Pre‐S2 deletion mutants of hepatitis B virus could have an important role in hepatocarcinogenesis in Asian children

Abstract

Although many studies on the risk factors and their carcinogenesis in adult hepatocellular carcinoma (HCC) have been reported, they remain poorly understood in childhood HCC. A retrospective study of 42 HCC cases in Asian children was conducted. Hepatitis B virus (HBV)‐DNA in HCC tissues was detected in 36 of 42 (86%) cases tested, while no hepatitis C virus (HCV)‐RNA was detectable in any of HCCs. Twenty of 36 (56%) HCC cases were accompanied by cirrhosis. Surprisingly, very high prevalence of the HBV pre‐S deletion mutant was recognized in 27 of 30 (90%) HCCs examined. They occurred most frequently in pre‐S2 (20/27, 74%) followed by pre‐S1 (5/27, 18.5%), and both pre‐S1/S2 (2/27, 7.4%). Interestingly, the pre‐S2 mutant consistently appeared with deletion at nt 4‐57 in all of the 20 cases with the pre‐S2 mutant (100%) and within this locus in the two cases with both pre‐S‐1/S2 mutants. Type II ground‐glass hepatocytes in non‐tumorous livers were seen in 15 of the 22 HCCs with the pre‐S2 deletion mutant (68%). This hotspot mutation in the pre‐S2 was further confirmed by complete genomic sequence of HBV in a Japanese boy who eventually developed HCC. Our result strongly suggests that HBV is a major contributor to the development of HCC in Asian children. The HBV pre‐S2 deletion mutant at nt 4‐57 which has a CD8 T‐cell epitope could be responsible for the emergence and aggressive outcome of childhood HCC. Determination of this hotspot mutation in the pre‐S2 region could be a useful index for predicting the clinical outcome of HCC development. (Cancer Sci 2009; 100: 2249–2254)

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide.^{( 1} , ^{2 )} Risk factors such as chronic infection of hepatitis B virus (HBV) and hepatitis C virus (HCV) are strongly associated with HCC occurrence, although the precise mechanism of the hepatocarcinogenesis is still controversial. It has been estimated that HCC in more than half of adult patients worldwide is related to HBV.^{( 3} , ^{4 )} Particularly in Asia, with highly endemic regions of HBV/HCV, hepatitis virus–related HCC is a big public health problem.

Pathogenesis of cancer in HBV infection has been extensively analyzed, and multiple risk factors appear to play a role. Chronic inflammation and the effects of cytokines is a major factor in the development of fibrosis and HCC.^{( 5 )} Integration of HBV‐DNA into the host cellular genome is also important; it may play a role in enhancing genomic instability and may trigger specific oncogenic pathways.^{( 6 )} In addition, HBV mutations in core promoter and precore regions have been reported to be linked to the severity of liver diseases and development of HCC;^{( 7 )} different HBV genotypes have been found to be associated with different mutation rates of HBV and its pathogenesis.^{( 8} , ^{9 )}

Furthermore, expression of HBV proteins may have a direct effect on cellular functions, and some of these gene products may favor malignant transformation. Cross‐sectional studies have demonstrated that the presence of pre‐S mutants in the serum and liver has been found to carry a high risk for the development of HCC in patients with chronic HBV infection.^{( 10} , ¹¹ , ¹² , ¹³ , ^{14 )} Furthermore, Wang et al. ^{( 15 )} reported the existence of two major types of ground‐glass hepatocyte (GGH); type I GGHs expressed hepatitis B surface antigen (HBsAg) with dense inclusion pattern, were scattered singly, and harbored the pre‐S1 deletion mutant, while type II GGHs were distributed in clusters and contained the pre‐S2 deletion mutant. Both types of pre‐S mutants could initiate endoplasmic reticulum (ER) stress‐dependent signals to induce oxidative DNA damage necessary in carcinogenesis.^{( 16 )} Moreover, transgenic mice harboring pre‐S2 mutants developed nodular liver cell dysplasia and HCC.^{( 17} , ^{18 )} Other functional studies of pre‐S mutants have shown that C terminally truncated medium (M) and large (L) protein function as a transcriptional activator, resulting in increased hepatocyte proliferation rate.^{( 19} , ^{20 )} HBV pre‐S mutants, particularly the pre‐S2 mutants, are now recognized as viral oncoproteins and GGHs are considered to represent precursor lesions of HBV‐related HCC.

The pathogenesis of chronic hepatitis B/C and its malignant transformation in children on the other hand, is poorly understood. Childhood HCC, however, is a real concern as most HCCs behave aggressively and have a high mortality rate.^{( 21} , ^{22 )} Understanding hepatocarcinogenesis in children is important, because childhood HCCs can provide evidence of a direct role of HBV in carcinogenesis, when many risk factors such as alcohol, smoking, diabetes, and obesity can still be excluded. To address these issues, we conducted a retrospective study of childhood HCCs in Asia, which is highly endemic for HBV/HCV. In this study, we focused on mutations of the pre‐S gene and identified a hotspot mutation in the pre‐S2 gene of HBV, which could have an important role in hepatocarcinogenesis in children.

Materials and Methods

Patients.  Liver specimens from 42 children with HCC in Asia, including 28 Vietnamese (24 boys and four girls, from 2 to 14 years of age, collected from 2003 to 2006 at Children’s Hospital No.1, Ho Chi Minh City, Vietnam), seven Koreans (four boys and three girls, from 2 to 16 years, collected from 1993 to 2004 at Seoul National University Hospital, Seoul, Korea), four Taiwanese (four boys, from 12 to 17 years, collected from 1993 to 2005 at National Cheng Kung University Hospital, Tainan, Taiwan), and three Japanese (three boys, from 5 to 13 years, collected from 1980 to 1995 at National Defense Medical College Hospital, Saitama, and Nihon University Hospital, Tokyo, Japan), were analyzed. In total, the sex ratio (boy/girl) was 34/8 (4.3:1) and the mean age was 11 ± 3 years. For comparison, we also examined 10 children with hepatoblastoma (mean age, 4 ± 3 years) and 10 children infected with HBV, but without hepatic tumors (mean age 6 ± 5 years). All patients with hepatic tumor underwent liver resection and were histologically diagnosed as either HCC or hepatoblastoma. In one Japanese boy with HCC, we followed his clinical course for 7 years. This study was approved by the respective ethical committees of the involved institutions.

Immunohistochemical staining.  Staining of HBsAg in formalin‐fixed, paraffin‐embedded (FFPE) liver tissues was done by an immunohistochemical method using a polyclonal rabbit antiserum against HBsAg (prepared by K.A.) and the Dako LSAB2 system‐HRP kit (Dako, Tokyo, Japan).

DNA/RNA extraction from liver specimens.  Extraction of the nucleic acids (DNA/RNA) from FFPE tissues and PCR were performed as described in detail previously.^{( 3 )} In most cases included in the non‐HCC control group, FFPE liver tissues were used for analyses. In a few cases, frozen liver tissues were used.

Detection of HBV‐DNA and HCV‐RNA by PCR for screening.  The sequences of the PCR primers for HBV (X region) and HCV (5′‐untranslated region) for screening and PCR have been reported previously.^{( 3 )} To avoid the risk of false‐positive results, PCR assays were done with strict precautions against cross‐contaminations.

Genotyping of HBV.  Genotyping of HBV was determined by phylogenetic analysis.

Amplification of the pre‐S gene and sequencing.  To obtain the whole region of the pre‐S domain (pre‐S1 + pre‐S2 genes), we designed PCR primers from well‐conserved sequence regions among HBV genotypes: P1 (sense, 5′‐TCACCATATTCTTGGGAACAAGA‐3′, nt 2817‐2839) and S1‐1R (antisense, 5′‐AAACCCCGC CTGTAACACGA‐3′, nt 194‐213) for first‐round PCR, and P2 (sense, 5′‐TTGGGAACAAGATCTACA GC‐3′, nt 2828‐2847) and S8R (antisense, 5′‐GGTCCTAGGAATCCTGAT‐3′, nt 171‐188) for second‐round PCR. The PCR reaction was performed in a 40‐μL mixture containing 1X Taq polymerase buffer containing 2 mm MgCl₂, 0.2 mm dNTP mix, 50 ng each primer, 1.25 units Ex Taq (Takara, Shiga, Japan), and 10 μL of extracted DNA. The nested PCR program was set for 40 cycles at 94°C for 20 s, 50°C (55°C for the 2nd round) for 20 s, 72°C for 40 s, followed by a final extension step at 72°C for 7 min. In one Japanese boy, the complete genome of HBV was amplified by a method previously reported.^{( 23 )} The PCR products were separated by 1% agarose gel electrophoresis and purified using the QIA quick gel extraction kit (Qiagen, Chatsworth, CA, USA). Purified DNA was subjected to direct sequencing using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit and automated DNA sequencer ABI 3130 (Applied Biosystems, Foster City, CA, USA).

Results

Histologically, 42 cases were diagnosed as HCC, of which 36 (86%) were intra‐hepatic HBV‐DNA‐positive. Of these 36 HCC cases, 20 (56%) were accompanied by cirrhosis. There was no surrounding liver parenchyma for histological examination in six HCC cases. Two of the 10 cases (20%) with hepatoblastoma had cirrhosis, and all 10 were negative for HBV‐DNA. HCV‐RNA was undetectable in all HCC cases. Genotyping of HBV showed that 22/30 (73%; 10/18 in Vietnam, 6/6 in Korea, 3/3 in Taiwan, 3/3 in Japan) cases were genotype C and 8/30 (27%; 8/18 in Vietnam) cases were genotype B. In the non‐HCC Vietnamese control group, six were genotype C and four were genotype B, respectively.

By sequencing analysis of HBV, the pre‐S mutant was identified in 27/30 (90%) HCCs; and in 16/18 (89%) Vietnamese, 5/6 (83%) Korean, 3/3 (100%) Taiwanese, and 3/3 (100%) Japanese patients (Table 1). No significant difference in the pre‐S mutant between genotypes B and C was found. All deletion mutants occurred with no frame‐shift of the sequence. Importantly, most of the pre‐S deletion mutants were located in pre‐S2 (20/27, 74%), followed by pre‐S1 (5/27, 18.5%), and in both pre‐S1/S2 (2/27, 7.4%). Interestingly, the deletion mutant in the pre‐S2 occurred consistently in the same locus at nt 4‐57 (54 nt deletion) in all 20 cases with the pre‐S2 mutant only, and within this hotspot region (nt 8‐10 and 45‐53, respectively) in two cases with both pre‐S1/S2 mutants (Fig. 1). Furthermore, the pre‐S1 mutant also very frequently occurred at nt 3040‐3111 (72 nt deletion) in all of the five cases. Among 22 HCCs with the pre‐S2 deletion mutant, type II GGHs coexisted in 15 (68%) cases by immunohistochemical examination. Meanwhile, no such mutation was found in any of HBV‐infected, non‐HCC Vietnamese children.

Table 1.

 Detection rate and location of hepatitis B virus (HBV) pre‐S deletion mutant in childhood hepatocellular carcinoma (HCC)

	Number tested	Deletion mutant	Location
			pre‐S1	pre‐S2	pre‐S1 + S2
With HCC
Vietnam	18	16 (89%)	2 (13%)	13 (81%)	1 (6%)
Korea	6	5 (83%)	0	5 (100%)	0
Taiwan	3	3 (100%)	3 (100%)	0	0
Japan	3	3 (100%)	0	2 (67%)	1 (33%)
Total	30	27 (90%)	5 (18.5%)	20 (74%)	2 (7.4%)
Without HCC†
Vietnam	10	0	0	0	0

†Comprising 3 with biliary atresia, 3 with HBV asymtomatic carrier, 2 with fulminant hepatitis, 1 with acute hepatitis, and 1 with Wilson’s disease.

Figure 1.

 Map of hepatitis B virus (HBV) pre‐S deletion mutant identified in childhood hepatocellular carcinoma (HCC). Numbers of nucleotide positions are based on the HBV‐VT101 isolate (accession no: AB112063).

Long‐term follow up of a Japanese boy with HCC.  The patient (#IF801) was a 13‐year‐old (born in 1983) boy born to an hepatitis B e antigen (HBeAg)+/HBV positive mother. His sister (16 years old, born in 1980) was also HBV‐positive. They became HBeAg‐positive HBV carriers soon after birth, but were negative for HCV‐RNA. At the age of 6, the boy received Shosaikoto treatment, comprising Kampo medicines, because of elevated alanine aminotransferase (ALT) (Fig. 2A). His liver tests improved for a while, but ALT again became abnormal. At this point, he was diagnosed with chronic active hepatitis on liver biopsy. Interferon therapy was started for 1 month at the age of 7 years. Following this therapy, the HBeAg seroconverted to anti‐HBe, but his ALT remained elevated for a while. At the age of 13, a rapid increase in serum alpha‐fetoprotein level was noted and the diagnosis of HCC was rendered following an ultrasound examination. He underwent surgical resection of the tumor. Histologically, the tumor was found to be moderately differentiated HCC with trabecular pattern (Fig. 3A). In the noncancerous liver, cirrhosis with slight lymphocytic infiltrations of the portal tracts was seen. Fatty metamorphosis in cancer cells and scattered large regenerative nodules suggesting pre‐neoplastic changes in non‐cancerous liver were observed (Fig. 3B). Scattered clusters of GGHs were present in the non‐cancerous liver (Fig. 3C). By immunohistochemical staining, these GGHs were strongly reactive for HBsAg and formed a localization pattern corresponding to type I and type II GGHs (Fig. 3D).

Figure 2.

 Clinical course of a Japanese boy (#IF801) who eventually developed hepatocellular carcinoma (HCC) (A) and his sister (B). ‘a’, ‘a’ determinant domain in the S gene; AFP, alpha‐fetoprotein; ALT, alanine aminotransferase; CAH, chronic active hepatitis on biopsy; CP, core promoter; IFN, interferon; m, mutant; PC, precore; Shosaikoto, Kampo medicine; w, wild type.

Figure 3.

 Liver histology of a Japanese boy (#IF801) showing moderately differentiated hepatocellular carcinoma (HCC) with a trabecular pattern (A). Scattered large regenerative nodules with fatty metamorphosis (arrows) suggesting pre‐neoplastic changes in non‐cancerous liver were observed (B). Scattered clusters of ground‐glass hepatocyte (GGH) were present in the non‐cancerous liver (C). By immunohistochemical staining using serial sections, these GGHs were strongly reactive for hepatitis B surface antigen (HBsAg) and formed a localization pattern corresponding to type I and type II GGHs (D).

Full‐length sequence of the HBV genome was recovered in serum samples from four different time points during his clinical course. HBV isolates at ages 6 and 7 years showed the wild type, but samples obtained later showed the deletion mutant in pre‐S2 (nt 45‐53) at the age of 8, and deletion mutants in both pre‐S1 (nt 2909‐2929) and pre‐S2 (nt 45‐53) at the age of 13 (Fig. 4). In addition to the pre‐S mutants, the precore mutant (G1896A) which corresponded to the HBeAg seroconversion was seen in the HBV isolated at ages 8 and 13. No other significant mutations such as double mutation of A1762T/G1764A within the core promoter region and the escape mutant within the ‘a’ determinant domain in the S gene were found. Meanwhile, his 16‐year‐old sister remained asymptomatic with no mutations found at complete sequencing of HBV at the age of 14 (Fig. 2B). A homology search at the nucleotide level between HBV isolates from the son and the daughter revealed 99.6% similarity. This suggests that they were infected with the same viral strain from their mother.

Figure 4.

 Alignment of nucleotide sequence in pre‐S1/S2 regions that showed deletions. Slash indicates nucleotide deletion. Number indicates nucleotide site of the defined hepatitis B virus (HBV) genome. –Years for each isolate corresponds to the age in years at which HBV was recovered.

Discussion

Only few studies on the status of HBV‐DNA in childhood HCC have been reported so far,^{( 24} , ^{25 )} because the prevalence of childhood HCC is much lower than that of adults. Study of childhood HCC is important, because the carcinogenic mechanism in childhood takes advantages of a shorter incubation period. Furthermore, various effects of well‐recognized risk factors of hepatocarcinogenesis such as heavy alcohol consumption, smoking, obesity, diabetes, and exposure to chemical carcinogens including aflatoxin B₁ can be excluded.^{( 26} , ²⁷ , ²⁸ , ^{29 )} For this reason, HCC in children may provide useful information for understanding the exact role of HBV in HCC development. To exclude aflatoxin B₁ intervention, which may sometimes pose a problem in tropical developing countries, we tested the mutation of p53 in tumors, but there was no evidence of specific mutation induced by aflatoxin B₁ at codon 249 in our cases (data not shown).

Since FFPE human tissues are stored routinely for many years without affecting DNA/RNA‐PCR, the method should allow systematic retrospective studies. However, the reliability of PCR results is always in question because of the risk of false‐positive results caused by cross‐contamination. In our laboratory, strict precautions against such events were undertaken to overcome this problem. To confirm the preservation of viral DNA/RNA in FFPE liver tissues used in this study, detection of cellular β‐actin RNA by PCR was performed. The results showed that the β‐actin RNA was amplified in all FFPE tissues examined (data not shown).

In this study, our results showed a high detection rate of HBV‐DNA in tumor tissues from Asian children with HCC. Our findings are in concordance with an epidemiological study in Taiwan, where children with HCC were found to have a very high positive rate for serum HBsAg.^{( 30} , ^{31 )} Furthermore, universal hepatitis B vaccination has reduced the incidence of childhood HCC.^{( 32 )} These findings strongly suggest that HBV is an important etiologic factor in the pathogenesis of HCC in Asian children, although the clinical course and the pathological change of HBV‐related liver disease are relatively mild compared to that of adults.^{( 31} , ^{33 )} In adult patients with chronic HBV infection, HCC usually develops at the age of about 40 years or older. Thus the incubation period from HBV infection to clinically demonstrable HCC is usually considered to be at least 20 years or more. However, in our patient population, HCC developed in children as young as 2 years. This is apparently unusual from both a clinical and epidemiologic point of view.

So far, although many hypotheses have been presented for hepatocarcinogenesis of HBV, the precise mechanism is still controversial. In this study, we focused on mutations of the pre‐S gene and identified high prevalence of the pre‐S deletion mutant in childhood HCCs. Surprisingly, 100% of the pre‐S2 deletion mutant occurred consistently in the locus nt 4‐57. This mutation site is similar to one of the prototypes of the pre‐S2 mutant identified in adult HCC; although admittedly the patterns of the deletion mutant are more complex in adult HCC.^{( 15 )} Furthermore, we observed sequential changes in the HBV genome of a Japanese boy with chronic HBV infection who eventually developed HCC. In this case, the deletion mutant appeared first in pre‐S2 at nt 45‐53 (located inside of the hotspot mutation), followed by mutation in the pre‐S1 gene a few years later. HCC developed 5 years after the pre‐S2 mutant was documented. This pre‐S2 mutant was conserved during the 5 years till HCC was diagnosed. Furthermore, type I and type II GGHs corresponding to pre‐S1 and pre‐S2 deletion mutants, respectively, coexisted in non‐cancerous liver parenchyma. This case is a good example to explain that the pre‐S2 mutant could play an important role in process of HCC development. On the contrary, it is very rare to find such pre‐S deletions of HBV in children without HCC. Our previous study showed no cases with such a mutant in 39 Russian children with HBV carrier, even though HBV is highly endemic in Russia.^{( 10 )} Furthermore, no case with the pre‐S mutant was found among Asian patients without HCC less than 20 years of age.^{( 10 )}

It is interesting to note high prevalence of pre‐S2 mutants with consistent deletion at nt 4‐57, and the frequent cirrhosis (56%) in childhood HCC suggest that an exaggerated immune response may impose on these children, as compared to the adulthood HCC cases among which a long‐term period of immune tolerance happens, followed by series of acute exacerbation. Both of the pre‐S1 and pre‐S2 regions exposed at the surface of HBV particles are highly immunogenic and potentially under selective pressure by the immune system.^{( 34 )} Particularly, an emergence of the pre‐S2 deletion mutant is interesting and important, since the pre‐S2 mutants usually occur at the late stage or in advanced diseases of chronic HBV infection with cirrhosis in adulthood^{( 11 )} and the deletion site coincides with an epitope of cytotoxic T‐cell and neutralization responses, suggesting the pre‐S2 deletion mutants may represent an immune escape mutant.^{( 35 )} Furthermore, pre‐S mutants lead to retention of HBs protein within the ER of hepatocytes, resulting in the appearance of GGHs.^{( 36} , ^{37 )} Thus, the overproduction, accumulation, and retention of the HBs protein in the hepatocytes could produce prolonged hepatocellular injury and trigger hepatocarcinogenesis through oncogenic pathways. In fact, the pre‐S mutants including the hotspot mutant reported here can induce ER stress and oxidative DNA damage.^{( 17} , ^{18 )} The pre‐S2 mutants, albeit inducing a weaker level of ER stress signals, could additionally initiate ER stress‐independent retinoblastoma (RB)/transcription factor E2F/cyclin A signaling through interaction with Jun activating binding protein (JAB1) to degrade p27, illustrating the growth advantage of type II GGHs.^{( 17} , ^{18 )} The combined effects of genomic instability and proliferation of hepatocytes harboring pre‐S mutants could potentially lead to hepatocarcinogenesis over the decades of chronic HBV infection. Moreover, transgenic mice harboring pre‐S2 mutant plasmids have been shown to develop dysplastic change of hepatocytes and HCC.^{( 17 )} These above findings strongly suggest the possibility of carcinogenesis induced by the pre‐S2 deletion mutant of HBV. Furthermore, histologic findings of GGH appearing in the liver, particularly type II GGHs, may represent the pre‐neoplastic lesions of HBV‐related HCC.

In addition to the evidence of HBV carcinogenesis, the remarkable predominance of HCC in boys suggests that other factor(s) in addition to chronic HBV infection may contribute to hepatocarcinogenesis in males, particularly the early occurrence in prepubertal males, i.e. androgenic hormone as cocarcinogenesis.^{( 38} , ³⁹ , ^{40 )}

Conclusions

In conclusion, this is the first report that demonstrates a very high prevalence of the pre‐S2 mutant in HBV‐related childhood HCCs. It is noteworthy that the pre‐S2 mutant appeared consistently with deletion at nt 4‐57. The absence of this pre‐S2 mutant in HBV‐infected children without HCC, and the development of HCC 5 years following pre‐S2 mutation in one case, suggest the important role this mutant may play in HBV‐induced hepatocarcinogenesis.