Generation of iPSC line NCHi015-A from a patient with truncus arteriosus carrying heterozygous variants in KMT2D and NOTCH1

Abstract

Truncus arteriosus (TA) is a congenital heart defect where one main blood vessel emerges from the heart, instead of individual aorta and pulmonary artreries. Peripheral mononuclear cells (PBMCs) of a male infant with TA were reporogrammed using Sendai virus. The resultant iPSC line (NCHi015-A) displayed normal colony formation, expressed pluripotency markers, and differentiated into cells from three germ layers. NCHi015-A was matched to the patient’s genetic profile, had normal karyotype, retained genetic variants in KMT2D and NOTCH1, and tested negative for reprogramming transgene. This iPSC line can be used for studying congenital heart defects associated with genetic variants in KMT2D and NOTCH1.

1. Resource Table

Unique stem cell line identifier	NCHi015-A
Alternative name(s) of stem cell line	NCH178 (NCHi015-A)
Institution	Center for Cardiovascular Research, Abigail Wexner Research Institute, Nationwide Children’s Hospital, Columbus, OH, USA
Contact information of distributor	Mingtao Zhao, PhD Mingtao.Zhao@nationwidechildrens.org
Type of cell line	iPSC
Origin	Human
Additional origin info required for human ESC or iPSC	Age: 1 year Sex: Male Race: Caucasian, Non-Hispanic
Cell Source	Peripheral Blood Mononuclear Cells (PBMC)
Clonality	Clonal
Method of reprogramming	Sendai Virus vectors
Genetic Modification	Yes
Type of Genetic Modification	Congenital
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-PCR KOS Transgene Negative (Supplementary Fig. 1C)
Associated disease	Truncus Arteriosus Type I
Gene/locus	KMT2D: c.2868G > C (12q13.12); NOTCH1: c.1099 + 1G > T (9q34.3)
Date archived/stock date	05/18/2023
Cell line repository/bank	NCHi015-A (NCH178) is deposited in the iPSC repository of pediatric cardiovascular disease in the Center for Cardiovascular Research at the Abigail Wexner Research Institute at Nationwide Children’s Hospital in Columbus, OH, USA.https://hpscreg.eu/cell-line/NCHi015-A
Ethical approval	Generation of this iPSC line was under an approved Institutional Review Board (IRB) protocol STUDY00001788 “iPSC Repository of Pediatric Cardiovascular Disease” at Nationwide Children’s Hospital.

2. Resource utility

NCHi015-A is an iPSC line generated from the blood sample of an infant with truncus arteriosus carrying genetic variants in KMT2D and NOTCH1. This iPSC line can be differentiated into the cardiovascular lineage to study gene- and disease-related heart defects. The in vitro system can be used to understand abnormal genetic mechanisms, screen for novel therapeutics, and increase understanding of how variants in KMT2D and NOTCH1 affect normal cardiac development.

3. Resource details

Truncus arteriosus is a congenital heart defect in which one main blood vessel exits the heart, instead of an individual pulmonary artery and aorta, causing oxygenated and deoxygenated blood to mix (Sadiq & Sadiq, 2021; Yaoita et al., 2024). Here, we characterize an iPSC line derived from a male infant with truncus arteriosus type I carrying genetic variants in KMT2D (c.2868G > C) and NOTCH1 (c.1099 + 1G > T) (Table 1). We envision this iPSC line to be used as a patient-specific in vitro model to study abnormal cardiac development related to variants in KMT2D and NOTCH1 (Mansfield et al., 2022). Since the line retains the genetic composition of the patient, it creates a biological system to study congenital heart disease in humans (Lin et al., 2021).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography Phase Contrast	Normal	Fig. 1A
Phenotype	Qualitative analysis: Immunocytochemistry	Expression of TRA-1–60, NANOG, SOX2, OCT3/4	Fig. 1D
	Quantitative analysis: Immunocytochemistry counting	NANOG: 99 ± 1 % OCT3/4: 98 ± 2 % SOX2: 98 ± 2 %	Supp. Fig. 1A
Genotype	Karyotype (G-banding) and resolution	Normal karyotype: 46, XY Resolution 1–2 Mb	Fig. 1B
Identity	Microsatellite PCR (mPCR), STR analysis, SNP	mPCR not performed	N/A
		1.1 x 106 SNPs from iPSCs and PBMCs with > 99 % correlation	Available with authors
Mutation analysis	Sequencing	Heterozygous KMT2D c.2868G > C and NOTCH1 c.1099 + 1G > T variants	Fig. 1C(i–ii)
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Negative	Supp. Fig. 1B
Differentiation potential	Directed trilineage in vitro differentiation	Positive immunofluorescence staining of three germ layers. Ectoderm: PAX6, OTX2 Mesoderm: TBX6, BRACHYURY/TBXT Endoderm: FOXA2, SOX17	Fig. 1E
Donor screening	HIV 1 + 2, Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

NCHi015-A was established by transducing the isolated peripheral blood mononuclear cells (PBMC) of a male infant diagnosed with truncus arteriosus type I and diffusely hypoplastic branch pulmonary arteries using a Sendai virus harboring 4 Yamanaka factors. The resultant iPSC line displayed normal colony morphology (Fig. 1A), and the majority of the cells expressed pluripotency markers TRA-1-60, SOX2, NANOG, and OCT3/4 as visualized with immunofluorescence staining (Fig. 1D, Supp. Fig. 1A). Whole-genome array verified NCHi015-A retained a normal karyotype (46, XY, Fig. 1B), and iPSC identity was matched to donor PMBCs using SNP molecular fingerprinting with > 99 % correlation (data with authors). Pathogenic heterozygous point mutations in KMT2D c.2868G > C (p.Glu956Asp) and NOTCH1 c.1099 + 1G > T (Splice Donor) were also retained in iPSCs, as confirmed by Sanger sequencing (Fig. 1Ci–1Cii). Under directed differentiation, NCHi015-A had the ability to give rise to cells from all three germ layers. Immunofluorescence staining confirmed the expression of germ layer-specific markers. Ectodermal-like cells were detected by expression of PAX6 and OTX2, mesodermal-like cells displayed TBX6 and Brachyury, whereas endodermal-like cells expressed FOXA2 and SOX17 (Fig. 1E). The iPSCs tested negative for mycoplasma contamination and for the reprogramming transgene (Supp. Fig. 1B–1C).

4. Materials and methods

4.1. Reprogramming

Subject PBMCs were isolated and cultured for 1 week at 37 °C, 5 % CO₂ in StemPro-34 SFM medium (ThermoFisher Scientific) supplemented with 1x GlutaMAX (ThermoFisher Scientific), 20 ng/mL IL3 (PeproTech), 20 ng/mL IL6 (Gibco), 20 ng/mL EPO (ThermoFisher Scientific), 100 ng/mL SCF (PeproTech), and 100 ng/mL FLT3 (Thermo Fisher Scientific). CytoTune^™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher Scientific) was used to transduce 5 x 10⁵ PBMCs. Cells were resuspended in supplemented StemPro34 SFM in Matrigel-coated plates (1:300 in DMEM-F12) for one week, after which cells were supplemented with complete E8 medium (ThermoFisher Scientific). After two weeks, iPSC clones were picked, expanded, and preserved in liquid nitrogen.

4.2. iPSC maintenance and passaging

Human iPSCs were incubated at 37 °C with 5 % CO₂ until 90 % confluent. Cells were washed with DPBS and dissociated with 0.5 mM EDTA for 5–8 min. iPSCs were replated with complete E8 medium supplemented with ROCK inhibitor (Y-27632, Selleck Chemicals) at 1:6 ratio.

4.3. Immunofluorescence

Pluripotency markers were assessed by immunofluorescence staining and manual counting of positively stained iPSCs with SOX2, NANOG, and OCT3/4. A total of 10 fluorescent images over triplicate experimental iterations were counted and normalized to the total DAPI-positive cells. Human iPSCs (passage 12) were fixed with 4 % paraformaldehyde solution (Electron Microscopy Sciences) for 15 min then permeabilized with 0.1 % Triton X-100 solution (Sigma) for 20 min at room temperature. Cells were blocked with 0.2 % BSA (Sigma) in DPBS and then incubated overnight with primary antibodies (1:1000) at 4 °C. Next day cells were incubated with secondary antibodies (1:2000) in 0.2 % BSA for 1 h followed by counterstaining with DAPI (1:2000) at room temperature for 5 min. Coverslips were mounted using SlowFade Gold Antifade (ThermoFisher Scientific) and imaged with a fluorescent microscope (Leica).

4.4. Karyotyping and cell identity

Chromosomal integrity was assessed using whole genome array. iPSCs (2 x 10⁶ cells, passage 16) and donor PBMCs were pelleted and sent for KaryoStat + Assay with Cell ID (ThermoFisher Scientific). One million SNPs from PBMCs and NCHi015-A were correlated for cell identity.

4.5. Directed germ layer differentiation

Pluripotency was determined by differentiating iPSCs (passages 20–21) into endoderm and ectoderm lineages using Human Pluripotent Stem Cell Functional Identification Kit (R&D Systems). Mesoderm induction was achieved using 8 μM CHIR99021 (Selleck Chemicals) in RPMI 1640 media (ThermoFisher Scientific) with B27 minus insulin supplement (ThermoFisher Scientific) for two days. Germ layer-specific markers were confirmed with immunofluorescence staining.

4.6. Mycoplasma Detection

Human iPSC supernatant (passage 20) was screened for mycoplasma contamination using the MycoAlert^™ Detection Kit (Lonza).

4.7. Transgene Detection

Total RNA was extracted from iPSCs (passage 24) using Direct-zol RNA MiniPrep kit (Zymo Research) and reverse transcribed into cDNA using the iScript cDNA Synthesis kit (Bio-Rad). Primers for GAPDH and KOS (Table 2) were used to amplify cDNA by PCR for 30 cycles. Amplicons were visualized using 1 % Agarose gel electrophoresis.

Table 2.

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Marker	Rabbit anti-NANOG	1:1000	Cell Signaling Technology Cat# 4903P	AB_10559205
Pluripotency Marker	Mouse anti-TRA-1–60	1:1000	ThermoFisher Scientific, Cat# MAI-023X	AB_2536705
Pluripotency Marker	Rabbit anti-SOX2	1:1000	ThermoFisher Scientific, Cat# PAI-094X	AB_2539862
Pluripotency Marker	Mouse anti-OCT3/4	1:1000	BD Biosciences, Cat# 561,628	AB_10895977
Ectoderm Marker	Rabbit anti-PAX6	1:1000	ThermoFisher Scientific, Cat# 42–6600	AB_2533534
Ectoderm Marker	Goat anti–OTX2	1:1000	R&D Systems, Cat# AF1979	AB_2157172
Endoderm Marker	Mouse anti-FOXA2	1:1000	Abnova, Cat# H00003170-M10	AB_534871
Endoderm Marker	Goat anti-SOX17	1:1000	R&D Systems, Cat# AF1924	AB_355060
Mesoderm Marker	Rabbit anti-TBX6	1:1000	ThermoFisher Scientific, Cat# PA5-35102	AB_2552412
Mesoderm Marker	Goat anti-Brachyury	1:1000	R&D Systems, Cat# AF2085	AB_2200235
Secondary Antibody	Goat anti-Mouse IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific, Cat# A-11032	AB_2534091
Secondary Antibody	Goat anti-Mouse IgG (H + L), Alexa Fluor 488	1:2000	ThermoFisher Scientific, Cat# A-11001	AB_2534069
Secondary Antibody	Goat Anti-Rabbit IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific, Cat# A-11012	AB_2534079
Secondary Antibody	Donkey anti-Mouse IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific, Cat# R37115	AB_2556543
Secondary Antibody	Donkey anti-Rabbit IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific, Cat# R37119	AB_2556547
Secondary Antibody	Donkey anti-Goat IgG (H + L), Alexa Fluor 488	1:2000	ThermoFisher Scientific, Cat# A32814	AB_2762838
Primers	Target	Size of band	Forward/Reverse primer (5′-3′)
Housekeeping Gene	GAPDH	452 bp	F: ACCACAGTCCATGCCATCAC R: TCCACCACCCTGTTGCTGTA
Transgene	KOS	528 bp	F: ATGCACCGCTACGACGTGAGCGC R: ACCTTGACAATCCTGATGTGG
Genotyping	KMT2D	407 bp	F: CATCTGGGGAGCCATCCTTGTC R: GAGGAGGAAGGGGCTCCATCAG
Genotyping	NOTCH1	584 bp	F: GGACAGGGAGCTCAGGGAGTG R: AGGCAGCGGCGGTCAGTG

4.8. Genotyping

Heterozygous mutations in NOTCH1 and KMT2D were previously detected via whole exome sequencing and confirmed by PCR using primers flanking each variant (Table 2). Amplicons were purified using the DNA Clean & Concentrator Kit (Zymo Research) and sent for Sanger sequencing using the forward primer for each gene of interest (Eurofins Scientific).