrp2, Oat1 and Oat3 expressions and the biochemical parameters were caused by toxicity of MTX. The results of the present study suggest that the toxicity of MTX may affect disposition and absorption of MTX, endogenous substances and many other drugs.

In conclusion, MTX treatment down‐regulates expression levels of Mrp2, Oat1 and Oat3. This effect is recovered by LV. Moreover, MTX treatment significantly decreased the biochemical parameters: ALT, ALP, serum total protein and serum albumin. The decline of biochemical parameters is also blocked by LV. MTX treatment also down‐regulated expression levels of Mrp2, CAR and PXR mRNA.