Abstract
Feline vector-borne diseases can be caused by a range of pathogens transmitted by arthropods. Many of these infections have zoonotic implications, and stray cats are potential sentinels for human and pet health. This study investigated the prevalence of selected vector-borne infections in stray colony cats in Milan. Blood samples from 260 stray cats were evaluated, using conventional polymerase chain reaction tests (cPCRs), for the presence of DNA associated with Rickettsia species, Anaplasma phagocytophilum and Ehrlichia species. Positive cPCR results occurred in 127/260 subjects (48.9%; 95% confidence interval [CI] = 40.7–58.1), with a prevalence of 31.9% (83/260, 95% CI = 25.4–39.6) for Rickettsia species, 17.7% (46/260, 95% CI= 13.0–23.6) for A phagocytophilum, and 5.4% (14/260, 95% CI = 2.9–9.0) for Ehrlichia species. There was no statistical association between a positive PCR test for vector-borne infections surveyed and colony location, age, gender, body condition score or complete blood count abnormalities, nor feline immunodeficiency virus, feline leukaemia virus or Toxoplasma gondii status. The only variable linked to positive PCR results was detection of signs of ocular infection and PCR positivity for Rickettsia species (P = 0.04, odds ratio [OR] = 2.2, 95% CI = 1.1–4.4, P = 0.02). There is a significant prevalence of vector-borne infections with zoonotic potential in urban stray cats in Milan. Thus, dogs and pet cats with outdoor access should be monitored and treated for ectoparasites on a regular basis to minimise risks of disease and the potential transmission of zoonotic agents to people.
Short Communication
Feline vector-borne diseases (FVBDs) are an emerging problem worldwide owing to their frequency and morbidity. Furthermore, most FVBDs are zoonotic, and stray cats can be potential sentinels for human infection. FVBDs, such as rickettsiosis, anaplasmosis and ehrlichiosis, are caused by diverse pathogens transmitted by arthropod vectors, especially fleas and ticks.1–3
Stray cats are predisposed to FVBDs because they live outdoors, have constant exposure to ticks and fleas, and prey on urban wildlife that may harbor pathogens. Additionally, stray cats are often neither monitored nor treated for vector-borne pathogens. Although several studies worldwide have reported on the epidemiology and emergence of FVBDs in owned healthy or sick pet cats,4–14 only a few studies have focused on stray colony cats15–18 and, in particular, there have been only studies looking for Bartonella species infections in stray cats in northern Italy.19,20
Free-roaming stray cats are a public health concern in urban and rural areas of Italy. 21 However, the environmental and medical impact of free-roaming cats is not well understood owing to a lack of scientific data on these populations. Identification and epidemiological surveillance of the various zoonotic diseases in cats may advance the development, and implementation, of protective measures by national and regional agencies. Therefore, an understanding of the prevalence of FVBDs could help to limit the spread of zoonotic diseases in feline, canine and human populations.
This study evaluated the prevalence of Rickettsia species, Anaplasma phagocytophilum, and Ehrlichia species in stray colony cats in Milan, and identified possible risk factors for these infections.
During a 2 year collection period (January 2008–January 2010), blood samples were taken from 260 stray cats from urban colonies in Milan (northern Italy), under a trap–neuter–release programme approved by the city council. The programme was conducted as previously described. 22 Briefly, stray cats, trapped by volunteers and presented to the University of Milan, were anaesthetised (tiletamine and zolazepam plus tramadol intramuscularly) while confined in the trap. General anaesthesia was maintained with isoflurane administered by mask. Before surgery clinical examinations were performed and blood samples were taken from each cat. After surgery cats were hospitalised for at least 5 days (depending on health status) before being released into the location from where they had been trapped.
Cats (n = 260) were collected from eight of the nine decentralisation zones of Milan, including three from zone 1 (1.2%), 11 from zone 2 (4.2%), 108 from zone 4 (41.5%), 12 from zone 5 (4.6%), 27 from zone 6 (10.4%), 55 from zone 7 (21.2%), 22 from zone 8 (8.5%) and 22 from zone 9 (8.5%). All cats were domestic shorthairs. Age distribution, estimated by dentition, included 118 (45.4%) kittens and 142 (54.6%) adult cats. The group consisted of 90 males (34.6%) and 170 females (65.4%). Body condition score (BCS) was recorded for 243 cats, with a median score of 4.3 ± 0.73 (range 2–8/9). Moreover, 225 cats (92.6%) had a normal weight with a BCS score range of 4–6. Only 18 (7.4%) cats were underweight (BCS = 1–3).
Health evaluation (n = 260) revealed 72 (27.7%) cats to be healthy and 188 (72.3%) cats to be unhealthy. Clinical abnormalities detected included enlarged lymph nodes (n = 133, 51.2%), pale mucous membranes (n = 14, 5.4%), stomatitis (n = 101, 38.8%), signs of respiratory tract infection (n = 22, 8.5%) and signs of ocular infection (n = 40, 15.4%). The cats were not systematically examined for the presence of ticks or fleas and so the rates of ectoparasitism were not recorded.
Blood samples were collected aseptically, from the jugular or cephalic vein, into EDTA-treated and serum separator tubes. Complete blood count (CBC, n = 150) was performed on EDTA-anticoagulated blood within 24 h of sample collection, using the ADVIA 120 System (Siemens Healthcare Diagnostics). Surplus blood was stored at −20°C and used for polymerase chain reaction (PCR) assay. Sera separated from whole blood were tested for antibodies to feline immunodeficiency virus (FIV) (gp40 and p24 FIV antigens; n = 166) and feline leukaemia virus (FeLV) p27 antigen (n = 166) using a commercial ELISA kit (SNAP FeLV/FIV Combo Plus Test; IDEXX Laboratories). The presence of immunoglobulin G (IgG) antibodies against Toxoplasma gondii (n = 113) was evaluated using a commercial indirect fluorescent antibody test (IFAT) kit (Fuller Laboratories). An antibody titre ⩾1:64 was considered indicative of T gondii exposure.
Conventional PCR (cPCR) was performed on blood samples to amplify pathogen-associated DNA associated with Rickettsia species, A phagocytophilum and Ehrlichia species. Primer names, sequences and amplicon size (base pairs) are summarised in Table 1, and PCR conditions have been previously reported.23–25 Control reactions were performed in the absence of template DNA to rule out contaminations during PCR.
Table 1.
Names, sequences and amplicon size (base pairs [bp]) of polymerase chain reaction primers used in this study
| Organism detected |
Primer name |
Nucleotide sequence (5′-3′) | Amplicon size (bp) | Reference |
|---|---|---|---|---|
| Rickettsia species | Tz-15-19 | TTCTCAATTCGGTAAGGGC | 246 | Tzianabos et al 23 |
| Tz-16-20 | ATATTGACCAGTGCTATTTC | |||
| Ehrlichia species | PER1 | TTTATCGCTATTAGATGAGCCTATG | 451 | Munderloh et al24 |
| PER2 | CTCTACACTAGGAATTCCGCTAT | |||
|
Anaplasma
phagocytophilum |
MSP4AP5 | ATGAATTACAGAGAATTGCTTGTAGG | 849 | de la Fuente et al 25 |
| MSP4AP3 | TTAATTGAAAGCAAATCTTGCTCCTATC |
The prevalence of each pathogen was calculated and univariate analysis of categorical data was performed using the χ2 test (cell frequencies of >5) or Fisher’s exact test (cell frequencies of ⩽5). Any parameters statistically linked to positive PCR results were used in a logistic regression model to test for independent risk factors associated with infection. Associations were considered statistically significant when P <0.05. Data were analysed using MedCalc Software (version 12.3.0).
Overall, 127 cats (48.9%, 95% confidence interval [CI] = 40.7–58.1) tested cPCR positive to at least one of the agents. Prevalence of each infection and co-infections are reported in Table 2. Median haematocrit (Ht) was 25.2% (range 13–38%), median white blood cell (WBC) count was 10,770/μl (range 1516–23,240/μl) and the median thrombocyte count was 374 × 109/l (range 90–800). Anaemia (Ht <24%) was found in 69/150 (46.0%) cats, leukopenia (WBC <10,570/μl) in 14/150 (9.3%) cats, leukocytosis (WBC >14,390/μl) in 5/150 (3.3%) cats, thrombocytopenia (PLT <200,670/μl) in 10/150 (6.7%) cats. Thirteen (7.8%) cats tested positive for FIV and six (3.6%) were positive for FeLV. An antibody titre for T gondii ⩾1:64 was detected in 31/113 (27.4%) cases.
Table 2.
Prevalence of vector-borne infections in 260 stray colony cats based on polymerase chain reaction detection of bacterial DNA in blood
| Vector-borne pathogen | Number of infected cats |
Observed prevalence (%) |
95% CI |
|---|---|---|---|
| Rickettsia species | 83 | 31.9 | 25.4–39.6 |
| Anaplasma phagocytophilum | 46 | 17.7 | 13.0–23.6 |
| Ehrlichia species | 14 | 5.4 | 2.9–9.0 |
| A phagocytophilum + Rickettsia species | 14 | 5.4 | 2.9–9.0 |
| A phagocytophilum + Ehrlichia species | 0 | 0 | 0 |
| Rickettsia species + Ehrlichia species | 2 | 0.8 | 0.09–2.80 |
| A phagocytophilum + Rickettsia species + Ehrlichia species | 0 | 0 | 0 |
CI = confidence interval
There were no correlations between colony location, age, gender, BCS, CBC abnormalities, FIV, FeLV, T gondii status and infections. The only variable linked to PCR-positive results was the presence of sign of ocular infections in association with Rickettsia species infection (Table 3).
Table 3.
Prevalence of Rickettsia species, Anaplasma phagocytophilum and Ehrlichia species in stray colony cats based on polymerase chain reaction (PCR) detection of bacterial DNA and statistical analysis of risk factors
| Factor | Category |
Ehrlichia species-positive, n (%) |
P |
A phagocytophilum-positive, n (%) |
P |
Rickettsia species-positive, n (%) |
P |
|---|---|---|---|---|---|---|---|
| Origin of the cats |
Zone 1 | 1/3 (33.3) | 0.38 | 0/46 (0.0) | 0.96 | 1/83 (1.2) | 0.57 |
| Zone 2 | 2/11 (18.1) | 0.22 | 3/46 (6.5) | 0.66 | 3/83 (3.6) | 0.99 | |
| Zone 4 | 5/109 (4.9) | 0.83 | 24/46 (52.2) | 0.15 | 41/83 (49.4) | 0.10 | |
| Zone 5 | 1/12 (8.3) | 0.84 | 0/46 (0.0) | 0.21 | 2/83 (2.4) | 0.40 | |
| Zone 6 | 1/27 (3.7) | 0.97 | 0/46 (0.0) | 0.18 | 4/83 (4.8) | 0.07 | |
| Zone 7 | 1/54 (1.9) | 0.34 | 15/46 (32.6) | 0.06 | 19/83 (22.9) | 0.76 | |
| Zone 8 | 2/22 (9.1) | 0.76 | 0/46 (0.0) | 0.05 | 9/83 (10.8) | 0.48 | |
| Zone 9 | 1/22 (4.5) | 0.76 | 4/46 (8.7) | 0.82 | 4/83 (4.8) | 0.23 | |
| Age | Juvenile (⩽6 months) | 8/118 (6.8) | 0.53 | 21/46 (45.7) | 0.90 | 42/83 (50.6) | 0.31 |
| Adult (>6 months) | 6/142 (4.2) | 25/46 (54.3) | 41/83 (49.4) | ||||
| Gender | Male | 4/90 (4.4) | 0.84 | 14/46 (30.4) | 0.63 | 22/83 (26.5) | 0.08 |
| Female | 10/170 (5.9) | 32/46 (69.6) | 61/83 (79.5) | ||||
| BCS | Poor (1–3/9) | 1/18 (5.5) | 0.66 | 1/44 (2.3) | 0.26 | 5/83 (6.0) | 0.74 |
| Good (4–6/9) | 11/225 (4.9) | 0.66 | 43/44 (97.7) | 78/83 (94.0) | |||
| Health status | Healthy | 4/72 (5.5) | 0.82 | 18/46 (39.1) | 0.08 | 24/83 (28.9) | 0.88 |
| Unhealthy | 10/188 (5.3) | 28/46 (60.9) | 59/83 (71.1) | ||||
| Clinical abnormalities in unhealthy cats | Lymph node enlargement | 6/133 (4.5) | 0.72 | 21/46 (45.7) | 0.51 | 45/83 (54.2) | 0.59 |
| Pale mucous membranes | 1/14 (7.1) | 0.76 | 4/46 (8.7) | 0.46 | 1/83 (1.2) | 0.08 | |
| Stomatitis | 5/101 (5.0) | 0.97 | 14/46 (30.4) | 0.26 | 25/83 (30.1) | 0.07 | |
| Signs of respiratory tract infection | 1/22 (4.5) | 0.76 | 3/46 (6.5) | 0.82 | 9/83 (10.8) | 0.48 | |
| Signs of ocular infection | 1/40 (2.5) | 0.62 | 7/46 (15.2) | 0.85 | 19/83 (22.9) |
0.04
OR = 2.2 CI = 1.11–4.38 P = 0.02* |
|
| CBC abnormalities | Anaemia | 0/70 (0.0) | 0.54 | 17/37 (45.9) | 0.89 | 35/71 (49.3) | 0.59 |
| Leukopenia | 0/14 (0.0) | 0.44 | 2/37 (5.4) | 0.53 | 5/71 (7.0) | 0.53 | |
| Leukocytosis | 0/5 (0.0) | 0.08 | 3/37 (8.1) | 0.18 | 2/71 (2.8) | 0.90 | |
| Thrombocytopenia | 0/10 (0.0) | 0.30 | 3/37 (8.1) | 0.99 | 6/71 (8.5) | 0.63 | |
|
A phagocytophilum
PCR results |
Positive | 0/46 (0.0) | 0.15 | – | – | 14/83 (16.9) | |
| Negative | 14/14 (100) | – | – | 69/83 (83.1) | |||
| Rickettsia species PCR results | Positive | 2/14 (14.3) | 0.83 | 14/46 (30.4) | 0.95 | – | – |
| Negative | 12/14 (85.7) | 32/46 (69.6) | – | ||||
| Ehrlichia species PCR results | Positive | – | 0/46 (0.0) | 0.15 | 2/83 (2.4) | 0.25 | |
| Negative | – | 46/46 (100) | 81/83 (97.5) | ||||
| FIV test results | Positive | 0/13 (0.0) | 0.74 | 5/39 (12.8) | 0.35 | 5/78 (6.4) | 0.68 |
| Negative | 13/13 (100) | 34/39 (87.2) | 73/78 (93.6) | ||||
| FeLV test results | Positive | 0/6 (0) | 0.34 | 0/39 (0.0) | 0.36 | 2/78 (2.6) | 0.75 |
| Negative | 6/6 (100) | 39/39 (100) | 76/78 (97.4) | ||||
| T gondii test results | Positive | 0/31 (0.0) | 0.93 | 6/23 (26.1) | 0.94 | 18/65 (27.7) | 0.83 |
| Negative | 2/81 (2.5) | 17/23 (73.9) | 47/65 (72.3) |
BCS = body condition score; CBC = complete blood count; FIV = feline immunodeficiency virus; FeLV = feline leukemia virus; OR = odds ratio; CI = 95% confidence interval
P values in bold are statistically significant (P <0.05). *P from logistic regression analysis
This is the first study to investigate the prevalence of selected FVBDs in urban stray cats in Milan. It is difficult to compare these results to the worldwide prevalence of feline infections owing to the limited data available, difficulties in comparing information from studies using different diagnostic tools (ie, molecular and serological) and confounding factors associated with distinct study populations (ie, stray vs owned cats, healthy vs sick cats).
Rickettsia species have been detected in up to 15.7% of ticks collected from public parks in northern Italy. 26 Despite their presence in arthropod vectors, rates of rickettsial infection in cats are generally low worldwide. Our prevalence was significantly higher than in previous studies on stray cats from Ireland in which no cats tested positive for Ehrlichia species DNA in blood. 18 Also in a study of stray cats in Ontario, Canada, no Rickettsia felis DNA was found in blood, despite 18% of fleas being found to test positive for R felis DNA. 17 There was an association between cats that tested PCR positive for Rickettsia species and the presence of signs of ocular infection in these cats (OR = 2.2, P = 0.02). In dogs, rickettsial infection can cause ocular abnormalities 1 and, although not previously documented, we suggest that this may also be true for cats.
In this study, 17.7% of cats were infected with A phagocytophilum, which is higher than other studies performed on feral cats in northern Florida, 15 Arizona 16 and Ireland 18 where no cats tested positive for A phagocytophilum DNA on PCR of blood. Studies have shown that, in some cases, A phagocytophilum DNA was not detected by PCR even if cats were seropositive (mainly at IFAT test) in the USA (4.3% seropositivity), 10 and northern (1.8%) 7 and central Spain (4.9%). 5
The Ehrlichia species that infect cats have been not fully determined. 3 The majority of epidemiological data on Ehrlichia species infections in cats are based on serological surveys. Only two studies have looked at prevalence of Ehrlichia species in central Italy. One study was able to detect serological evidence of Ehrlichia species in 10.2% of stray cats from shelters in Tuscany. 4 Another study from the Abruzzo region, detected two seropositive cats out of 203 (1%), although both cats were PCR-negative for Ehrlichia species DNA in blood samples. 6 No Ehrlichia species-associated DNA was amplified by PCR from blood of stray cats in Ireland 18 nor from feral cats in Arizona (USA) 16 or Florida. 15
Our study had certain limitations as some pathogens were investigated only at the genus level (eg, Rickettsia species and Ehrlichia species), and information about the species infecting the study population was lacking. Ectoparasitism was not investigated and, consequently, potential vectors associated with the pathogens in this area were not identified. Risk factors analysed were not available for all 260 cats. Regardless of these limitations, we believe that this study provides new and useful information on FVBDs in Italy.
Conclusions
We found that FVBDs were present with significant prevalence in the stray urban feline population of Milan. Pet cats with outdoor access in this region should be regularly monitored and treated for ectoparasites to minimise health risks to humans and pets.
Footnotes
Funding: The authors received no specific grant from any funding agency in the public, commercial or not-for-profit sectors for the preparation of this short communication.
The authors do not have any potential conflicts of interest to declare.
Accepted: 1 November 2013
References
- 1. Greene CE, Kidd L, Breitschwerd EB. Rocky Mountain and Mediterranean spotted fevers, cat-flea typhuslike illness, rickettsialpox, and typhus. In: Greene CE. (ed). Infectious diseases of the dog and cat. 4th ed. St Louis, MO: Elsevier Saunders, 2012, pp 259–269. [Google Scholar]
- 2. Lappin MR, Breitschwerdt EB. Anaplasma phagocytophilum infection (feline granulocytotropic anaplasmosis). In: Greene CE. (ed). Infectious diseases of the dog and cat. 4th ed. St Louis, MO: Elsevier Saunders, 2012, pp 254–256. [Google Scholar]
- 3. Lappin MR, Breitschwerdt EB. Ehrlichia spp. infection (feline monocytotropic ehrlichiosis). In: Greene CE. (ed). Infectious diseases of the dog and cat. 4th ed. St Louis, MO: Elsevier Saunders, 2012, pp 238–241. [Google Scholar]
- 4. Ebani VV, Andreani A. Ehrlichiosi felina da Ehrlichia canis. Indagine sierologica tra gatti della Toscana. Obiettivi Documenti Veterinari 2002; 9: 47–49. [Google Scholar]
- 5. Aguirre E, Tesouro MA, Amusategui I, et al. Assessment of feline ehrlichiosis in central Spain using serology and a polymerase chain reaction technique. Ann N Y Acad Sci 2004; 1026: 103–105. [DOI] [PubMed] [Google Scholar]
- 6. Vita S, Santori D, Aguzzi I, et al. Feline leishmaniasis and ehrlichiosis: serological investigation in Abruzzo region. Vet Res Commun 2005; 29 Suppl 2: 319–321. [DOI] [PubMed] [Google Scholar]
- 7. Solano-Gallego L, Hegarty B, Espada Y, et al. Serological and molecular evidence of exposure to arthropod-borne organisms in cats from northeastern Spain. Vet Microbiol 2006; 118: 274–277. [DOI] [PubMed] [Google Scholar]
- 8. Lappin MR, Griffin B, Brunt J, et al. Prevalence of Bartonella species, haemoplasma species, Ehrlichia species, Anaplasma phagocytophilum, and Neorickettsia risticii DNA in the blood of cats and their fleas in the United States. J Feline Med Surg 2006; 8: 85–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Hackett TB, Jensen WA, Lehman L, et al. Prevalence of DNA of Mycoplasma haemofelis, ‘Candidatus Mycoplasma haemominutum’, Anaplasma phagocytophilum, and species of Bartonella, Neorickettsia, and Ehrlichia in cats used as blood donors in the United States. J Am Vet Med Assoc 2006; 229: 700–704. [DOI] [PubMed] [Google Scholar]
- 10. Billeter SA, Spencer JA, Griffin B, et al. Prevalence of Anaplasma phagocytophilum in domestic felines in the United States. Vet Parasitol 2007; 147: 194–198. [DOI] [PubMed] [Google Scholar]
- 11. Tabar MD, Altet L, Francino O, et al. Vector-borne infections in cats: molecular study in Barcelona area (Spain). Vet Parasitol 2008; 151: 332–336. [DOI] [PubMed] [Google Scholar]
- 12. Barrs VR, Beatty JA, Wilson BJ, et al. Prevalence of Bartonella species, Rickettsia felis, hemoplasmas and the Ehrlichia group in the blood and fleas in eastern Australia. Aust Vet J 2010; 88: 160–165. [DOI] [PubMed] [Google Scholar]
- 13. Ayllón T, Diniz PP, Breitschwerdt EB, et al. Vector-borne diseases in client-owned and stray cats from Madrid, Spain. Vector Borne Zoonotic Dis 2012; 12: 143–150. [DOI] [PubMed] [Google Scholar]
- 14. Vilhena H, Martinez-Díaz VL, Cardoso L, et al. Feline vector-borne pathogens in the north and centre of Portugal. Paras Vectors 2013; 6: 99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Luria BJ, Levy JK, Lappin MR, et al. Prevalence of infectious diseases in feral cats in Northern Florida. J Feline Med Surg 2004; 6: 287–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Eberhardt JM, Neal K, Shackelford T, et al. Prevalence of selected infectious disease agents in cats from Arizona. J Feline Med Surg 2006; 8: 164–168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kamrani A, Parreira VR, Greenwood J, et al. The prevalence of Bartonella, hemoplasma, and Rickettsia felis infections in domestic cats and in cat fleas in Ontario. Can J Vet Res 2008; 72: 411–419. [PMC free article] [PubMed] [Google Scholar]
- 18. Juvet F, Lappin MR, Brennan S, et al. Prevalence of selected infectious agents in cats in Ireland. J Feline Med Surg 2010; 12: 476–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Fabbi M, Vicari N, Tranquillo M, et al. Prevalence of Bartonella henselae in stray and domestic cats in different Italian areas: evaluation of the potential risk of transmission of Bartonella to humans. Parassitologia 2004; 46: 127–129. [PubMed] [Google Scholar]
- 20. Fabbi M, De Giuli L, Tranquillo M, et al. Prevalence of Bartonella henselae in Italian stray cats: evaluation of serology to assess the risk of transmission of Bartonella to humans. J Clin Microbiol 2004; 42: 264–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Slater MR, Di Nardo A, Pediconi O, et al. Free-roaming dogs and cats in central Italy: public perceptions of the problem. Prev Vet Med 2008; 84: 27–47. [DOI] [PubMed] [Google Scholar]
- 22. Spada E, Proverbio D, Della Pepa A, et al. Seroprevalence of feline immunodeficiency virus, feline leukaemia virus and Toxoplasma gondii in stray cat colonies in northern Italy and correlation with clinical and laboratory data. J Feline Med Surg 2012; 14: 369–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Tzianabos T, Anderson BE, McDade JE. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology. J Clin Microbiol 1989; 27: 2866–2868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Munderloh UG, Madigan JE, Dumler JS, et al. Isolation of the equine granulocytic ehrlichiosis agent, Ehrlichia equi, in tick cell culture. J Clin Microbiol 1996; 34: 664–670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. De la Fuente J, Massung RF, Wong SJ, et al. Sequence analysis of the msp4 gene of Anaplasma phagocytophilum strains. J Clin Microbiol 2005; 43: 1309–1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Capelli G, Ravagnan S, Montarsi F, et al. Occurrence and identification of risk areas of Ixodes ricinus-borne pathogens: a cost effectiveness analysis in north-eastern Italy. Parasit Vectors 2012; 5: 61. [DOI] [PMC free article] [PubMed] [Google Scholar]