Skip to main content
Cell Death and Differentiation logoLink to Cell Death and Differentiation
. 2024 May 11;31(6):820–832. doi: 10.1038/s41418-024-01301-w

RIPK1 protects naive and regulatory T cells from TNFR1-induced apoptosis

Jelle Huysentruyt 1,2, Wolf Steels 1,2, Mario Ruiz Perez 1,2, Bruno Verstraeten 1,2, Mike Vadi 1,2, Tatyana Divert 1,2, Kayleigh Flies 1,2, Nozomi Takahashi 1,2, Bart N Lambrecht 3,4,5,6, Wim Declercq 1,2, Tom Vanden Berghe 1,2,7, Jonathan Maelfait 1,2, Peter Vandenabeele 1,2,, Peter Tougaard 1,2
PMCID: PMC11164875  PMID: 38734851

Abstract

The T cell population size is stringently controlled before, during, and after immune responses, as improper cell death regulation can result in autoimmunity and immunodeficiency. RIPK1 is an important regulator of peripheral T cell survival and homeostasis. However, whether different peripheral T cell subsets show a differential requirement for RIPK1 and which programmed cell death pathway they engage in vivo remains unclear. In this study, we demonstrate that conditional ablation of Ripk1 in conventional T cells (Ripk1ΔCD4) causes peripheral T cell lymphopenia, as witnessed by a profound loss of naive CD4+, naive CD8+, and FoxP3+ regulatory T cells. Interestingly, peripheral naive CD8+ T cells in Ripk1ΔCD4 mice appear to undergo a selective pressure to retain RIPK1 expression following activation. Mixed bone marrow chimeras revealed a competitive survival disadvantage for naive, effector, and memory T cells lacking RIPK1. Additionally, tamoxifen-induced deletion of RIPK1 in CD4-expressing cells in adult life confirmed the importance of RIPK1 in post-thymic survival of CD4+ T cells. Ripk1K45A mice showed no change in peripheral T cell subsets, demonstrating that the T cell lymphopenia was due to the scaffold function of RIPK1 rather than to its kinase activity. Enhanced numbers of Ripk1ΔCD4 naive T cells expressed the proliferation marker Ki-67+ despite the peripheral lymphopenia and single-cell RNA sequencing revealed T cell-specific transcriptomic alterations that were reverted by additional caspase-8 deficiency. Furthermore, Ripk1ΔCD4Casp8ΔCD4 and Ripk1ΔCD4Tnfr1−/− double-knockout mice rescued the peripheral T cell lymphopenia, revealing that RIPK1-deficient naive CD4+ and CD8+ cells and FoxP3+ regulatory T cells specifically die from TNF- and caspase-8-mediated apoptosis in vivo. Altogether, our findings emphasize the essential role of RIPK1 as a scaffold in maintaining the peripheral T cell compartment and preventing TNFR1-induced apoptosis.

Subject terms: Immunology, Cell biology

Introduction

Conventional T lymphocytes are considered naive until encountering their cognate antigen in the periphery, after which they differentiate into effector and memory T cells. T cell homeostasis is strictly regulated before, during, and after infection to maintain the population size and establish optimal responsiveness [1, 2]. The need for stringent regulation of cell death in T lymphocytes has been underscored by the discovery of mutations in apoptosis mediators resulting in defective immune responses. Deficiencies in the death receptor-mediated pathway of extrinsic apoptosis, such as mutations in Fas or FasL, have been associated with autoimmune lymphoproliferative syndrome (ALPS) in both humans [3, 4] and mice [5, 6] due to inefficient clearing of antigen-activated T cells. Downstream of death receptors, T cell-specific deletion of FADD or caspase-8 in young mice resulted in immunodeficiency due to proliferation defects rather than lymphoproliferative-like syndrome [7, 8]. This was later explained by an increased sensitivity of FADD- or caspase-8-deficient peripheral T cells to necroptosis [9, 10].

Receptor-Interacting Protein Kinase 1 (RIPK1) is a central mediator of inflammation and cell death downstream of TNF-receptor 1 (TNFR1). By default, RIPK1 acts as a scaffold for the recruitment of signaling partners involved in TNF-mediated NF-κB and MAPK activation and subsequent induction of genes involved in cell survival and inflammation [11]. Several kinase-mediated checkpoints keep RIPK1 in pro-survival mode and negatively affect kinase-dependent cell death [12]. RIPK1 becomes an active kinase when these checkpoints are bypassed and induces caspase-8-dependent apoptosis [13, 14]. Furthermore, upon caspase-8 inhibition, RIPK1 can initiate the execution of necroptosis [15]. Biallelic Ripk1 mutations in humans are associated with T cell dysbiosis and autoinflammatory syndromes [1618]. Patients carrying Ripk1 mutations rendering RIPK1 resistant to caspase-8 cleavage develop an autoinflammatory syndrome [19, 20]. Contrary to humans, whole-body RIPK1-deficient mice display postnatal lethality [21]. RIPK1-deficient fetal liver hematopoietic cells failed to reconstitute the peripheral T cell compartment in irradiated recipient mice [22]. Additionally, hematopoietic reconstitution experiments have shown that the reduction in RIPK1 deficient leukocyte populations in the bone marrow is restored by the administration of anti-TNF antibodies [23].

T cell-specific deletion of Ripk1 induced peripheral T cell lymphopenia [24, 25]. Moreover, loss of RIPK1 in T cells apparently results in a senescent phenotype associated with age-related features such as neurodegeneration, sarcopenia, and inflammation in the lungs, kidneys, and heart [25]. In vivo ablation of Ripk1 had no noticeable effect on the development of conventional TCRαβ+ T cell precursors in the thymus [26]. However, the effect of Ripk1-deficiency on peripheral T cell homeostasis remains unclear. Altogether, our data reveal that the RIPK1 scaffold function is required to protect peripheral naive and regulatory T cells from TNFR1- and Caspase-8-mediated apoptosis in vivo.

Results

RIPK1-deficiency in conventional T cells results in a vast loss of peripheral naive T cells and FoxP3+ Tregs

To investigate the role of RIPK1 in peripheral T lymphocytes, Ripk1fl/fl and Cd4-Cre mice were crossed to generate mice with a specific deletion of Ripk1 in conventional T cells (Ripk1ΔCD4). Similar to earlier observations [24, 26], we found no differences in total cell numbers or frequencies of immature CD4CD8 double-negative (DN) and CD4+CD8+ double positive DP thymocytes or mature CD4+ single-positive (SP) and CD8+ SP thymocytes (Figs. 1A, B, S1A). In contrast, the frequencies of CD4+ and CD8+ peripheral T cells were dramatically decreased in the spleen and mesenteric lymph nodes (mLN) of Ripk1ΔCD4 mice (Figs. 1A and S1B). Effector (CD62L-CD44high) and central memory (CD62L+CD44high) CD4+ and CD8+ T cells were reduced in the spleen and mLN, the decreased T cell numbers were primarily due to a loss of naive CD4+ and CD8+ T cells (CD62L+CD44low) (Figs. 1C and S1C).

Fig. 1. RIPK1-deficiency in conventional T cells results in a vast loss of peripheral naive T cells and FoxP3+ Tregs.

Fig. 1

A Flow cytometry plots of CD4 and CD8 expression in the thymus (upper) and spleen (lower) of Ripk1ΔCD4 mice and Ripk1FL/FL littermates representative of at least three independent experiments. Percentage are displayed of each quadrant. B Stacked bar plots showing CD4-CD8- double negative (DN), CD4+CD8+ double positive (DP), CD4+CD8- single positive (CD4+ SP) and CD4-CD8+ single positive (CD8+ SP) cells in the thymus from (n = 11) Ripk1ΔCD4 mice and (n = 13) Ripk1FL/FL littermates. C Stacked bar plots showing conventional CD4+ (left) and CD8+ (right) T cells, divided into naive (CD62L+CD44low), effector (CD62L-CD44high) and central memory (CD62L+CD44high) T cells in the spleen of (n = 7) Ripk1ΔCD4 mice and (n = 8) Ripk1FL/FL littermates. Ripk1indΔCD4 mice and Ripk1FL/FL littermates were treated with tamoxifen-containing food for ten weeks. Stacked bar plots showing (D) DN, DP, CD4+ SP, and CD8+ SP cells in the thymus from n = 3 mice per condition and (E) naive, effector, and central memory T cells within CD4+ (left) and CD8+ (right) populations in the spleen from (n = 3) Ripk1indΔCD4 mice and (n = 4) Ripk1FL/FL littermates. D, E are representative of three independent experiments. F Stacked bar plots showing naive, effector, and central memory T cells within CD4+ (left) and CD8+ (right) populations in the spleen from (n = 8) Ripk1ΔK45A mice and (n = 7) Ripk1+/+ littermates. Bar plots showing FoxP3+ regulatory T cells (Tregs) in the spleen (left) and mLN (right), (G) from (n = 7) Ripk1ΔCD4 mice and (n = 8) Ripk1FL/FL littermates and (H) from (n = 8) Ripk1ΔK45A mice and (n = 7) Ripk1+/+ littermates, and (I) from (n = 7) Ripk1ΔFoxP3 mice and (n = 8) Ripk1FL/FL littermates. I Data are representative of three independent experiments, or (C, F, G, H) combined from two, or (B) three independent experiments. BI Flow cytometry data are shown as mean ± sem, and (GI) each dot represents an individual mouse. Statistics: statistical significance was calculated by (GI) unpaired t-tests (two-sided) or (BF) Fisher’s LSD two-way ANOVA on Log2-transformed data. ns non-significant, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Ripk1ΔCD4 mice initially develop normally, while older animals displayed reduced body weight compared to Ripk1fl/fl littermates (Fig. S1D), as previously reported [25]. This report was performed on young adult mice (around 8–12 weeks-old) before any weight differences were observed (Fig. S1D). To determine whether the ablation of RIPK1 in fully developed mice would affect peripheral T cell survival in the same way as constitutive RIPK1 deletion in Ripk1ΔCD4, we crossed Ripk1fl/fl mice with tamoxifen-inducible Cd4-CreERT2 mice (Ripk1indΔCD4 mice). The numbers of different thymocyte populations in Ripk1indΔCD4 mice were compatible with Ripk1fl/fl littermates after tamoxifen treatment (Fig. 1D), confirming the normal thymopoiesis in the absence of RIPK1 [26] (Fig. 1B). However, similar to Ripk1ΔCD4 mice, we found a significant loss of peripheral naive, effector, and memory CD4+ T cells in the spleen of adult Ripk1indΔCD4 mice after 10 weeks of tamoxifen treatment (Fig. 1E), revealing the requirement of RIPK1 for the homeostasis of post-thymic CD4+ T cells. The peripheral CD8+ T cell numbers were unaffected (Fig. 1E), which could be due to its restriction to the Cd4-promotor and the incomplete penetrance of tamoxifen-inducible Cre-lines in T cells [27]. Analysis of naive CD4+ and CD8+ T cell numbers in the Ripk1 kinase-dead knock-in mice (Ripk1K45A) revealed that the scaffold function of RIPK1 is sufficient for peripheral T cell homeostasis and that RIPK1 kinase activity is not implicated (Figs. 1F and S1E).

Ripk1ΔCD4 mice also displayed decreased numbers of peripheral FoxP3+ regulatory T cells (Tregs) in the spleen and mLN of Ripk1ΔCD4 mice (Fig. 1G), while Ripk1K45A mice had comparable Treg numbers to wild-type littermates (Fig. 1H). Also here, RIPK1 is dispensable for thymic Treg development (Fig. S1F). Furthermore, Treg-specific Ripk1-deficient mice (Ripk1ΔFoxP3) also displayed reduced FoxP3+ Tregs in the spleen and mLN but expanded numbers of effector T cells (Figs. 1I and S1G, H). These results are in line with a recent report showing that the Ripk1ΔFoxP3 mice display reduced Treg percentages, eventually leading to fatal systemic autoimmunity [28]. Altogether, our results in Ripk1ΔCD4 mice show the essential role of RIPK1 scaffold function in the homeostasis of naive CD4+ and CD8+ T cells and FoxP3+ Treg cells and in preventing T cell lymphopenia.

Mixed bone marrow chimeras reveal a survival disadvantage for peripheral RIPK1-deficient T cells

In Ripk1ΔCD4 mice, the floxed Ripk1 gene is excised upon Cd4 promotor-controlled Cre recombinase expression. Western blot analysis revealed that peripheral naive CD4+ T cells in Ripk1ΔCD4 mice were RIPK1-deficient. In contrast, CD4+ effector and central memory (CD44high) T cells exhibited residual RIPK1 expression (Fig. 2A). Moreover, some RIPK1 protein was also detected in naive CD8+ T cells from Ripk1ΔCD4 mice, while the RIPK1 protein levels in CD44high T cells were only slightly lower than Ripk1fl/fl littermates (Fig. 2A). We then sorted naive CD4+ and CD8+ T cells and stimulated them in vitro with anti-CD3 and anti-CD28 antibodies. The CD4+ T cells remained RIPK1 deficient before and after stimulation, while naive CD8+ T cells exhibited elevated RIPK1 protein levels following anti-CD3/CD28 stimulation. This suggests that some CD8+ T cells escapes LoxP recombination and undergo a selective pressure to retain RIPK1 expression following TCR stimulation (Fig. 2B). To further test the survival of Ripk1ΔCD4-derived cells in a competitive environment with wild-type T lymphocytes, we generated mixed bone marrow chimeras. Irradiated CD45.1 recipient mice received bone marrow cells from heterozygous CD45.1/2 allele donors combined with an equal amount of either Ripk1fl/fl or Ripk1ΔCD4 bone marrow cells (Fig. 2C). Twelve weeks post bone marrow reconstitution, we found that Ripk1ΔCD4-derived bone marrow cells largely failed to reconstitute CD4+ and CD8+ naive, effector and central memory T cells, as well as FoxP3+ Tregs, in the spleen, mLN and blood (Figs. 2D, E, and S2). However, the Ripk1ΔCD4 bone marrow cells could still reconstitute B cells and unconventional TCRγδ+ T cells (Figs. 2D, E, and S2A). These findings demonstrate that Cd4 promotor-driven Ripk1-deficiency result in a competitive survival disadvantage of conventional CD4+ and CD8+ T cells and FoxP3+ Tregs compared to wild-type T cells.

Fig. 2. Mixed bone marrow chimeras reveal a survival disadvantage for peripheral RIPK1-deficient T cells.

Fig. 2

A, B Western blot analysis of RIPK1 protein levels was performed on CD4+ and CD8+ T cells, purified by cell sorting from the spleen and lymph nodes of Ripk1ΔCD4 mice and Ripk1FL/FL littermates. A Total, naive and CD44high, B naive T cells, before or after 72 h of stimulation with anti-CD3ε and anti-CD28 antibodies in the presence of IL-2. The following gating strategies were applied: total T cells (live, CD4+ or CD8+), naive T cells (live, CD4+ or CD8+, CD25-, CD62L+ CD44low) and CD44high T cells (live, CD4+ or CD8+, CD62L CD44high). C Graphical representation of the mixed bone marrow (BM) chimera setup. CD45.1 recipient mice were sub-lethally irradiated and transfused with a 1:1 mixture of bone marrow cells derived from CD45.1/2 heterozygous wild-type mice and either Ripk1ΔCD4 or littermate Ripk1FL/FL mice (both CD45.2). Bars depicting ratios of CD45.2 to CD45.1/2 from mixed BM chimeras, showing B cells, TCRγδ+ T cells, naive, effector, and central memory (CM) CD4+ and CD8+ T cells, and FoxP3+ Tregs isolated from the (D) spleen and (E) mLN. A ratio of 1 indicates that the specific cell subset was reconstituted equally by the bone marrow cells of both donors. Data are representative of (B) two, or (A) three independent experiments. D, E Flow cytometry data are combined from two independent experiments with n = 6 mice per group shown as mean ± sem, with each dot representing an individual mouse. Statistics: D, E Statistical significance was calculated by Fisher’s LSD two-way ANOVA on Log2-transformed data. ns = non-significant, ****p < 0.0001.

RIPK1 is essential for survival of naive T cells in a caspase-8-dependent manner

To examine whether the induction of extrinsic apoptosis affects the survival of RIPK1 deficient T cells, we created mice with a T cell-specific deletion of both Ripk1 and Casp8 (Ripk1ΔCD4Casp8ΔCD4). Similar as in Ripk1ΔCD4 mice (Fig. 1A, B), no significant differences were found in percentages and numbers of the different thymic subsets between Ripk1ΔCD4Casp8ΔCD4 mice and Ripk1fl/flCasp8fl/fl littermates (Figs. 3A, and S3A, B), excluding a role for caspase-8. Genetic removal of Casp8 in Ripk1-deficient T cells resulted in comparable percentages and total numbers of both CD4+ and CD8+ peripheral T cells in spleen and mLN similar to littermate controls (Figs. 3A, B, S3C, D, and Table S1). Suggesting that RIPK1 deficient T cells die by caspase-8-mediated apoptosis in the periphery. Additionally, while CD8+ naive and central memory T cell numbers were restored in Ripk1ΔCD4Casp8ΔCD4 mice, increased numbers of CD8+ effector T cells were observed in both spleen and mLN compared to littermate controls (Figs. 3B and S3D). In addition, the total number of FoxP3+ Tregs were likewise rescued in both spleen and mLN of Ripk1ΔCD4Casp8ΔCD4 mice (Fig. 3C). Western blot analysis revealed that in thymic subsets, Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4 mice exhibit similar efficiency in Cre-mediated Ripk1 ablation. DP Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4 thymocytes showed some residual RIPK1 and caspase-8 protein expression, whereas SP-CD4+ or SP-CD8+ thymocytes displayed potent RIPK1 and caspase-8 deletion (Fig. 3D). Similarly, RIPK1 and caspase-8 protein levels were undetectable in peripheral CD4+ and CD8+ T cells from Ripk1ΔCD4Casp8ΔCD4 mice (Fig. 3D). Indeed, enhanced caspase-8 cleavage could be observed in peripheral naive CD4+ Ripk1ΔCD4 T cells (Fig. S3E). Altogether, these data demonstrate that peripheral T cell lymphopenia due to the absence of RIPK1 scaffold function is caused by caspase-8-mediated apoptosis.

Fig. 3. RIPK1 is essential for survival of naive T cells in a caspase-8-dependent manner.

Fig. 3

A Flow cytometry plots of CD4 and CD8 expression in the thymus, spleen, and mLN of Ripk1ΔCD4Casp8ΔCD4 mice and Ripk1FL/FLCasp8FL/FL littermates representative of at least three independent experiments. Percentage are displayed of each quadrant. B Stacked bar plots showing naive, effector and central memory T cells within CD4+ (left) and CD8+ (right) populations in the spleen of (n = 3) Ripk1ΔCD4 (KO) and (n = 4) Ripk1ΔCD4Casp8ΔCD4 (DKO) mice and (n = 4) for each of their respective Ripk1FL/FL and Ripk1FL/FLCasp8FL/FL littermates. Data are shown as mean ± sem, and statistical differences are indicated in Table S1. C FoxP3+ regulatory T cells (Tregs) in the spleen (left) and mLN (right) of Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4 mice and their respective Ripk1FL/FL and Ripk1FL/FLCasp8FL/FL littermates. Data are representative of three independent experiments and shown for n = 4 mice per group. (D, upper panels) Western blot analysis of RIPK1 and caspase-8 protein levels was performed on (Upper) CD4+CD8+ double positive (DP), CD4+ single positive and CD8+ single positive thymocytes, purified by cell sorting from the thymus of Ripk1ΔCD4 mice, Ripk1FL/FL littermates and Ripk1ΔCD4Casp8ΔCD4 mice. The following gating strategies were applied: DP (live, CD3-CD4+CD8+TCR-), CD4+ (live, Lin CD3+ CD4+CD8 TCRβ+), and CD8+ (live, Lin- CD3+ CD4CD8+ TCRβ+). (D, lower panel) Western blot analysis performed on peripheral CD4+ and CD8+ T cells (naive and CD44high), purified cell sorting from the combined spleens and lymph nodes of Ripk1ΔCD4 mice, Ripk1FL/FL littermates and Ripk1ΔCD4Casp8ΔCD4 mice. The following gating strategies were applied: naive T cells (live, CD4+ or CD8+, CD25-, CD62L+ CD44low) and CD44high T cells (live, CD4+ or CD8+, CD62L CD44high). E Cells were isolated from the mLN of Ripk1ΔCD4 (n = 3) mice, Ripk1ΔCD4Casp8ΔCD4 (n = 3) mice and their respective Ripk1FL/FL (n = 3) and Ripk1FL/FLCasp8FL/FL (n = 2) littermates and subjected to single-cell RNA sequencing (scRNA-seq). Clusters of CD4+ and CD8+ T cells, TCRγδ+ T cells, B cells, proliferating cells, and myeloid cells were identified (Fig. S3F) and presented in a Uniform Manifold Approximation and Projection (UMAP) plot. F Principal component analysis (PCA) showing the average gene expression in CD4+ naive T cells (Cluster 1) for the individual Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4 mice and their respective Ripk1FL/FL and Ripk1FL/FLCasp8FL/FL littermates. G Volcano plots representing the differentially expressed (DE)-genes in the cluster of CD4+ naive T cells (C1) of Ripk1ΔCD4 mice compared to Ripk1FL/FL littermates (left), Ripk1ΔCD4 mice compared to Ripk1ΔCD4Casp8ΔCD4 mice (middle) or Ripk1ΔCD4Casp8ΔCD4 mice compared to Ripk1FL/FLCasp8FL/FL littermates (right). Significance (-Log10 of the p-value) is indicated on the y-axis and Log2 of the fold-change in gene expression is indicated on the x-axis. Data are representative of (D) two, (A) three, or (B) four independent experiments. Statistics: statistical significance was calculated by (D) Fisher’s LSD one-way ANOVA. ns = non-significant, *p < 0.05, **p < 0.01, ***p < 0.001.

RIPK1-deficient T cells display transcriptome adaptations that are reverted by additional Casp8 gene deletion

To explore how the loss of RIPK1 affected T cell function and how the absence of caspase-8 regulated the survival of RIPK1 deficient T cells, we performed single-cell RNA sequencing (scRNA-seq) on cells isolated from the mLN and enriched for T cells from Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4 mice along with their respective littermate controls. Based on cell-specific annotation markers (Fig. S3F), we identified different CD4+ and CD8+ T cell subsets among the different immune subsets (Figs. 3E and S3F). As naive CD4+ T cells were consistently RIPK1 deficient in both Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4 mice, we focused the scRNA-seq analysis on this cluster (Fig. 3E). Principle component analysis (PCA) of average gene expression in naive CD4+ T cells revealed a significant variation between Ripk1ΔCD4 mice and Ripk1fl/fl littermates (Fig. 3F). Interestingly, in naive CD4+ T cells no variation was observed between Ripk1ΔCD4Casp8ΔCD4 mice and littermate controls (Fig. 3F), indicating an overall transcriptional rescue of the Ripk1ΔCD4 phenotype by Casp8-deficiency. Volcano plots of the differentially expressed (DE) genes revealed that naive CD4+ T cells from Ripk1ΔCD4 mice and Ripk1ΔCD4Casp8ΔCD4 mice had almost identical DE genes as Ripk1ΔCD4 mice and Ripk1fl/fl littermates (Fig. 3G, left and middle panels). Indeed, surprisingly few transcriptional differences were observed between double-deficient Ripk1ΔCD4Casp8ΔCD4 and wild-type littermates (Fig. 3G, right panel). Interestingly, Il7r and Bcl2 were two of the most prominent DE genes, with Il7r expression being decreased and Bcl2 expression being increased in Ripk1ΔCD4 mice. The B cell/plasma cell markers Igkc and Cd74 were upregulated in all examined immune cell populations of Ripk1ΔCD4 mice (Figs. 3G, and S4A, B), showing that their upregulation is not limited to T cells. PCA plots of the B cell/plasma cell cluster further revealed no transcriptomic differences or alterations in the pan-B cell marker Cd19 between genotypes (Figs. S4C, D). Conversely, similar to RIPK1-deficient naive CD4+ T cells, PCAs revealed transcriptomic alterations in all identified CD4+ and CD8+ T cell clusters between Ripk1ΔCD4 mice and wild-type littermates, which were reverted by additional caspase-8 deletion (Fig. S4D). These results show a complete cellular and transcriptional rescue of the Ripk1ΔCD4 T cell phenotypes by additional caspase-8 deletion.

RIPK1-deficient naive T cells proliferate but die following activation due to extrinsic caspase-8-dependent apoptosis

The T cell lymphopenic phenotype observed in the Ripk1ΔCD4 mice could indicate defective homeostatic proliferation. However, despite dramatically reduced absolute numbers of naive peripheral T cells, we observed increased amounts and frequencies of Ki-67+ naive CD4+ T cells in the mLN of Ripk1ΔCD4 mice compared to Ripk1fl/fl littermates (Figs. 4A and S4E). The increased Ki-67+ expression suggests the occurrence of enhanced proliferation as a compensatory mechanism to replenish the T cell numbers following severe T cell lymphopenia [29]. This phenomenon does not happen in Ripk1ΔCD4Casp8ΔCD4 mice, revealing a restoration of the proliferation phenotype by the absence of the Casp8 gene (Figs. 4A and S4E). We depicted the top-20 DE genes based on the Log2 fold-change in expression (Figs. 4B, C, S4F). As naive T cells depend on IL-7 signaling for survival [30], and BCL-2 limits mitochondrial apoptosis, we further investigated anti-apoptotic Bcl2 family members and IL-7Rα regulators. Of the Bcl2 family members, only the anti-apoptotic Bcl2 and Mcl1 were enhanced in Ripk1ΔCD4 mice, while the pro-apoptotic Bcl2 family members remained unchanged (Fig. 4B). Similarly, the expression of key IL-7Rα regulators (Foxo1, Runx1, Gabpa, Gfi1, Klf2, Ets1 and Spi1) remained unchanged in naive CD4+ T cells of Ripk1ΔCD4 mice (Fig. 4B), suggesting that the Il7r downregulation is not caused by altered expression of these transcription factors. Additionally, we validated the reduced IL-7Rα surface expression and increased BCL-2 protein levels in naive CD4+ T cells by flow cytometry in Ripk1ΔCD4 mice (Fig. 4D). Measuring the effect of IL-7 stimulation on RIPK1 deficient T cell survival shows that even at higher IL-7 concentrations RIPK1 deficiency resulted in reduced survival responses, which was entirely rescued in the Ripk1ΔCD4Casp8ΔCD4 mice (Figs. 4E and S4G). Furthermore, despite reduced numbers of Ripk1ΔCD4 naive CD4+ T cells in bone marrow chimeras (Fig. 2D, E), their IL-7Rα expression was restored in the presence of wild-type cells, indicating this reduction is be induced by the environment (Fig. 4F, G).

Fig. 4. RIPK1-deficient naive T cells proliferate but die following activation due to extrinsic caspase-8-dependent apoptosis.

Fig. 4

A Bar plots showing percentages (left) and absolute numbers (right) of Ki-67+ cells within the population of CD4+ naive T cells in the mLN of (n = 7) Ripk1ΔCD4 mice and (n = 8) Ripk1ΔCD4Casp8ΔCD4 mice, compared with (n = 9) Ripk1FL/FL and (n = 8) Ripk1FL/FLCasp8FL/FL littermates. Results are combined from two independent experiments. B Heatmaps displaying the relative average expression levels of the top-20 DE genes (left) and curated genes (right) in CD4+ naive T cells (Cluster 1, Fig. 4C) of Ripk1ΔCD4Casp8ΔCD4 (n = 3) mice and their respective Ripk1FL/FL (n = 3) and Ripk1FL/FLCasp8FL/FL (n = 2) littermates. Average gene expression shown as Log2 Fold-change (FC) is indicated for each genotype in columns, and rows represent individual genes. C UMAP plot indicating the clusters of CD4+ naive (Cluster 1, cyan) and CD8+ naive (Cluster 6, red) T cells separated over the four different genotypes. D Bar graphs indicating protein levels of surface IL-7Rα (left) and intracellular BCL-2 (right), represented as the mean fluorescent intensity (MFI), in CD4+ naive T cells isolated from the mLN. Data are representative of (D-left) three independent experiments with n = 3 mice per group, (D-right) one experiment with n = 3 mice per group. E CD4+ naive T cells were purified from the spleen and lymph nodes by cell sorting and stimulated during 72 h with different concentrations of IL-7. Cell death was determined by flow cytometry and represented as the percentage of dead cells within the CD4+ T cell population. Data are combined from n = 6 (Ripk1FL/FL), or n = 3 (Ripk1ΔCD4 and Ripk1ΔCD4Casp8ΔCD4) biological replicates. F Graphical representation of the mixed bone marrow (BM) chimera setup. G Bar graphs indicating surface protein levels of IL-7Rα, represented as the mean fluorescent intensity (MFI), in CD4+ naive T cells from the spleen of mixed bone marrow chimera mice. Data are pooled from three independent experiments with n = 11 mice. H, I CD4+ naive T cells were purified from the spleen and mLN by cell sorting, labeled with CellTrace Violet, and stimulated for 72 h with anti-CD3ε and anti-CD28 antibodies in the presence of IL-2. H Representative proliferation plots of CD4+ T cells is shown by the reduction in CellTrace Violet staining for each division. I Percentages of dead CD4+ T cells were determined in every independent experiment by flow cytometry after 72 h. Data are combined from (I-right) n = 3 or (I-left) n = 4 independent biological experiments. J, K CD4+ naive T cells were purified from the spleen and lymph nodes by cell sorting, pre-treated with different combinations of cycloheximide (CHX), BV6, or zVAD for 30 min at 37 °C and 5% CO2, and subsequently stimulated with ABT-737 or TNF for 20 h. Cell death was determined by flow cytometry and represented as the percentage of dead cells within the naive CD4+ T cell population based on fixable viability dye (FvD) staining. J, K Data are combined from two independent experiments with n = 4 biological replicates or n = 2 in the (J; zVAD) condition and n = 2 in the (K; CHX + TNF + BV6 + zVAD) condition. A, D, GK Flow cytometry data are shown as (A, D, G, I) mean ± sem, or (E, J, K) mean ± SD, and each dot (E) represents the mean, or (A, D, G, I) or an individual mouse or biological replicate. Statistics: Statistical significance was calculated by (A, D, G) Fisher’s LSD one-way ANOVA on absolute values or (A) Log2-transformed data, (I) unpaired t-test (two-sided) on absolute values or (E, J, K) Fisher’s LSD two-way ANOVA on absolute values. ns = non-significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Anti-CD3/CD28 stimulation of naive CD4+ and CD8+ T cells showed that Ripk1ΔCD4 cells were capable of proliferating but displayed enhanced cell death following the TCR stimulation (Figs. 4H, I, S4H, S4I). Previously, T cells from Casp8ΔCD4 mice were reported to display enhanced RIPK1-dependent necroptosis in response to anti-CD3/CD28 stimulation [31]. However, both the enhanced cell death and proliferative capabilities were the same between cells from Ripk1ΔCD4Casp8ΔCD4 mice and their wild-type littermates (Fig. 4H, I), showing a complete rescue of the anti-CD3/CD28 induced cell death in Ripk1ΔCD4 T cells by additional Casp8 deletion. Similarly, the spontaneous cell death of cultured naive CD4+ T cells from Ripk1ΔCD4 mice could be rescued by the addition of caspase-inhibitor zVAD-fmk alone (Fig. 4J). Whereas, naive CD4+ T cells from Ripk1ΔCD4Casp8ΔCD4 mice were not protected from ABT-737-triggered mitochondrial apoptosis (Fig. 4J), confirming intrinsic apoptosis to be caspase-8 independent in T cells. Accordingly, we found that naive CD4+ T cells from Ripk1ΔCD4 mice were more sensitive to TNF-mediated cell death both in the presence and absence of the Smac mimetic BV6 (Fig. 4K), showing that Ripk1 gene ablation leads to enhanced TNF-induced extrinsic apoptosis [32, 33]. The addition of zVAD-fmk rescued this, and no enhanced cell death was observed in any condition with Ripk1ΔCD4Casp8ΔCD4 cells (Fig. 4K). Combined, these data confirm that the enhanced cell death in naive CD4+ T cells from Ripk1ΔCD4 mice is mediated by caspase-8-dependent apoptosis, possibly through TNF engagement.

Naive T cells and FoxP3+ Tregs require RIPK1 for protection from TNFR1-induced apoptosis

We blocked endogenous TNF in Ripk1ΔCD4 mice to follow up on this finding and since in vivo anti-TNF blockade was reported to restore hematopoietic reconstituted RIPK1-deficient T cells in the bone marrow [23]. TNF blockade by administration of anti-TNF antibodies every 3–4 days during two weeks increased the absolute numbers of naive, effector and central memory CD4+ T cells and naive CD8+ T cells in both spleen and mLN, while no difference was observed in Ripk1fl/fl littermates (Figs. 5A, B and S5A, B). Furthermore, Treg numbers were not significantly increased, showing them to be less affected by short time anti-TNF treatment than conventional CD4+ and CD8+ T cell numbers (Fig. 5C).

Fig. 5. Naive T cells and FoxP3+ Tregs require RIPK1 for protection from TNFR1-induced apoptosis.

Fig. 5

A, B Ripk1ΔCD4 mice and Ripk1FL/FL littermates were treated with anti-TNF-α antibodies or isotype control every 3–4 days for two weeks. Total numbers of (A-left) CD4+ or (B-left) CD8+ T cells and stacked bar plots divided into naive (CD62L+CD44low), effector (CD62LCD44high), and central memory (CD62L+CD44high) (A-right) CD4+ and (B-right) CD8+ T cells in the mLN. Data are combined from two independent experiments with n = 8 in the Ripk1FL/FL (Isotype) and Ripk1ΔCD4 (α-TNF) groups and n = 9 mice in the Ripk1ΔCD4 (Isotype) and Ripk1FL/FL (α-TNF) groups. C FoxP3+ regulatory T cells (Tregs) in the spleen (left) and mLN (right) of Ripk1ΔCD4 mice and Ripk1FL/FL littermates treated with anti-TNF-α antibodies or isotype control. Data are combined from two independent experiments with n = 8 mice per group. D CD4+ naive T cells were purified by cell sorting from the spleen and lymph nodes of Ripk1ΔCD4 mice, Ripk1FL/FL littermates, and Ripk1ΔCD4Casp8ΔCD4 mice, and pre-treated with cycloheximide and stimulated during 20 h with mTNF or hTNF. Cell death was determined by flow cytometry and represented as the percentage of dead cells within the CD4+ T cell population. Data are combined and shown for n = 3 independent biological experiments. E FoxP3+ regulatory T cells (Tregs) in the spleen (n = 6) and mLN (n = 3) of Ripk1ΔCD4 and Ripk1ΔCD4TNFR1−/− mice and their respective Ripk1FL/FL and Ripk1FL/FLTNFR1−/− littermates. Data are representative of two independent experiments. F Stacked bar plots showing naive, effector, and central memory T cells within CD4+ (left) and CD8+ (right) populations in the mLN of Ripk1ΔCD4 and Ripk1ΔCD4TNFR1−/− mice and their respective Ripk1FL/FL and Ripk1FL/FLTNFR1−/− littermates. Data are representative of two independent experiments and shown for n = 3 mice per group. Statistical data for each population is shown in Table S2. AF Flow cytometry data are shown as mean ± sem, and AE each dot representing an individual mouse or (D) the average of technical replicates in an independent experiment. Statistics: Statistical significance was calculated by (C) unpaired t-tests (two-sided), or (D) Fisher’s LSD two-way ANOVA on absolute values, or (E) Fisher’s LSD one-way ANOVA, or (A, B, F) Log2-transformed data. ns = non-significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Murine TNF (mTNF) engages both TNFR1 and TNFR2, while human TNF (hTNF) is a specific agonist for murine TNFR1 [34]. While the numbers of SP thymocytes were unchanged in Ripk1ΔCD4 mice (Fig. 1B), exposure to mTNF and hTNF of both thymic (Fig. S5C) and peripheral naive CD4 T cells (Fig. 5D) resulted in increased cell death. Additional deletion of caspase-8 rescued this phenotype (Figs. 5D, S5C). This indicates that Ripk1-deficiency sensitizes both CD4+ thymocytes and peripheral naive CD4+ T cells to TNFR1-induced, caspase-8-dependent extrinsic apoptosis.

Therefore, we generated mice with an additional deletion of TNFR1 (Ripk1ΔCD4TNFR1−/−) to determine the in vivo contribution of TNFR1-mediated apoptosis to the T cell lymphopenia of Ripk1ΔCD4 mice. In line with our previous data from Ripk1ΔCD4Casp8ΔCD4 mice, the reduced numbers of FoxP3+ Tregs naive, effector, and central memory CD4+ and CD8+ T cells in Ripk1ΔCD4 mice were rescued by additional deletion of TNFR1 in both spleen and mLN (Figs. 5E, F S5D, and Table S2). These results demonstrate that the peripheral T cell lymphopenia in Ripk1ΔCD4 mice can be attributed to an increased sensitivity of RIPK1-deficient T cells to caspase-8 and TNFR1-mediated apoptosis.

Discussion

Peripheral T cell homeostasis demands an exact balance between T cell survival and cell death at the different stages of T cell maturation to ensure an appropriate immune response and remove the effector T cells after clonal expansion [35, 36]. RIPK1 deficiency was previously reported to result in the loss of peripheral T cells [24, 25], but there is limited knowledge on the requirement of RIPK1 in different peripheral T cell populations. We found that Ripk1ΔCD4 mice display severe peripheral T cell lymphopenia, which is primarily mediated by a loss of naive CD4+ and CD8+ T cells, though cell numbers in the thymus were not reduced. The latter confirms previous reports that despite thymic expression of RIPK1, normal thymopoiesis occurs in the absence of RIPK1 [26]. Interestingly, unlike Ripk1Cd4-cre mice, early hematopoiesis in the thymus and bone marrow was abrogated in Ripk1iVav-cre mice and rescued with additional Mlkl deficiency [37]. These data indicate that RIPK1-deficient hematopoietic stem cells are more susceptible to IFNγ and ZBP1-dependent necroptosis in the bone marrow and thymus. In contrast, splenic CD4 and CD8 T cells from Ripk1iVav-cre mice were not rescued by additional MLKL deficiency [37], which supports our findings that peripheral RIPK1-deficient T cells undergo TNFR1-dependent apoptosis.

In mice the peripheral naive T cell pool primarily maintains its numbers by a continuous replenishment from the thymus, although lymphopenia can enhance peripheral homeostatic proliferation [29, 38, 39]. Western blots revealed that low amounts of RIPK1 remain expressed in the DP thymocytes from Ripk1ΔCD4 mice, which is consistent with previous reports on Cd4-Cre line’s activation profile at the DP stage [40]. Nevertheless, SP-CD4 and SP-CD8 thymocytes and peripheral naive CD4 T cells displayed effective RIPK1 deletion. Contrary to thymic SP-CD8 cells, peripheral naive CD8+ T cells expressed low amounts of RIPK1. However, following in vitro anti-CD3/CD28 stimulation, the CD8+ T cells displayed RIPK1 levels comparable with those in wild-type, indicating a selective pressure to retain RIPK1 expression to survive following activation. Despite the incomplete deletion of RIPK1 in the remaining peripheral CD8+ T cells, the CD8+ T cell compartment was widely reduced in Ripk1ΔCD4 mice. Similarly, Ripk1ΔCD4-derived bone marrow cells failed to reconstitute any population of conventional naive, effector, and central memory CD4+ and CD8+ T cells or Tregs in the presence of wild-type cells, demonstrating a competitive survival disadvantage of these RIPK1-deficient T cell subsets.

Kinase-dead Ripk1K45A mice did not display any change in total T cell numbers, confirming earlier findings [24]. Further subset analysis clarified that the RIPK1 scaffold function, rather than the kinase activity, is crucial for the steady state homeostasis of peripheral naive, effector, or central memory CD4+ and CD8+ T cells. In addition, we found that peripheral FoxP3+ Tregs also depend on the RIPK1-scaffold function to avoid caspase-8 mediated apoptosis, while RIPK1 deficiency did not affect the numbers of thymic FoxP3+ Tregs.

In order to identify the mechanism of cell death implicated in the T cell lymphopenia, we showed that additional caspase-8 deletion in Ripk1ΔCD4Casp8ΔCD4 mice resulted in a complete restoration of the T cell numbers with similar single-cell transcriptomic profiles as wild-type littermates. Upon in vitro anti-CD3/CD28 stimulation, naive CD4+ T cells from Ripk1ΔCD4Casp8ΔCD4 mice proliferate and die to the same extent as wild-type littermates. Because the absence of caspase-8 sensitizes T cells to RIPK1-dependent necroptosis [8, 10, 31], the additional loss of RIPK1 seems to completely block the switch to necroptosis in T cells of Ripk1ΔCD4Casp8ΔCD4 mice. This indicates that the absence of both RIPK1 and caspase-8 rescues each other’s T cell phenotypes and implies that at steady state, neither T cell development nor peripheral T cell homeostasis requires RIPK1 or caspase-8 as long as both are deleted. At steady-state, percentages and numbers of Ripk1/Casp8 double-deficient T cell populations are similar as wild-type T cells. However, whether the absence of both genes still allows for an appropriate T-cell response during infection in vivo remains to be explored.

We found that the increased apoptosis of peripheral T cells in Ripk1ΔCD4 mice was associated with enhanced markers of proliferation in the naive T cells, likely constituting a form of lymphopenia-induced proliferation [29, 38]. This compensatory proliferation was associated with decreased expression of IL-7Rα and IL-7 responsiveness in naive CD4+ cells from Ripk1ΔCD4 mice, which was reverted in Ripk1ΔCD4Casp8ΔCD4 mice. Two recent studies showed that T cell-specific RIPK1-deficient mice display characteristics of senescent cells and that this is associated with the development of age-related inflammatory diseases in mostly 7–12 months-old mice [25, 41]. While one study reported that the age-related pathologies were FADD-dependent [41], the other study showed that it was associated with increased mTOR activity [25]. However, transferring RIPK1-deficient T cells into a wild-type environment partially reduced the hyperactive mTOR phenotype, suggesting that the enhanced mTOR activity is a cell-extrinsic effect of RIPK1-deficiency [25]. In light of the cellular rescue by additional caspase-8 deletion, the reported senescent T cell phenotype following RIPK1 deficiency [25] may be caused by the lymphopenia-induced dysbalance leading to age-related sequelae.

By use of several mouse models, we show that the RIPK1 scaffold function protects naive, effector and central memory CD4+ and CD8+ T cells, as well as FoxP3+ regulatory T cells, from caspase-8-mediated apoptosis in vivo. Moreover, Ripk1-deficient naive CD4+ T cells display an increased sensitivity to TNFR1-induced apoptosis following TNF stimulation in vitro. TNF has previously been implicated in the death of RIPK1-deficient T cells in the bone marrow during hematopoietic reconstitution experiments [23]. Accordingly, specific deletion of TNFR1 in Ripk1ΔCD4Tnfr1−/− mice revealed that naive T cells and FoxP3+ Tregs require RIPK1 to avoid TNFR1-induced apoptosis in vivo. These findings provide novel insights into T cell survival mechanisms and emphasize the essential role of the RIPK1 in peripheral T cell homeostasis of not only FoxP3+ Tregs but also conventional naive, effector, and memory T cells and, could provide important insights for therapeutic targeting of RIPK1 in T cell-driven diseases.

Materials and methods

Mice

Conditional Ripk1 mice (Ripk1FL/FL) were generated in-house as described before [27]. Cd4-Cre transgenic mice were generated as described before [35]. T-cell-specific Ripk1-knockout mice (Ripk1ΔCD4) were created by crossing Ripk1FL/FL mice with Cd4-Cre transgenic mice. Mice were bred by crossing heterozygous parents (Ripk1FL/+ Cd4-CreTg/+) with Ripk1FL/FL mice. Ripk1FL/+ Cd4-Cre+/+ and Ripk1FL/FL Cd4-Cre+/+ mice were used as littermate controls. Tamoxifen-inducible T cell specific Ripk1-knockout mice (Ripk1indΔCD4) were created by crossing Ripk1FL/FL mice with Cd4-Cre-ERT2 transgenic mice (Jackson Laboratory, Bar Harbor, ME, USA). For in vivo Ripk1 deletion, Ripk1indΔCD4 mice were injected intraperitoneally three consecutive days with 1 mg tamoxifen (T5648, Sigma-Aldrich, Burlington, MA, USA) dissolved in corn oil (C8267, Sigma-Aldrich) followed by a single injection every 2 weeks during 10 weeks before being used for experiments. Alternatively, the mice were fed with a tamoxifen-containing diet (TD.55125.I 400 mg/kg, Envigo, Indianapolis, IN, USA) during 10 weeks. RIPK1 kinase-dead knock-in mice (Ripk1K45A) were described before [36] and purchased from GlaxoSmithKline (GSK, London, UK). FoxP3-Cre transgenic mice were kindly provided by Prof. Dr. Bart Lambrecht (Ghent University, Belgium). Treg-specific Ripk1-knockout mice (Ripk1ΔFoxP3) were created by crossing Ripk1FL/FL with FoxP3-Cre transgenic mice. CD45.1 and CD45.1/2 mice were from the Jackson Laboratory. Conditional Casp8 mice (Casp8FL/FL) were described before [37]. T cell-specific Ripk1- and Casp8-double knockout mice (Ripk1ΔCD4Casp8ΔCD4) were created by crossing Casp8FL/FL mice with Ripk1FL/+ Cd4-CreTg/+ mice. TNFR1-deficient mice (Tnfr1−/−) were described before [38]. Full-body Tnfr1-deficient and T cell-specific Ripk1-deficient mice were created by crossing Tnfr1−/− mice with Ripk1FL/+ Cd4-CreTg/+ mice. All mice were bred and housed in individually ventilated cages at the VIB Center for Inflammation Research under specific pathogen-free (SPF) conditions in a temperature-controlled (21 °C) animal facility with a 14/10-h light/dark cycle. Water and food were provided ad libitum. Mice were used for experiments at an age of 8–12 weeks unless otherwise specified. Researchers were not blinded. Within each genotype, mice were randomly assigned to anti-TNF or isotype control groups. Irradiated mice were randomly assigned to the individual bone marrow chimera groups. Effect size and sample size calculation was performed using G*power 3.1.9.7. software with an α-error of 0.05 and a power of 95%. The number of mice (n) for each experiment is reported in the figure legends. Both male and female mice were used for all the experiments. Only male Treg-specific Ripk1-knockout mice (Ripk1ΔFoxP3) were used as the transgene in these mice is located on the X-chromosome and suffers from X-chromosome inactivation in female mice. For in vivo neutralization of TNF-α, mice received doses of anti-TNF-α (MP6-XT22, Biolegend, San Diego, CA, USA) or IgG isotype control (RTK2071, Biolegend) every 3–4 days during 2 weeks by intraperitoneal injection (4 µg/g body weight). Afterwards, cells were collected as described below and T cell numbers were measured by flow cytometry.

All experiments on mice were conducted in accordance with the Declaration of Helsinki and approved by the IRC-UGent ethical committee under the reference numbers (EC2020-045 and EC2022-078).

Genotyping

Genotyping of the different mouse lines was performed by PCR. Wild type and loxP-site flanked Ripk1 alleles were identified using the following PCR primers: 5′-GGCAAACACCTTTAATCCAAGCCTGGTC-3′, 5′-GGCAAACACCTTTAATCCAAGCCTGGTC-3′ and 5′-CCATGGCTGCAAACACCTAAACCTGAAG-3′, yielding a 287 bp wild-type DNA fragment and a 366 bp floxed DNA fragment. The Cd4-Cre construct was identified using 2 additional primers; 5′-GCCTGCATTACCGGTCGATGCAACGA-3′ and 5′-GTGGCAGATGGCGCGGCAACACCAT-3′, resulting in an 800 bp DNA fragment when the transgene is present. Ripk1K45A mice were identified using the 5′-CTCTGATTGCTTTATAGGACACAGCA-3′ forward and 5′-GTCTTCAGTGATGTCTTCCTCGTA-3′ reverse primers, yielding a 575 bp wild-type DNA fragment and a 473 bp knock-in DNA fragment. The presence of the transgenic Foxp3-Cre construct was detected using a combination of the following PCR primers: 5′-CCTAGCCCCTAGTTCCAACC-3′, 5′-AAGGTTCCAGTGCTGTTGCT-3′, 5′-CCTGGTGATGAGGAGAATCAG-3′ and 5′-ATTTCAGGGATGGACACACC-3′, yielding a 322 bp wild-type DNA fragment and a 585 bp transgenic DNA fragment. Identification of the loxP-site flanked Casp8 alleles was performed by using the following PCR primers: 5′-TTGAGAACAAGACCTGGGGACTG-3′ and 5′-GGATGTCCAGGAAAAGATTTGTGTC-3′, yielding a 200 bp wild-type DNA fragment and a 300 bp floxed DNA fragment. Presence of the Tnfr1 alleles was detected using a combination of the following PCR primers: 5′-CTCTCTTGTGATCAGCACTG-3′, 5′-CTGGAAGTGTGTCTCAC-3′, 5′-CTGGAAGTGTGTCTCAC-3′ and 5′-CCAAGCGAAACATCGCATCGAGCGA-3′, yielding a 1400 bp wild-type DNA fragment and a 950 bp knockout DNA fragment.

Generation of mixed bone marrow chimeras

CD45.1 recipient mice received a sublethal irradiation dose (800 cGy). At least 4 h later, the recipient mice were injected intravenously with a 1:1 mixture of BM cells (4 × 106 cells in total) derived from CD45.1/2 and either Ripk1FL/FL or Ripk1ΔCD4 (both CD45.2) donors. Validation of the reconstitution was performed 8 weeks later by collection of tail vein blood. Osmotic lysis of red blood cells was performed using ACK lysis buffer (10548E, Lonza, Basel, Switzerland) and lymphocytes were analyzed by flow cytometry. 12 weeks after reconstitution of the bone marrow, mice were euthanized and ratios of CD45.1/2 and CD45.2T cell numbers in spleen, mLN, and blood were analyzed by flow cytometry.

Sample processing for flow cytometry and FACS

Thymi, spleens, and lymph nodes were harvested and stored in ice-cold PBS containing 3% heat-inactivated fetal calf serum (FCS) and 2 mM EDTA (15575020, Invitrogen, Waltham, MA, USA). Tissues were smashed on top of a 70 µm cell strainer using the plunger of a 3-ml syringe and single cells were subsequently collected by centrifugation at 500 × g and 4 °C during 5 min. For purification of splenocytes, an additional osmotic lysis of red blood cells was performed using ACK lysis buffer (10548E, Lonza).

Flow cytometry

Single-cell suspensions were obtained as described, Fc-receptors were blocked with anti-CD16/CD32 antibodies (clone 2.4G2, BD Biosciences, Franklin Lakes, NJ, USA) and cells were stained with fluorochrome-conjugated monoclonal antibodies. The following antibodies were from BD Biosciences: BUV395-conjugated anti-CD3 (145-2C11), BV605-conjugated anti-CD4 (RM4-5), PE- and BUV395-conjugated anti-CD25 (PC61), V450-conjugated anti-CD44 (IM7), AF700-conjugated anti-CD45R/B220 (RA3-6B2), PE-conjugated anti-CD45.1 (A20), AF700- and PE-conjugated anti-CD62L (MEL-14), BUV737-conjugated anti-CD127 (SB-199), AF488-conjugated anti-FoxP3 (MF23), PerCP-Cy5.5-conjugated Ki-67 (B56) and FITC- and PE-CF594-conjugated anti-TCRγδ (GL3). The following antibodies were from Biolegend: APC-conjugated anti-CD3 (145-2C11), BV785-conjugated anti-CD4 (GK1.5), FITC- and PerCP-Cy5.5- and BV510-conjugated anti-CD8β (YTS156.7.7), BV785-conjugated anti-CD11b (M1/70), BV785-conjugated anti-CD11c (N418), BV785-conjugated anti-CD19 (6D5), BV421-conjugated anti-CD45R/B220 (RA3-6B2), PerCP-Cy5.5-conjugated anti-CD45.2 (104), BV421-conjugated anti-CD127 (A7R34), PE-conjugated anti-Bcl-2 (BCL/10C4), BV785-conjugated anti-F4/80 (BM8), BV785-conjugated anti-Ly-6G (1A8), APC-Cy7- and BV711-conjugated anti-TCRβ (H57-597) and BV785-conjugated anti-Ter-119 (TER-119). The following antibodies were from eBioscience (Waltham, MA, USA): eFluor450-conjugated anti-CD8α (53-6.7), PE-Cy5-conjugated anti-CD11b (M1/70), AF700- and PE-Cy5-conjugated anti-CD19 (1D3), PE-Cy7-conjugated anti-CD44 (IM7), FITC-conjugated anti-CD62L (MEL-14), APC-conjugated anti-FoxP3 (FJK-16s), PE-Cy5-conjugated anti-Gr-1 (RB6-8C5), and PE-Cy5-conjugated anti-Ter-119 (TER-119). Staining for cell viability was done using Fixable Viability Dye eFluor™ 780 or eFluorTM 506 (eBioscience). Intracellular stainings for FoxP3, Ki-67, and Bcl-2 were performed using the Foxp3/Transcription Factor Staining Buffer Set (00-5523-00, eBioscience). Flow cytometry was performed on an LSR-II HTS, LSRFortessa™ 5-lasers, or FACSymphony™ A5 cytometer (BD Biosciences) using FACSDiva™ software, and data were analyzed using FlowJo™ v10 software.

Cell enrichment and FACS

Thymus, spleens, and lymph nodes (axillary, brachial, inguinal, and mesenteric) were collected and single-cell suspensions were prepared as described before. For isolation of CD4+ single-positive thymocytes from the thymus, thymocytes were subjected to an in-house optimized procedure using MagnisortTM magnets (eBioscience) for negative selection with MagnisortTM streptavidin negative selection beads (MSNB-6002-74, eBioscience) and a biotinylated CD8α antibody (clone 53-6.7, eBioscience). For isolation of naive and CD44high T cells from spleen and mLN, first CD4+ and CD8+ T cells were enriched with the MagnisortTM Mouse T cell enrichment kit (8804-6820-74, eBioscience), according to the manufacturer’s instructions, or using MagnisortTM magnets (eBioscience) for negative selection with MagnisortTM streptavidin negative selection beads and biotinylated antibodies. The following antibodies were from eBioscience: anti-B220 (RA3-6B2), anti-Ly-6G/Ly-6C (RB6-8C5), anti-TER-119 (TER-119), anti-TCRγδ (GL3), anti-CD49b (DX5), anti-CD19 (1D3) and anti-CD24 (M1/69). The following antibodies were from Biolegend: anti-CD11b (M1/70) and anti-MHC-II (M5/114.15.2). The enriched T cells were then stained as described and sorting was performed using FACSAria™ II and FACSAria™ III cell sorters (BD Biosciences). The following gating strategies were applied: total T cells (live, CD4+ or CD8+), naive T cells (live, CD4+ or CD8+, CD25-, CD62L+ CD44low) and CD44high T cells (live, CD4+ or CD8+, CD62L- CD44high).

Cell culture and stimulations

For the TNF-induced cell death assay, FACS-sorted CD4+ naive T cells or purified single positive CD4+CD8- thymocytes were pre-treated with 1 µg/ml cycloheximide (C7698, Sigma-Aldrich) during 30 min, and 1 × 105 cells were incubated on round-bottom 96-well plates in T cell medium (RPMI supplemented with 10% FCS, 400 µM sodium-pyruvate, 50 µM 2-mercaptoethanol, 20 µM glutamine, 100 IU/ml penicillin, 0.1 mg/ml streptomycin and non-essential amino acids) supplemented with 10 ng/ml IL-2 (VIB protein core, Ghent, Belgium), 1 ng/ml IL-7 (217-17, Peprotech, Rocky Hill, NJ, USA) and 10 ng/ml of either mTNF or hTNF (VIB protein core, Ghent, Belgium) during 20 h at 37 °C and 5% CO2. Cells were collected, stained as described, and cell death was analyzed by flow cytometry. For survival assays with a titration of IL-7, 1 × 105 FACS-sorted naive T cells were incubated on round-bottom 96-well plates in T cell medium (RPMI supplemented with 10% FCS, 400 μM sodium-pyruvate, 50 μM 2-mercaptoethanol, 20 μM glutamine, 100 IU/ml penicillin, 0.1 mg/ml streptomycin and non-essential amino acids) with 10 ng/ml IL-2 (Protein core, VIB) and treated with different concentrations of IL-7 (217-17, Peprotech), ranging from 10 pg/ml to 10 ng/ml, for 72 h at 37 °C and 5% CO2. Cells were collected, stained, as described previously, and cell death was analyzed by flow cytometry using Fixable Viability Dye e780 (65-0865-14, eBioscience, San Diego, CA). For TCR-induced proliferation assays, FACS-sorted naive T cells were stained with CellTraceTM Violet (C34557, Invitrogen) according to the manufacturer’s instructions. 1 × 105 CTV-stained naive T cells were incubated on round-bottom 96-well plates, pre-coated with 5 μg/ml anti-CD3ε antibodies (100302, Biolegend), in T cell medium supplemented with 10 ng/ml IL-2 (Protein core, VIB) and 1 μg/ml soluble anti-CD28 (553294, BD Biosciences) during 72 h at 37 °C and 5% CO2. Cells were collected and stained as described for analysis of proliferation (CellTrace Violet dilution) and cell death (Fixable Viability Dye) by flow cytometry, or otherwise lysates were prepared for western blot analysis.

For the intrinsic/extrinsic apoptosis assays, FACS-sorted CD4+ naive T cells or purified CD4+ thymocytes were pre-treated with 1 µg/ml cycloheximide (C7698, Sigma-Aldrich) and, when indicated, 2 µM BV6 (S7597, Selleckchem), 2 µM GSK’872 (S8465, Selleckchem) or 50 µM zVAD (ALX-260-020-M005, Enzo Lifescience (VWR)) during 30 min. 7 × 104 cells were incubated on round-bottom 96-well plates in T cell medium (RPMI supplemented with 10% FCS, 400 µM sodium-pyruvate, 50 µM 2-mercaptoethanol, 20 µM glutamine, 100 IU/ml penicillin, 0.1 mg/ml streptomycin and non-essential amino acids) supplemented with 10 ng/ml IL-2 (VIB protein core, Ghent, Belgium), 1 ng/ml IL-7 (217-17, Peprotech, Rocky Hill, NJ, USA) and 10 ng/ml of either mTNF or hTNF (VIB protein core, Ghent, Belgium) or 1 µM ABT-737 (S1002, Selleckchem) during 20 h at 37 °C and 5% CO2. Cells were collected, stained as described and cell death was analyzed by flow cytometry. The number of biological replicates (n) for each experiment is reported in the figure legends.

Western blotting

FACS-sorted T cells or T cells from TCR-induced proliferation assays were collected and lysed in 1× Laemmli buffer containing 50 mM Tris-HCl pH 6.8, 2% sodium dodecyl sulphate (SDS), and 10% glycerol. Lysates were boiled during 10 min at 95 °C, proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane. Immunoblotting was performed by overnight incubation at 4 °C using the following primary antibodies: anti-RIPK1 (#610459, 1:2000, BD Biosciences), anti-caspase-8 (MAB3429, 1:1000, Abnova, Taipei, Taiwan) and anti-actin (69100, 1:20,000, MP Biomedicals, Irvine, CA, USA) followed by a 1 h incubation at RT using the following secondary antibodies: HRP-linked anti-mouse IgG (NA931, 1:3000, GE Healthcare, Chicago, IL, USA) and HRP-linked anti-rat IgG (NA935, 1:3000, GE Healthcare). Full length western blots can be found in Supplemental Materials.

Sample processing for single-cell RNA sequencing

Single cells were prepared from the mLNs as described in ’Sample processing for flow cytometry and FACS’. Half of the cells were used for enrichment of T cells using the MagniSort™ Mouse T cell Enrichment Kit (8804-6820-74, eBioscience) according to the manufacturer’s instructions. The other half of the single cell suspensions were not enriched. Cells were subsequently stained with fluorochrome-conjugated monoclonal antibodies recognizing CD4 (clone RM4-5, BD Biosciences) and CD8β (clone YTS156.7.7, Biolegend), DAPI for cell viability, TruStain FcX Block (101320, BioLegend), the mouse cell surface protein antibody panel containing 165 oligo-conjugated antibodies and 9 TotalSeq-A isotype controls (TotalSeq-A, BioLegend) and a unique TotalSeq-A cell hashing antibody (BioLegend). Sorting of live CD4+ and CD8+ T cells from the enriched cells and sorting of total live cells from the unenriched cells was performed using FACSAria™ II and FACSAria™ III cell sorters (BD Biosciences). This resulted in two suspension of sorted cells per mouse which were tagged with unique hashing antibodies and combined in a 1:1 ratio to ensure enough T cells would be available for sequencing as T cell numbers are significantly reduced in the mLN of Ripk1ΔCD4 mice.

Single-cell RNA sequencing

Three biological replicates per sample were loaded (consisting of a 1:1 combination of total live cells and enriched T cells) were multiplexed per lane using TotalSeq-A cell hashing antibodies. In the final analysis, only two of the three Ripk1FL/FLCasp8FL/FL samples had sufficient cells to analyse. Sorted single-cell suspensions at an estimated final concentration of 1500 cells/µl were loaded on a Chromium GemCode Single Cell Instrument (10x Genomics) to generate single-cell gel beads-in-emulsion (GEM). The scRNA-Seq libraries were prepared using the GemCode Single Cell 3′ Gel Bead and Library kit, version 3.1 (10x Genomics) according to the manufacturer’s instructions with the addition of amplification primers (3 nM each, 5′CCTTGGCACCCGAGAATT*C*C - 5′GTGACTGGAGTTCAGACGTGTGC*T*C) during cDNA amplification to enrich the TotalSeq-A cell surface and hashing protein oligos, respectively. Size selection with SPRIselect Reagent Kit (B23318, Beckman Coulter, Brea, CA, USA) was used to separate amplified cDNA molecules for 3′ gene expression and cell surface protein construction. TotalSeq-A protein library construction including sample index PCR using Illumina’s Truseq Small RNA primer sets and SPRIselect size selection was performed according to the manufacturer’s instructions. The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent, Santa Clara, CA, USA). Sequencing libraries were loaded on an Illumina NovaSeq flow cell at VIB Nucleomics core with sequencing settings according to the recommendations of 10× Genomics, pooled in a 70:20:10 ratio for the combined 3’ gene expression, cell surface, and hashing protein samples, respectively. The Cell Ranger pipeline (10x Genomics, version 5.0.0) was used to perform sample demultiplexing and to generate FASTQ files for read 1, read 2, and the i7 sample index for the gene expression, cell surface, and hashing protein libraries. Read 2 of the gene expression libraries was mapped to the mouse reference genome (GRCm38.99). Subsequent barcode processing, unique molecular identifiers filtering, and gene counting was performed using the Cell Ranger suite. The average of the mean reads per cell across all gene expression libraries was 33,800, with an average sequencing saturation of 62%, as calculated by Cell Ranger. In total, 4 individual single-cell libraries were created in this study, entailing 56,740 cells.

scRNA-seq data analysis

Separate samples were merged and the aggregate was processed via the following functions of the Seurat [42] (v 4.0.2) pipeline with default parameters unless specified otherwise: NormalizeData, FindVariableFeatures, ScaleData, RunPCA (npcs = 150), FindNeighbours (dims = 1:50), FindClusters (resolution = 1.3), RunTSNE (dims = 1:50), RunUMAP (dims = 1:50). Clusters were further curated manually based on marker gene expression. Differentially expressed genes were found using the FindMarkers function (adjusted p-value < 0.05). Figures were made using the DotPlot and DimPlot functions. Heatmaps were made using an inhouse built function based on the pheatmap package (v 1.0.12). To create the PCA figure, gene expression was averaged per sample using the AverageExpression function of Seurat and used as input for the prcomp function. Volcano plots were made in Graphpad Prism.

Statistical analysis

Differences between experimental groups in all datasets were analyzed on absolute values or on Log2-transformed data (when the F-test showed differences between conditions) and is specified in the figure legend, comprising of unpaired t-tests, Fisher’s LSD one-way ANOVA or Fisher’s LSD two-way ANOVA. Results are expressed as mean ± sem. Statistical analyses were carried out using GraphPad Prism version 9.4.1 (Graphpad Software Inc., La Jolla, CA).

Supplementary information

Suppl Figure S1 (329.2KB, png)
Suppl Figure S2 (65.5KB, png)
Suppl Figure S3 (727.5KB, png)
Suppl Figure S4 (594KB, png)
Suppl Figure S5 (265.8KB, png)
Suppl Table S1 (225.3KB, png)
Suppl Table S2 (236.3KB, png)
Suppl Table S3 (13.1KB, xlsx)

Acknowledgements

We thank the VIB Single Cell Core, and VIB Flow Core Ghent, for support and access to the instrument park (vib.be/core-facilities). Additionally, we thank the VIB-UGent animal house staff.

Author contributions

JH, PV, TV, and NT initiated the study. PV and PT supervised the project. JH, WS, PV, and PT designed experiments. JH, WS, MV, TD, KF, MRP, and PT performed experiments. JH, WS, and BV analyzed data. JH, PV, and PT wrote the manuscript. WD, BL, and JM contributed to discussions and critical data interpretation. All of the authors have read or provided comments on the manuscript.

Funding

JH held an FWO PhD fellowship. PV is senior full professor at Ghent University and senior PI at the VIB-UGent Center for Inflammation Research (IRC). PT were funded through an FWO and a BOF-UGent postdoc fellowships. Research in the Vandenabeele unit is supported by the FWO research projects (3G033120, 3G0A9322), EOS research consortium (EOS 30826052, 3G0I5722), UGent Special Research Fund Methusalem (01M00709), iBOF (01IB3920), grants from the Foundation against Cancer (365A08921), CRIG and GGIG consortia, and VIB. Research in the Declercq group is supported by Hercules medium infrastructure grant (319306720), UGent basic infrastructure grants (01B06718, 01B10920), grants from Foundation against Cancer (365B03421) and the EU H2020 ITN CancerPrev project (859860).

Data availability

The single-cell sequencing has been deposited in the Gene Expression Omnibus under the ID GSE260973. All data needed to obtain the conclusions in this work are present in the paper or the Supplementary Materials figures or tables. All mouse lines, reagents, and software used are listed in the paper or the Supplementary Materials.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors jointly supervised this work: Peter Vandenabeele, Peter Tougaard.

Supplementary information

The online version contains supplementary material available at 10.1038/s41418-024-01301-w.

References

  • 1.Jameson SC. Maintaining the norm: T-cell homeostasis. Nat Rev Immunol. 2002;2:547–56. doi: 10.1038/nri853. [DOI] [PubMed] [Google Scholar]
  • 2.Surh CD, Sprent J. Homeostasis of naive and memory T cells. Immunity. 2008;29:848–62. doi: 10.1016/j.immuni.2008.11.002. [DOI] [PubMed] [Google Scholar]
  • 3.Fisher GH, Rosenberg FJ, Straus SE, Dale JK, Middelton LA, Lin AY, et al. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell. 1995;81:935–46. doi: 10.1016/0092-8674(95)90013-6. [DOI] [PubMed] [Google Scholar]
  • 4.Magerus-Chatinet A, Stolzenberg MC, Lanzarotti N, Neven B, Daussy C, Picard C, et al. Autoimmune lymphoproliferative syndrome caused by a homozygous null FAS ligand (FASLG) mutation. J Allergy Clin Immunol. 2013;131:486–90. doi: 10.1016/j.jaci.2012.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature. 1992;356:314–7. doi: 10.1038/356314a0. [DOI] [PubMed] [Google Scholar]
  • 6.Takahashi T, Tanaka M, Brannan CI, Jenkins NA, Copeland NG, Suda T, et al. Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand. Cell. 1994;76:969–76. doi: 10.1016/0092-8674(94)90375-1. [DOI] [PubMed] [Google Scholar]
  • 7.Zhang J, Cado D, Chen A, Kabra NH, Winoto A. Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD/Mort1. Nature. 1998;392:296–9. doi: 10.1038/32681. [DOI] [PubMed] [Google Scholar]
  • 8.Salmena L, Lemmers B, Hakem A, Matysiak-Zablocki E, Murakami K, Au PY, et al. Essential role for caspase 8 in T-cell homeostasis and T-cell-mediated immunity. Genes Dev. 2003;17:883. doi: 10.1101/gad.1063703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Osborn SL, Diehl G, Han SJ, Xue L, Kurd N, Hsieh K, et al. Fas-associated death domain (FADD) is a negative regulator of T-cell receptor-mediated necroptosis. Proc Natl Acad Sci USA. 2010;107:13034–9. doi: 10.1073/pnas.1005997107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ch’en IL, Tsau JS, Molkentin JD, Komatsu M, Hedrick SM. Mechanisms of necroptosis in T cells. J Exp Med. 2011;208:633–41. doi: 10.1084/jem.20110251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.van Loo G, Bertrand MJM. Death by TNF: a road to inflammation. Nat Rev Immunol. 2022;23:289–303. doi: 10.1038/s41577-022-00792-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Delanghe T, Dondelinger Y, Bertrand MJM. RIPK1 kinase-dependent death: a symphony of phosphorylation events. Trends Cell Biol. 2020;30:189–200. doi: 10.1016/j.tcb.2019.12.009. [DOI] [PubMed] [Google Scholar]
  • 13.Peterson LW, Philip NH, DeLaney A, Wynosky-Dolfi MA, Asklof K, Gray F, et al. RIPK1-dependent apoptosis bypasses pathogen blockade of innate signaling to promote immune defense. J Exp Med. 2017;214:3171. doi: 10.1084/jem.20170347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dondelinger Y, Delanghe T, Priem D, Wynosky-Dolfi MA, Sorobetea D, Rojas-Rivera D, et al. Serine 25 phosphorylation inhibits RIPK1 kinase-dependent cell death in models of infection and inflammation. Nat Commun. 2019;10:1–16. doi: 10.1038/s41467-019-09690-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Pasparakis M, Vandenabeele P. Necroptosis and its role in inflammation. Nature. 2015;517:311–20. doi: 10.1038/nature14191. [DOI] [PubMed] [Google Scholar]
  • 16.Cuchet-Lourenço D, Eletto D, Wu C, Plagnol V, Papapietro O, Curtis J, et al. Biallelic RIPK1 mutations in humans cause severe immunodeficiency, arthritis, and intestinal inflammation. Science. 2018;361:810–3. doi: 10.1126/science.aar2641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li Y, Führer M, Bahrami E, Socha P, Klaudel-Dreszler M, Bouzidi A, et al. Human RIPK1 deficiency causes combined immunodeficiency and inflammatory bowel diseases. Proc Natl Acad Sci USA. 2019;116:970–5. doi: 10.1073/pnas.1813582116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sultan M, Adawi M, Kol N, McCourt B, Adawi I, Baram L, et al. RIPK1 mutations causing infantile-onset IBD with inflammatory and fistulizing features. Front Immunol. 2022;13. 10.3389/FIMMU.2022.1041315/FULL. [DOI] [PMC free article] [PubMed]
  • 19.Tao P, Sun J, Wu Z, Wang S, Wang J, Li W, et al. A dominant autoinflammatory disease caused by non-cleavable variants of RIPK1. Nature. 2020;577:109–14. doi: 10.1038/s41586-019-1830-y. [DOI] [PubMed] [Google Scholar]
  • 20.Lalaoui N, Boyden SE, Oda H, Wood GM, Stone DL, Chau D, et al. Mutations that prevent caspase cleavage of RIPK1 cause autoinflammatory disease. Nature. 2020;577:103–8. doi: 10.1038/s41586-019-1828-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kelliher MA, Grimm S, Ishida Y, Kuo F, Stanger BZ, Leder P. The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity. 1998;8:297–303. doi: 10.1016/S1074-7613(00)80535-X. [DOI] [PubMed] [Google Scholar]
  • 22.Zhang H, Zhou X, McQuade T, Li J, Chan FKM, Zhang J. Functional complementation between FADD and RIP1 in embryos and lymphocytes. Nature. 2011;471:373–7. doi: 10.1038/nature09878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rickard JA, O’Donnell JA, Evans JM, Lalaoui N, Poh AR, Rogers T, et al. RIPK1 regulates RIPK3-MLKL-driven systemic inflammation and emergency hematopoiesis. Cell. 2014;157:1175–88. doi: 10.1016/j.cell.2014.04.019. [DOI] [PubMed] [Google Scholar]
  • 24.Dowling JP, Cai Y, Bertin J, Gough PJ, Zhang J. Kinase-independent function of RIP1, critical for mature T-cell survival and proliferation. Cell Death Dis. 2016;7:e2379–e2379. doi: 10.1038/cddis.2016.307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Imanishi T, Unno M, Yoneda N, Motomura Y, Mochizuki M, Sasaki T, et al. RIPK1 blocks T cell senescence mediated by RIPK3 and caspase-8. Sci Adv. 2023;9. 10.1126/SCIADV.ADD6097. [DOI] [PMC free article] [PubMed]
  • 26.Webb LV, Barbarulo A, Huysentruyt J, Vanden Berghe T, Takahashi N, Ley S, et al. Survival of single positive thymocytes depends upon developmental control of RIPK1 kinase signaling by the IKK complex independent of NF-κB. Immunity. 2019;50:348. doi: 10.1016/j.immuni.2019.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Donocoff RS, Teteloshvili N, Chung H, Shoulson R, Creusot RJ. Optimization of tamoxifen-induced Cre activity and its effect on immune cell populations. Sci Rep. 2020;10. 10.1038/S41598-020-72179-0. [DOI] [PMC free article] [PubMed]
  • 28.Deng X, Wang L, Zhai Y, Liu Q, Du F, Zhang Y, et al. RIPK1 plays a crucial role in maintaining regulatory T-Cell homeostasis by inhibiting both RIPK3- and FADD-mediated cell death. Cell Mol Immunol. 2024;21. 10.1038/S41423-023-01113-X. [DOI] [PMC free article] [PubMed]
  • 29.Min B. Spontaneous T cell proliferation: a physiologic process to create and maintain homeostatic balance and diversity of the immune system. Front Immunol. 2018;9:1. doi: 10.3389/fimmu.2018.00547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chen D, Tang TX, Deng H, Yang XP, Tang ZH. Interleukin-7 biology and its effects on immune cells: mediator of generation, differentiation, survival, and homeostasis. Front Immunol. 2021;12. 10.3389/FIMMU.2021.747324. [DOI] [PMC free article] [PubMed]
  • 31.Ch’en IL, Beisner DR, Degterev A, Lynch C, Yuan J, Hoffmann A, et al. Antigen-mediated T cell expansion regulated by parallel pathways of death. Proc Natl Acad Sci USA. 2008;105:17463–8. doi: 10.1073/pnas.0808043105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Takahashi N, Vereecke L, Bertrand MJMM, Duprez L, Berger SB, Divert T, et al. RIPK1 ensures intestinal homeostasis by protecting the epithelium against apoptosis. Nature. 2014;513:95–9. doi: 10.1038/nature13706. [DOI] [PubMed] [Google Scholar]
  • 33.Dannappel M, Vlantis K, Kumari S, Polykratis A, Kim C, Wachsmuth L, et al. RIPK1 maintains epithelial homeostasis by inhibiting apoptosis and necroptosis. Nature. 2014;513:90–4. doi: 10.1038/nature13608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ostade, Van X, Vandenabeele P, Everaerdt B, Loetscher H, Gentz R, et al. Human TNF mutants with selective activity on the p55 receptor. Nature. 1993;361:266–9. doi: 10.1038/361266a0. [DOI] [PubMed] [Google Scholar]
  • 35.Krammer PH, Arnold R, Lavrik IN. Life and death in peripheral T cells. Nat Rev Immunol. 2007;7:532–42. doi: 10.1038/nri2115. [DOI] [PubMed] [Google Scholar]
  • 36.Zhan Y, Carrington EM, Zhang Y, Heinzel S, Lew AM. Life and death of activated T cells: how are they different from naive T cells? Front Immunol. 2017;8. 10.3389/FIMMU.2017.01809. [DOI] [PMC free article] [PubMed]
  • 37.Roderick-Richardson JE, Lim SE, Suzuki S, Ahmad MH, Selway J, Suleiman R, et al. ZBP1 activation triggers hematopoietic stem and progenitor cell death resulting in bone marrow failure in mice. Proc Natl Acad Sci USA. 2024;121. 10.1073/PNAS.2309628121. [DOI] [PMC free article] [PubMed]
  • 38.Osborne LC, Patton DT, Seo JH, Abraham N. Elevated IL-7 availability does not account for T cell proliferation in moderate lymphopenia. J Immunol. 2011;186:1981–8. doi: 10.4049/jimmunol.1002224. [DOI] [PubMed] [Google Scholar]
  • 39.den Braber I, Mugwagwa T, Vrisekoop N, Westera L, Mögling R, Bregje de Boer A, et al. Maintenance of peripheral naive T cells is sustained by thymus output in mice but not humans. Immunity. 2012;36:288–97. doi: 10.1016/j.immuni.2012.02.006. [DOI] [PubMed] [Google Scholar]
  • 40.Shi J, Petrie HT. Activation kinetics and off-target effects of thymus-initiated cre transgenes. PLoS ONE. 2012;7. 10.1371/JOURNAL.PONE.0046590. [DOI] [PMC free article] [PubMed]
  • 41.Wang L, Zhang X, Zhang H, Lu K, Li M, Li X, et al. Excessive apoptosis of Rip1-deficient T cells leads to premature aging. EMBO Rep. 2023;24. 10.15252/EMBR.202357925. [DOI] [PMC free article] [PubMed]
  • 42.Hao Y, Hao S, Andersen-Nissen E, Mauck WM, Zheng S, Butler A, et al. Integrated analysis of multimodal single-cell data. Cell. 2021;184:3573–3587.e29. doi: 10.1016/j.cell.2021.04.048. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Suppl Figure S1 (329.2KB, png)
Suppl Figure S2 (65.5KB, png)
Suppl Figure S3 (727.5KB, png)
Suppl Figure S4 (594KB, png)
Suppl Figure S5 (265.8KB, png)
Suppl Table S1 (225.3KB, png)
Suppl Table S2 (236.3KB, png)
Suppl Table S3 (13.1KB, xlsx)

Data Availability Statement

The single-cell sequencing has been deposited in the Gene Expression Omnibus under the ID GSE260973. All data needed to obtain the conclusions in this work are present in the paper or the Supplementary Materials figures or tables. All mouse lines, reagents, and software used are listed in the paper or the Supplementary Materials.


Articles from Cell Death and Differentiation are provided here courtesy of Nature Publishing Group

RESOURCES