Maternal GLP-1 receptor activation inhibits fetal growth

Abstract

Glucagon-like peptide 1 (GLP-1) regulates food intake, insulin production, and metabolism. Our recent study demonstrated that pancreatic α-cells-secreted (intraislet) GLP-1 effectively promotes maternal insulin secretion and metabolic adaptation during pregnancy. However, the role of circulating GLP-1 in maternal energy metabolism remains largely unknown. Our study aims to investigate systemic GLP-1 response to pregnancy and its regulatory effect on fetal growth. Using C57BL/6 mice, we observed a gradual decline in maternal blood GLP-1 concentrations. Subsequent administration of the GLP-1 receptor agonist semaglutide (Sem) to dams in late pregnancy revealed a modest decrease in maternal food intake during initial treatment. At the same time, no significant alterations were observed in maternal body weight or fat mass. Notably, Sem-treated dams exhibited a significant decrease in fetal body weight, which persisted even following the restoration of maternal blood glucose levels. Despite no observable change in placental weight, a marked reduction in the placenta labyrinth area from Sem-treated dams was evident. Our investigation further demonstrated a substantial decrease in the expression levels of various pivotal nutrient transporters within the placenta, including glucose transporter one and sodium-neutral amino acid transporter one, after Sem treatment. In addition, Sem injection led to a notable reduction in the capillary area, number, and surface densities within the labyrinth. These findings underscore the crucial role of modulating circulating GLP-1 levels in maternal adaptation, emphasizing the inhibitory effects of excessive GLP-1 receptor activation on both placental development and fetal growth.

NEW & NOTEWORTHY Our study reveals a progressive decline in maternal blood glucagon-like peptide 1 (GLP-1) concentration. GLP-1 receptor agonist injection in late pregnancy significantly reduced fetal body weight, even after restoration of maternal blood glucose concentration. GLP-1 receptor activation significantly reduced the placental labyrinth area, expression of some nutrient transporters, and capillary development. Our study indicates that reducing maternal blood GLP-1 levels is a physiological adaptation process that benefits placental development and fetal growth.

INTRODUCTION

Glucagon-like peptide 1 (GLP-1) was identified as an incretin that influences critical physiological processes such as gastric emptying, food intake, and insulin secretion (1, 2). Notably, GLP-1 and glucagon stem from the same preproglucagon (GCG) gene (3, 4). The exclusive expression of GCG in pancreatic α-cells, enteroendocrine L cells, and some neurons in the brainstem underlines its pivotal role (5–7). Posttranslational cleavage of proglucagon by prohormone convertase 1 (PC1, also known as PCSK1 or PC1/3) produces GLP-1 (8, 9). In pancreatic α-cells, predominantly expressed PC2 converts most proglucagon into glucagon (8, 9). Interestingly, PC1 is also expressed in α-cells and directs the intraislet GLP-1 production (10–13). Despite the significance of α-cell-produced GLP-1 in augmenting insulin secretion during metabolic stress, enteroendocrine L cells are the primary source of circulating GLP-1.

Decades of comprehensive research have unveiled broader biological functions of GLP-1, extending its influence on the immune, lung, and cardiovascular systems (1, 2, 14). Pregnancy instigates a cascade of maternal adaptations to ensure a successful pregnancy and a healthy outcome. Our recent study has presented compelling evidence that pregnancy increases maternal intraislet GLP-1 production, indirectly impacting fetal nutrient supply and development through enhanced maternal insulin secretion and improved glucose metabolism (15). However, the existing information on changes in maternal blood GLP-1 concentration during pregnancy remains scarce and riddled with contradictions (16–19), highlighting the need for further research. To the best of our knowledge, no study has explored the physiological role of systemic maternal GLP-1 in pregnancy and fetal development, a significant gap in our understanding of maternal-fetal metabolic interactions. A recent report by Jasson’s group has shed light on the presence of GLP-1 receptors (GLP-1R) in human trophoblast cells and a positive correlation between maternal plasma GLP-1 levels and birthweight (20). Contrary to this finding, an early study reported an inverse relationship between maternal blood GLP-1 concentrations and fetal abdomen circumference and birth weight (17). Such discrepancies highlight the need for comprehensive insights into the physiological role of systemic GLP-1 in maternal metabolic adaptation and fetal development.

A previous study treated a preeclampsia rat model with GLP-1R agonist (GLP-1RA) and reported some promising outcomes, such as significantly improved blood pressure and renal function (21). This study also suggested a potential regulatory role of GLP-1R activation in placental development (21). Despite the contraindication of GLP-1RA use in pregnant women, the increasing prescription of GLP-1RA for managing obesity and type 2 diabetes in women of childbearing age has underscored the urgency and significance of our research endeavor.

In the present study, we use mouse models to unveil a paradoxical trend: maternal blood GLP-1 concentrations progressively decrease, whereas intraislet GLP-1 content significantly increases during pregnancy (15, 19). Intriguingly, GLP-1RA injection significantly reduces fetal body weight, independently of glucose metabolism. GLP-1R activation, however, has no significant impact on insulin-like growth factor 1 (IGF-1), IGF binding protein 1 (IGFBP1), or insulin levels in fetal circulation. Although placental weight remains unaffected, the labyrinth areas and capillary density exhibit remarkable reductions. Our findings convincingly assert that systemic maternal GLP-1R activation impedes placental development and fetal growth. Thus, our study suggests that declining maternal blood GLP-1 levels is a physiological adaptation process that ultimately benefits placental and fetal development.

MATERIAL AND METHODS

Materials

Antibodies against insulin, GLP-1, GLP-1R, cluster of differentiation 31 (CD31), and Ki67 were from Abcam (Cambridge, MA). The ELISA kits for total GLP-1 and IGF-1, TRIzol, NuPAGE gels, SuperScript III reverse transcriptase, and Oligo (Dt)_12–18 primer, Alexa-Fluor-conjugated goat anti-mouse, and rabbit antibodies were from Invitrogen (Carlsbad, CA). Glucose, glucose oxidase, BSA, and Schiff reagent were from Sigma-Aldrich (St. Louis, MO). The mouse insulin ELISA kit was from Mercodia (Uppsala, Sweden). Nitroblue tetrazolium (NBT)/5-bromo-4-chloro-3-indoyl phosphate (BCIP) stock solution was from Roche Diagnostics (Indianapolis, IN). Super signal West Pico PLUS chemiluminescent substrate was from Thermo Fisher Scientific (Waltham, MA). Semaglutide (Sem) was obtained from Novo Nordisk (Plainsboro, NJ).

Experimental Animals

The C57BL/6 mice were from the Jackson Laboratory (Bar Harbor, ME) and housed in a standard animal facility with constant AC and controlled light (0600–1800). Ten to 12-wk-old nulliparous female mice were randomly selected for mating. Pregnancy was determined by the presence of a vaginal plug and assigned the embryonic age E0.5. The dams were injected with saline for control (Con) or GLP-1R agonist Sem (sc, 6 µg/kg, daily) from E13.5 to E17.5 (15). Although Sem is long-acting in humans, it must be injected daily due to a significantly shorter half-life in mice than in humans (instructed by Novo Nordisk; 15, 22). However, Sem’s half-life in mice is remarkably longer than endogenous GLP-1 (15, 22). Fetal and maternal tissues were collected at E18.5 in the fed state. Fetal blood samples were collected through the cut-opened jugular veins with capillary tubes. To restore maternal blood glucose concentrations, glucose (1 g/kg, ip) was injected into some dams at the same time as Sem injection. Blood samples were collected through the tail vein. For studying maternal blood GLP-1 concentration, sequential blood samples were collected from the same mice before pregnancy and during pregnancy at E12.5, E15.5, and E18.5. Serum samples were prepared, and glucose concentration was determined using glucose oxidase. Experiments using mouse models were carried out under the Association for Assessment and Accreditation of Laboratory Animal Care guidelines with approval from the University of California San Diego Animal Care and Use Committee.

Immunohistochemistry and Immunofluorescence

The placenta and ileum were fixed in 4% paraformaldehyde or 10% neutral-buffered formalin, then processed and embedded in optimal cutting temperature compound or paraffin. For immunohistochemistry (IHC), tissue sections were blocked with 2% H₂O₂ in PBS, then heated in 0.1 M pH 6.0 citrate buffer for 15 min at 95°C for antigen retrieval. After second-round blocking, the slide was probed with the primary antibody or rabbit serum (for a negative control) overnight at 4°C. The sections were visualized using 3,3′-diaminobenzidine (Vector Laboratories, Burlingame, CA) at room temperature (RT) for 1.5 min and counterstained with hematoxylin. For immunofluorescence (IF), the slides were incubated in 1% SDS in PBS for 5 min to induce antigen retrieval. After blocking with BSA in PBS for 2 h, sections were then incubated with primary antibody overnight at 4°C. After rinsing, the secondary antibody conjugated with Alexa Fluor 488 or 568 was applied to the slides and incubated for 2 h at RT. After washing, sections were mounted in DAPI Fluoromount-G (SouthernBiotech, Birmingham, AL) and visualized by fluorescent optical microscopy. The IHC and IF images were captured using a Keyence microscope (BZ-X800E; Keyence, Laguna Hills, CA). The cluster of differentiation 31 (CD31)-positive and labyrinth areas were measured using the ImageJ software. The CD31/labyrinth area ratios were calculated. The images of IF with anti-GLP-1 antibody were analyzed using the ImageJ software. The ileum L-cell numbers were determined by counting GLP-1-positive cells. The total cell numbers were determined by measuring DAPI-positive nuclei. The ratio of ileum L cells to total cells in each image was calculated. For each mouse, 12 randomly selected ×20 images were analyzed, and the mean ratio was used for statistical comparison.

The placental endogenous alkaline phosphatase (AP) was stained using paraffine embed slides. All paraffin slides were deparaffinized and rehydrated before staining. The placenta slides were put in NTMT solution (100 mM NaCl, 50 mM MgCl, 100 mM Tris pH 9.5, 10% Tween-20) 2 times for 10 min. The slides were stained with the NBT/BCIP solution in the dark for 20 min and counterstained with nuclear fast red. These slides were used to calculate the cross-sectional area of the placenta using the ImageJ software.

Western Blot and Real-Time PCR

The serum (5 µL) was prepared and run through the NuPAGE gels and blotted with the indicated antibodies (see details in figure legends). The protein bands from Western blots were quantified using Quantity One software (Bio-Rad).

Total RNA extraction was prepared from the placentas and ileum with TRIzol following the manufacturer’s instructions. cDNA was synthesized using SuperScript III reverse transcriptase and oligo(dT)_12–18 primer. Real-time PCR was performed using the QuantStudio 3 real-time PCR system (Invitrogen) and specific primers (Table 1; 23). Expression data were normalized to the amount of 18 s rRNA. The levels of the PCR product were calculated from standard curves established from each primer pair.

Table 1.

Sequences for real-time PCR primers

Gene	Forward (5′ to 3′)	Reverse (5′ to 3′)
18S rRNA	CGAAAGCATTTGCCAAGAAT	AGTCGGCATCGTTTATGGTC
mFABPpm	ATCTGGAGGTCCCATTTCAA	ATGGCTGCTGCCTTTCAC
Glut1	GACCCTGCACCTCATTGG	GATGCTCAGATAGGACATCCAAG
Lat1	CAAAGTGCCAAGAAAAAGAGC	CTGAGCAGGGAGGAACCAC
Snat1	CTTCAGCCATAAAATCCCTCAT	CATCGACGTACCAGGCTGA
Snat2	CAATGAGATCCGTGCAAAAG	TGCTTCCAATCATCACCACT
Lpl	GAAGTCTGACCAATAAGAAGGTCAA	TGTGTGTAAGACATCTACAAAATCAGC
CD36	TTGAAAAGTCTCGGACATTGAG	TCAGATCCGAACACAGCGTA
Gcg	TGTCTACACCTGTTCGCAGC	TCCTCATGCGCTTCTGTCTG
Pc1/3	TCTGGTTGTCTGGACCTCTGAGT	CATCAAGCCTGCCCCATTCTTT

Statistical Analysis

Data are expressed as means ± standard error of the mean (SE). Statistical analyses were performed using the Student t test or ANOVA, followed by Bonferroni post tests using Prism software. Differences were considered significant at P < 0.05.

RESULTS

Decline in Maternal Blood GLP-1 during Pregnancy

GLP-1 influences food intake, insulin production, and glucose metabolism. Studies have reported that pregnancy increases GLP-1 levels in maternal pancreas (15, 19). It is still uncertain whether there is any adaptative change in maternal blood GLP-1 concentration. To address these questions, we conducted a longitudinal analysis of sequential blood samples obtained from C57BL/6 mice before and during pregnancy. The blood and tissue samples were collected at a fed state around 10:00–11:00 AM to maintain consistency in the sampling procedure.

Our results showed that maternal blood GLP-1 concentrations were progressively reduced during pregnancy (Fig. 1A). Blood GLP-1 is predominantly produced by L cells of the intestine. To assess whether the L-cell populations are altered during pregnancy, we used immunofluorescence (IF) to study the relative L-cell population in the ileum. Notably, we found that GLP-1-positive cell rates remained statistically unchanged throughout the various stages of pregnancy (Fig. 1, B and C). Given that pregnancy is known to increase intestinal length (24), it would be reasonable to anticipate a corresponding increase in the total L-cell population during pregnancy, as reported in a previous mouse study (19). However, contrary to changes in the ileum L-cell population, our results indicate that pregnancy significantly reduces GLP-1 concentrations within the maternal circulation of mice. In addition, the mRNA levels of Gcg and PC1/3 in the ileum were also comparable between nonpregnant and pregnant mice (Fig. 1D). Therefore, future studies are required to determine whether pregnancy reduces maternal blood GLP-1 concentration by inhibiting GLP-1 secretion from enteroendocrine L cells, increasing GLP-1 degradation, and or expansion of maternal blood volume.

Figure 1.

Pregnancy reduced maternal blood GLP-1 concentration. Maternal tissue samples were collected from pregnant C57BL/6J mice at indicated embryonic ages and a fed state. A: blood total GLP-1 concentrations were determined by an ELISA kit. B and C: the L cells were probed by IF with an anti-GLP-1 antibody (red fluorescent protein, RFP, indicated by white arrowhead) using the ileum. The total cell number was determined by DAPI (blue) nucleus staining. The number of ileum L cells and total cells was counted by the ImageJ software and the L cell to total ratio was calculated. For each mouse, 12 randomly picked images (×20) were used for an average ratio calculation. D: mRNA levels of Gcg and Pc1/3 in the ileum of nonpregnant and pregnant mice (E18.5) were measured by real-time PCR. *P < 0.05, **P < 0.001, ***P < 0.0001 vs. non-preg. GLP-1, glucagon-like peptide 1; IF, immunofluorescence.

Maternal GLP-1R Activation Reduced Fetal Body Weight

Since maternal blood GLP-1 levels are significantly reduced during pregnancy, we injected semaglutide (Sem), a long-acting GLP1-RA, to study the effect of GLP-1R activation on the placenta and fetal development. Sem was chosen for this study because it is a clinically approved GLP-1RA that is well-tolerated.

As expected, Sem injection significantly reduced maternal blood glucose concentrations even though the dams had free access to food (Fig. 2A). In contrast, maternal blood insulin concentrations were significantly increased by Sem injection (data not shown). To isolate the effect of GLP-1R activation on fetal development from the effect of maternal glucose reduction, we concomitantly administered glucose into a group of mice, thereby maintaining maternal blood glucose concentrations (Fig. 2A).

Figure 2.

Maternal Sem injection reduced fetal body weight. Pregnant C57BL/6J mice were injected with Sem, Sem and glucose (Sem+Glu), or saline from E13.5 to E17.5. A: blood glucose concentrations were measured using glucose oxidase, n = 6. B: accumulative food intake was measured with a single-caged dam. The intake was normalized by body weight. C–E: body composition was measured by Echo-MRI, n = 14–17. F: the average fetal body weights of each litter were compared between dams receiving Sem, Sem+Glu, and saline treatment (Con). *P < 0.05 vs. Con. Con, control; Sem, semaglutide.

Sem injection did not induce any alterations in litter size, fetal sex ratio, or gross fetal tissue structure (data not shown). Maternal food intake exhibited a trend of reduction during the initial 2 days of Sem injection, subsequently returning to baseline levels (Fig. 2B). The relatively short treatment duration and low dosage resulted in no significant changes in maternal body weight, fat mass, or lean tissue mass (Fig. 2, C–E). Nevertheless, in line with findings in rats (21), we observed a notable reduction in fetal body weight within the Sem-injected groups (Fig. 2F). Even upon restoration of glucose levels (Fig. 2A), the fetal body weights in the Sem and glucose coadministration (Sem + Glu) group remained significantly lower compared with saline-injected controls (Fig. 2F). These results indicate that GLP-1R activation actively impedes fetal growth. Since the inhibitory effect is not contingent upon reducing maternal blood glucose levels, the subsequent sections of this report focus on data derived from Sem-injected mice.

Maternal GLP-1R Activation Did Not Alter Fetal Islet Development, Blood Insulin and IGF-1 Concentrations, and Glucose Metabolism

Beyond nutrition supply, fetal growth is intricately regulated by various hormones, including IGF-1 and insulin (25). To decipher the mechanisms underlying the inhibitory effects of maternal Sem injection on fetal growth, we analyzed fetal blood insulin and IGF-1 concentrations. Intriguingly, maternal Sem injection led to a significant elevation in fetal blood IGF-1 concentrations (Fig. 3A). Apart from hormonal levels, the bioactivity of IGF-1 is modulated by its binding proteins within the circulation. IGFBP1 is recognized for inhibiting IGF-1 bioactivity (26). Our results showed that serum IGFBP1 protein levels were comparable between the Con and Sem fetuses (Fig. 3B). Although this study did measure the IGF-1 activity, the significantly increased blood IGF-1 concentration suggests that maternal GLP-1R activation increases IGF-1 bioactivity in fetuses. Given the established role of IGF-1 in promoting fetal growth, the observed increase in fetal blood IGF-1 concentration contradicts the reduced body weight observed in Sem-treated fetuses. We posit that the surge in fetal blood IGF-1 is a compensatory response to the maternal GLP-1RA-induced fetal growth restriction. These findings effectively exclude the contribution of IGF-1 to the inhibition of fetal growth induced by maternal Sem injection.

Figure 3.

Maternal GLP-1R activation increased fetal blood IGF-1 levels but did not affect fetal β-cell proliferation and insulin production. Fetal blood and tissues were collected at E18.5 after daily Sem injection from E13.5 to E17.5. Serum IGF-1 (A) and insulin (C) were measured using ELISA kits. Blood IGFBP1 protein was measured by Western blotting (B). D: the pancreas tissue sections were probed by IF with anti-insulin and Ki67 antibodies. The Ki67-positive rates of β-cells were calculated and compared between fetuses from Con and Sem dams. E: serum glucose concentrations were determined using glucose oxidase. *P < 0.05 vs. Con. GLP-1R, glucagon-like peptide 1 receptor; IF, immunofluorescence; IGFBP1, insulin like growth factor binding protein 1.

GLP-1 promotes β-cell proliferation and glucose-induced insulin secretion in adults (1, 2). Insulin directly enhances fetal growth. Although it has been demonstrated that a minute quantity of Sem can traverse the placental barrier (27), the activation of GLP-1R within the fetal compartment potentially fosters fetal β-cell development and insulin production. Contrary to this proposed hypothesis, our findings revealed that fetal blood insulin concentrations and β-cell proliferation rates in fetuses from Sem-treated dams were comparable with those in the control fetuses (Fig. 3, C and D). Moreover, the fetal blood glucose concentrations at the time of tissue collection exhibited no significant deviations consequent to maternal Sem injection (Fig. 3E). Although direct monitoring of fetal blood glucose concentrations immediately post-Sem injection was not performed, the absence of a reduction in the body weights of fetuses from glucose-supplemented dams discounts the notion that the decrease in fetal glucose levels is responsible for the fetal growth restriction induced by maternal GLP-1R activation. Therefore, these results indicate that GLP-1R activation hinders fetal growth independently of fetal IGF-1, insulin, and glucose metabolism.

Maternal GLP-1R Activation Reduced Placental Labyrinth Area and Vascular Development

Considering the crucial role of the placenta in facilitating fetal nutrient supply and growth, we assessed the impact of Sem treatment on placental parameters. Despite the observed decrease in fetal body weight, no significant differences were found in placental weights or the body-to-placenta weight ratio between Sem-treated and control dams (Fig. 4, A and B). Subsequent real-time PCR analysis revealed notable reductions in the expression levels of select nutrient transporters, including glucose transporter 1 (Glut1) and sodium neutral amino acid transporter 1 (Snat1), within Sem-treated placentas (Fig. 4C). However, a significant upregulation in the mRNA levels of Lat1 and Snat2 was observed in the Sem-treated placentas (Fig. 4C).

Figure 4.

Maternal Sem injection impaired placenta development. A and B: placentas (E18.5) were weighted using an analytical scale. Fetal sex was determined by PCR. A: the average placenta weights (per litter) were analyzed. B: the fetal/placenta weight ratio was calculated using the single fetal measurement. C: the mRNA expression levels were determined by real-time PCR. D–F: the placenta sections were stained using the AP staining procedure. The section areas were measured using ImageJ software. D and E: the ratios of JZ or LB to the total area were calculated. G–K: the placental sections were probed by IF with an anti-CD31 antibody. The images were analyzed using ImageJ software to determine the capillary area and structure in the LB. *P < 0.05 vs. Con. AP, alkaline phosphatase; APC, area per capillary; CAD, capillary area density; CD31, cluster of differentiation 31; CND, capillary number density; CSD, capillary surface density; DC, decidua; IF, immunofluorescence; JZ, junctional zone; LB, labyrinth zone.

Although no discernible alterations were observed in placental weight, the placental cross-sectional areas of the labyrinth zone (LB) in the Sem group were notably reduced compared with the control group (Con) (Fig. 4, D–F). In contrast, Sem-treated placentas exhibited a significant increase in the junctional zone (Fig. 4, D–F).

In addition to trophoblast cells, the endothelial cells within the labyrinth zone (LB) constitute the vascular surface of the placenta, directly engaging with the placental blood supply. CD31, an established endothelial cell marker associated with angiogenesis and vascular permeability (28, 29), has been utilized in histologically assessing vascularity in nutrient-transferring tissues (30–32). Our findings revealed that Sem injection led to a significant reduction in LB capillary area density (CAD), capillary number density (CND), and capillary surface density (CSD; Fig. 4, G–I). Conversely, the area per capillary (APC), serving as a measure of capillary size, exhibited no significant difference between placentas from Sem-treated and control (Con) dams (Fig. 4J). Nevertheless, the vessel density, computed as the ratio of CD31 fluorescence intensity to the labyrinth area, was notably diminished in placentas from Sem-treated dams (Fig. 4K). Collectively, these results underscore that maternal GLP-1R activation results in the constriction of capillary branching, blood flow, and nutrient exchange within the placenta, even in the absence of significant alterations in capillary size.

DISCUSSION

GLP-1 is a hormone that plays a vital role in regulating food intake and energy metabolism, which are crucial for both maternal metabolic adaptation and fetal growth. In this study, we used mouse models to investigate the levels of GLP-1 in maternal blood during pregnancy. We found that the maternal blood GLP-1 concentration decreased progressively during pregnancy, contrary to the increase in pancreatic islet GLP-1 content (15, 19). We then administered the GLP-1R agonist Sem during late pregnancy. We found that it resulted in a significant decrease in fetal body weight and a notable reduction in the placental labyrinth area and capillary vessel density. Our study suggests that the decline in maternal circulating GLP-1 levels is an aspect of metabolic adaptation that benefits placental development and fetal growth.

Pregnancy increases food intake to meet the nutritional demands of placental development and fetal growth (33). GLP-1 is vital in reducing food intake (1, 2). Furthermore, activation of GLP-1R in early pregnancy reduces maternal food intake (27, 34). Previous studies in humans and animals have reported contradictory changes in maternal blood GLP-1 levels, possibly due to single-time-point measurements taken during gestation (16–19). In contrast, the present study involved the sequential collection of blood samples from the same mice before and during pregnancy. Our study revealed a progressive decline in maternal blood GLP-1 concentration throughout pregnancy. Therefore, the decrease in maternal blood GLP-1 concentration should align with the increased food intake during pregnancy. However, more direct evidence is crucial to support the argument that reduced blood GLP-1 increases maternal food intake.

Given the progressive decline in maternal blood GLP-1 concentration during pregnancy, the utilization of GLP-1RA serves as a justifiable approach to delineate the regulatory effect of GLP-1 on fetal growth. Previous animal studies reported that GLP-1RA treatment during early pregnancy significantly reduced fetal body weight (27, 34). Similar to a rat study (21), our study revealed a comparable inhibitory effect in mice (Fig. 2) upon administering GLP-1RA during late pregnancy. Notably, bariatric surgery, known to induce a significant increase in GLP-1 production (35, 36), has been associated with a significant reduction in birth weight and an elevated risk of small-for-gestational-age infants (36–39). A recent study further established the pivotal role of elevated GLP-1 in maternal bariatric surgery-associated fetal growth restriction (36). These collective findings underscore the suppressive effect of maternal GLP-1R activation on fetal growth.

Fetal body weight is mainly determined by organ development and tissue mass. Although it has been documented that early gestational Sem administration leads to minor adverse effects on fetal visceral and skeletal development (27, 34), neither the current study nor a prior investigation in rats detected any notable tissue structure abnormalities following GLP-1R activation during late pregnancy (21). Thus, our study suggests that the late pregnancy GLP-1R activation-induced reduction in fetal body weight predominantly arises from an inhibitory effect on fetal tissue growth or tissue mass.

It has been observed that maternal GLP-1R activation during early pregnancy leads to decreased food intake, which was believed to be the reason behind fetal growth restriction (27, 34). However, our current study and previous studies on rats have shown that GLP-1R activation during late pregnancy reduced fetal body weight without significantly affecting maternal food intake (Fig. 2; 21). Therefore, these observations suggest something other than maternal food intake in the GLP-1R activation-induced fetal growth restriction during late pregnancy.

The placenta is pivotal in fetal nutrient supply and growth. The trophoblast and endothelial cells provide an interface separating maternal and fetal circulations. Although GLP-1R activation during late pregnancy did not significantly alter placental weight, a reduction in the placental labyrinth zone was detected (Fig. 4). Since the labyrinth zone is responsible for nutrient exchange, the decrease of the placental labyrinth area should impact fetal nutrient supply. Accordingly, the expression levels of Glut1, Snat1, and CD36 were significantly reduced by Sem treatment (Fig. 4C). These results indicate that maternal GLP-1R activation alters placental development. However, additional comprehensive studies are warranted to directly ascertain the specific impacts on placental nutrient transport.

An adequate and unimpeded circulation system is a critical determinant for placental nutrient supply. Through histologically assessing the endothelial marker CD31, we indirectly investigated the placental vascular structure and blood flow. Our results showed that, despite the same size per capillary (measured by APC), maternal Sem treatment significantly reduced the vascular branching, the capillary nutrient exchange area, and blood flow (measured by CND, CSD, and CAD respectively, Fig. 4). These results indicate that in addition to the significantly reduced labyrinth zone, maternal GLP-1R activation alters placental vascular structure. These effects could undermine placental blood flow and then fetal nutrient supply.

Prior studies have reported the expression of GLP-1R in mouse endothelial cells and human trophoblast cells (20, 40, 41). Studies have also reported that GLP-1 increases nitric oxide synthase expression and then nitric oxide production in rat and mouse endothelial cells directly via GLP-1R (21, 42, 43). Therefore, we measured GLP-1R expression in mouse placentas to verify if maternal Sem treatment directly alters placenta and vascular development. To our surprise, no GLP-1R protein was detected in the mouse placental endothelial or trophoblast cells (Supplemental Fig. S1, A and B, maternal pancreases were used as positive control). Although our study cannot completely rule out the expression of GLP-1R in mouse placenta, the negative IHC (Supplemental Fig. S1A), IF (Supplemental Fig. S1B), and real-time PCR (data not shown) results do not support the notion that maternal Sem injection directly impairs placental and placental vascular development.

In Summary, the findings from the present study underscore the adaptive decline in maternal blood GLP-1 concentration during pregnancy. Notably, an excessive activation of GLP-1R impedes both placental development and fetal growth. Further comprehensive investigations are warranted to validate our findings in humans and to elucidate how pregnancy reduces GLP-1 in maternal circulation and its role in maternal metabolic adaptation.

DATA AVAILABILITY

The datasets and reagents generated during the current study are available from the corresponding author upon reasonable request.

SUPPLEMENTAL DATA

Supplemental Fig. S1: https://doi.org/10.6084/m9.figshare.24938826.v1.

GRANTS

This work was supported by NIH Grants R21HD112143 (to J.S.), R21HD111199 (to J.S.), R21HD107869 (to J.S.), DK095132 (to J.S.), and DK113007 (to J.S.).

DISCLAIMERS

Dr. Jianhua Shao is the guarantor of this work and, as such, has full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

J.S. conceived and designed research; L.Q., C.L., T.Z., and B.D. performed experiments; L.Q., C.L., and J.S. analyzed data; J.S. interpreted results of experiments; J.S. drafted manuscript; J.S. edited and revised manuscript; J.S. approved final version of manuscript.