Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Pdxp | UniProtKB | P60487 | |
| Strain, strain background (Escherichia coli) | BL21(DE3) pLysS | Stratagene Europe/VWR | AGLS200132 | |
| Genetic reagent (M. musculus; male) | Pdxptm1Goh; C57Bl/6J | Ozgene Ltd.; Jeanclos et al., 2019 | Floxed Pdxp mice | |
| Genetic reagent (M. musculus; female) | B6.FVB-Tg(EIIa-cre)C5379Lmgd/J | Jackson Labs | RRID: MGI:2174520 | Ubiquitous Cre deleter |
| Genetic reagent (M. musculus; male and female) | Pdxptm1Goh × EIIa-cre | Jeanclos et al., 2019 | Pdxp-deficient mice | |
| Biological sample (M. musculus) | Primary hippocampal neurons | This paper | From embryos of Pdxp-deficient or floxed Pdxp control mice |
|
| Biological sample (M. musculus) | Hippocampi | This paper | Freshly isolated tissues from Pdxp-deficient or floxed Pdxp control mice |
|
| Antibody | Anti-MAP2 (mouse monoclonal) | Millipore | Cat# MAB3418, RRID: AB_94856 | IF (1:500) |
| Antibody | Anti-actin (mouse monoclonal) | Sigma-Aldrich | Cat# MAB1501, RRID: AB_2223041 | WB (1:5000) |
| Antibody | Anti-PDXP (rabbit monoclonal) | Cell Signaling Technology | Cat# 4686, RRID: AB_2162520 | WB (1:1000) |
| Antibody | Anti-PDXK (rabbit polyclonal) | Sigma-Aldrich | Cat# AV53615, RRID: AB_1855158 | WB (1:1000) |
| Antibody | Anti-PNPO (rabbit polyclonal) | Thermo Fisher Scientific | Cat# PA5-26400, RRID: AB_2543900 | WB (1:1000) |
| Recombinant DNA reagent | pGEX-4T-1 (plasmid) | This paper | N-terminally GST-tagged, human PDXP |
|
| Recombinant DNA reagent | pET-SUMO (plasmid) | This paper | N-terminally His6-SUMO-tagged human PDXP |
|
| Recombinant DNA reagent | pET-M11 (plasmid) | EMBL Heidelberg | N-terminally His6-tagged, human SenP2 |
|
| Recombinant DNA reagent | pET-M11 (plasmid) | Jeanclos et al., 2022 | Murine HAD phosphatases (PDXP, PGP, LHPP, NT5C1A, NANP, PHOP2, PSPH, PNKP, MDP1) |
|
| Sequence-based reagent | Pdxp_F | This paper | PCR primers | TCGACCATGGCGCGCTGCGAGCGG |
| Sequence-based reagent | Pdxp_R | This paper | PCR primers | AAAAGTGAATTCTCAGTCCTCCAGCCCCTC |
| Sequence-based reagent | Pdxp-D14A_F | This paper | PCR primers | GCCCTGCGCGCCGTGCTGGGCCAGGCGCAG |
| Sequence-based reagent | Pdxp-D14A_R | This paper | PCR primers | GCCCAGCACGGCGCGCAGGGCCGCGCCGCG |
| Sequence-based reagent | Pdxp-N60A_F | This paper | PCR primers | TTCGTGAGCAACGCCAGCCGGCGCGCG |
| Sequence-based reagent | Pdxp-N60A_R | This paper | PCR primers | CGCGCGCCGGCTGGCGTTGCTCACGAA |
| Sequence-based reagent | Pdxp-N60S_F | This paper | PCR primers | TTCGTGAGCAACAGCAGCCGGCGCGCG |
| Sequence-based reagent | Pdxp-N60S_R | This paper | PCR primers | CGCGCGCCGGCTGCTGTTGCTCACGAA |
| Sequence-based reagent | Pdxp-R62A_F | This paper | PCR primers | AGCAACAACAGCGCGCGCGCGCGGCCC |
| Sequence-based reagent | Pdxp-R62A_R | This paper | PCR primers | GGGCCGCGCGCGCGCGCTGTTGTTGCT |
| Sequence-based reagent | Pdxp-Y146A_F | This paper | PCR primers | GTGCTCGTAGGCGCCGACGAGCAGTTT |
| Sequence-based reagent | Pdxp-Y146A_R | This paper | PCR primers | AAACTGCTCGTCGGCGCCTACGAGCAC |
| Sequence-based Reagent | Pdxp-E148A_F | This paper | PCR primers | GTAGGCTACGACGCGCAGTTTTCCTTC |
| Sequence-based reagent | Pdxp-E148A_R | This paper | PCR primers | GAAGGAAAACTGCGCGTCGTAGCCTAC |
| Sequence-based reagent | Pdxp-H178A_F | This paper | PCR primers | CGCGACCCTTGGGCCCCGCTCAGCGAC |
| Sequence-based reagent | Pdxp-H178A_R | This paper | PCR primers | GTCGCTGAGCGGGGCCCAAGGGTCGCG |
| Peptide, recombinant protein | Bovine brain calcineurin | Sigma-Aldrich | Cat# C1907 | PP2B |
| Peptide, recombinant protein | Phosphopeptide from PKA regulatory subunit type II | Sigma-Aldrich | Cat# 207008 | DLDVPIPGRFDRRVpSVAAE; PP2B substrate |
| Peptide, recombinant protein | Recombinant human PTP1B | Cayman Chemical | Cat# 10010896 | Amino acids 1–321 |
| Peptide, recombinant protein | EGFR phosphopeptide with Tyr992 autophosphorylation site | Santa Cruz Biotechnology | Cat# sc-3126 | DADEpYLIPQQG; PTP1B substrate |
| Peptide, recombinant protein | Calf intestinal alkaline phosphatase | NEB | Cat# M0525S | |
| Commercial assay or kit | EZ-Link NHS-PEG4-Biotin | Thermo Fisher | Cat# 21455 | |
| Chemical compound, drug | Flavone; 3,7-dihydroxyflavone; 5,7-dihydroxyflavone; 3,5,7-trihydroxyflavone; 5,6,7-trihydroxyflavone; 7,8-dihydroxyflavone | Sigma-Aldrich | Cat# F2003; Cat# 419826; Cat# 95082; Cat# 282200; Cat# 465119; Cat# D5446 | |
| Chemical compound, drug | 3,7,8,4’-Tetrahydroxyflavone | Ambinter | Cat# AMB30621919 | |
| Software, algorithm | Prism version 9.5.1 | GraphPad Prism | RRID: SCR_002798 | |
| Software, algorithm | OriginPro 2021b | OriginLab | RRID: SCR_014212 | |
| Other | Super Streptavidin Biosensors | Sartorius | Cat# 18-5057 | For biolayer interferometry experiments |