Abstract
Purpose
Celiac disease (CD) is a chronic autoimmune disorder with a common genetic pathogenesis with type 1 diabetes (T1D). This study aimed to investigate the immune regulation in patients with both CD and T1D.
Methods
A total of 29 CD patients, 29 T1D patients, and 16 patients with both CD and T1D, along with 30 healthy controls (HCs) were included. The mRNA expression levels of TNF-α, IL-6, IL-2, and CTLA4 were evaluated in peripheral blood samples.
Results
The results showed that in patients with CD, T1D and CD/T1D, TNF-α mRNA levels were significantly increased (P = 0.0009, 0.0001, and 0.008, respectively), while CTLA4 mRNA levels were significantly decreased in them compared to the control group (P = 0.0009, 0.0001, and 0.004, respectively). IL-2 mRNA expression levels were also significantly higher in CD (P = 0.01) and comorbid CD/T1D (P = 0.01) patients than in the control group. There was no significant difference in terms of IL-6 expression between studied groups (P > 0.05).
Conclusions
TNF-α mRNA exhibited potential diagnostic value for distinguishing CD, T1D, and comorbid CD/T1D patients from HCs. These findings contribute to our understanding of the shared genetic factors and potential mechanisms underlying CD and T1D, which can aid in improved diagnostic methods and treatment approaches for these conditions.
Keywords: Celiac disease, Type 1 diabetes, mRNA expression, Tumor necrosis factor
Introduction
Celiac disease (CD) is a chronic autoimmune disorder caused by gluten consumption in individuals with specific HLA risk factors (HLA-DQ2 and HLA-DQ8), leading to small intestinal damage and nutrient malabsorption [1–3]. CD presents with a diverse range of clinical manifestations, which encompass, but are not restricted to, weight loss, diarrhea, abdominal pain, fatigue. Additionally, in specific instances, CD may persist without displaying any noticeable symptoms [4, 5]. Type 1 diabetes (T1D), as an autoimmune disease induced by the destruction of insulin producing cells in pancreatic islets, is considered as one of the prominent CD-associated disorders, and their coexistence may lead to significant challenges in managing each of these clinical conditions [6]. Actually, there is an intricate interplay of genetic factors in the development of these two autoimmune conditions and HLA DQ2 and DQ8 molecules underscore the shared genetic susceptibility between them [7]. Moreover, CD and T1D have clinical and pathogenic overlaps and certain cytokines and inflammatory mediators are known to contribute to this co-occurrence [8]. For example, Rezaei Tavirani et al. conducted a screening analysis to investigate the common Non-HLA genes impacted by both CD and T1D [9]. Two separated networks of 2000 and 430 genes were constructed related to T1D and CD, respectively. There were 11 common hubs between the two networks. TNF was reported as a central mediator in immune responses for both CD and T1D and Interleukin (IL)-6, IL-2 and Cytotoxic T lymphocyte-associated protein 4 (CTLA4) were among common hubs of these two disorders.
TNF, a potent pro-inflammatory cytokine, is primarily synthesized by macrophages and T cells, and its involvement represents a critical factor in the pathogenesis of CD and T1D [10]. In CD, TNF is believed to contribute to the chronic intestinal inflammation and tissue damage observed. Studies have shown elevated levels of TNF in the intestine of individuals with CD, reflecting an ongoing immune response [9]. One aspect of TNF’s involvement in T1D pathogenesis is its role in promoting beta cell apoptosis or programmed cell death. TNF triggers a cascade of events that result in mitochondrial dysfunction, endoplasmic reticulum stress, and activation of pro-apoptotic pathways within beta cells [11]. IL-6 induces the activation of lymphocytes and the release of various cytokines in CD [12]. Moreover, it induces alterations in cellular tight junctions (TJ), which play a critical role in the permeability of gluten into the lamina propria [12, 13]. Substantial evidence suggests that IL-6 enhances susceptibility to T1D by exacerbating inflammation within pancreatic islets [14, 15], This is achieved by inhibiting the expression of FOXP3 and promoting the migration of lymphocyte, consequently leading to apoptosis of β-cells [15, 16]. The role of IL-2 in CD and T1D pathogenesis is also well established [17, 18]. In the context of CD, IL-2 exhibits an inflammatory function, leading to apoptosis of epithelial cells and atrophy of intestinal villi [17]. Conversely, IL-2 performs a dual role in T1D. It acts as an inflammatory agent upon binding to the receptor on T-effector cells. Simultaneously, it exerts a protective function by reducing inflammation when binding to the receptor on regulatory T-cells (T-reg cells). Thus, IL-2’s contribution to T1D involves both pro-inflammatory and anti-inflammatory mechanisms, thereby influencing the disease pathology [18]. The CTLA4 gene locus is located near genes associated with autoimmune diseases like T1D and CD [18]. Latest research suggests that this gene plays a vital role in safeguarding genetically vulnerable individuals from T1D. By activating and proliferating regulatory T cells, it effectively reduces inflammation, prevents β-cell apoptosis, and hinders T1D progression [19, 20]. CTLA-4 functions as a negative regulator of T cell activation, serving to downregulate immune responses and prevent excessive inflammation in CD. It competes with another protein, CD28, for binding to the antigen-presenting cells (APCs) that present gluten peptides to T cells [21].
The current study aimed to investigate the immune regulation in patients with combined T1D and CD due to the lack of research in this area. It is important to explore shared genes and find biomarkers to manage and control disease severity, especially when two diseases are present simultaneously. Therefore, the mRNA expression levels of TNF-α, IL-6, IL-2 and CTLA4 were evaluated in peripheral blood (PB) samples of CD, T1D and subjects with these two conditions in comparison with healthy control (HC) subjects.
Materials and methods
Clinical samples
In this study, a total of 29 patients diagnosed with CD without T1D or other autoimmune diseases were included (median age (mean ± SD) of 23.79 ± 12.85 years). Among them, 15 were males and 14 were females. Additionally, 29 patients with T1D without CD or other autoimmune diseases (14 males and 15 females) were included (median age (mean ± SD) of 12.9 ± 5.253 years). 16 patients who diagnosed with both CD and T1D, with a median age (mean ± SD) of 21.38 ± 9.899 years were also included. Among these patients, 10 were males and 6 were females. The diagnosis of CD in confirmed cases was based on serological tests including anti-tTG IgA along with total IgA, histopathology (using the Marsh classification), and genetic testing (HLA-DQ Typing). The diagnosis of T1D in confirmed cases was based on HbA1C, FBS tests, and clinical manifestations. Patients diagnosed with both CD and T1D simultaneously underwent tests specific to the diagnosis of each disease. All patients were selected from individuals referred and admitted to Taleghani Hospital and Mofid Children’s Hospital in Tehran, Iran, between August 2020 and November 2022.
A control group consisting of 30 healthy subjects with no history of T1D, CD, or other autoimmune diseases, as well as no history of chronic digestive system diseases, cancer, digestive surgeries, other types of diabetes, or pregnancy and lactation. The control group had a median age (mean ± SD) of 24.13 ± 13.01 years and included 15 males and 15 females.
Fresh whole blood samples, approximately 10 ml each, were collected from the studied groups using standard venipuncture technique and EDTA anticoagulant tubes.
RNA extraction and complementary DNA synthesis
Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) using the RNA extraction kit for blood cell/tissue (Yekta tajhiz Azma, Tehran, Iran) according to the provided protocol. The purity of the isolated RNA was measured by spectroscopy (Nanodrop, Thermo Scientific NanoDrop Products, Wilmington, DE, USA). cDNA synthesis was performed using the 2X RT-PCR kit (Taq), Pre-Mix (BioFact, Japan Cat.No: BR861-050), according to the protocol.
Gene expression analysis
Appropriate primers for TNF-α, IL-6, IL-2, CTLA4 and Beta-2 Microglobulin (β2MG), as an internal control, were designed and analyzed by Gene Runner v. 6.0 software (Table 1).
Table 1.
Specific primers used for real-time quantitative PCR
| Gene symbol | Primer sequence |
|---|---|
| IL-2 | F:5´ TACATGCCCAAGAAGGCCAC 3´ |
| IL-2 | R:5´ AGCACTTCCTCCAGAGGTTTG 3´ |
| IL-6 | F:5´ ACTCACCTCTTCAGAACGAATTG 3´ |
| IL-6 | R:5´ CCATCTTTGGAAGGTTCAGGTTG 3´ |
| CTLA4 | F:5´ TGATGGGGAATGAGTTGACC 3´ |
| CTLA4 | R:5´ GGTAGTATGGCGGTGGGTA 3´ |
| TNF-α | F:5´ CCGAGGCAGTCAGATCATCTT 3´ |
| TNF-α (Reverse) | R:5´ AGCTGCCCCTCAGCTTGA 3´ |
| β2MG(Forward) | F:5’-CCAGCGTACTCCAAAGATTC-3’ |
| β2MG(Reverse) | R:5’-ATGTCGGATGGATGAAACCC-3’ |
The mRNA expression levels of desired genes were measured using real-time polymerase chain reaction (PCR). The reactions were performed using a final volume of 20 µl and SYBR Premix Ex Taq (RealQ Plus 2x Master Mix Green-Amplicon, Japan). The Rotor-Gene Q series was utilized, and the reactions were carried out under the following conditions: initial denaturation at 95 °C for 15 min, followed by 40 cycles of 20 s at 95 °C and 60 s at 60 °C. To determine the changes in gene expression levels, the 2−ΔΔCt Method was employed (ΔCt = Ct gene– Ct control).
Statistical analysis
Statistical analysis was performed using SPSS (V.21) and GraphPad Prism (V.9.7). The investigated variables in this study were compared with one-way ANOVA. The diagnostic value of TNF-α, IL-6, IL-2 and CTLA4 PB mRNA expression in distinguishing CD, T1D and simultaneous CD and T1D patients from HCs was also evaluated using the receiver operating characteristic (ROC) curve. P values ≤ 0.05 were considered significant.
Result
Clinical characteristics of study subjects
Among CD patients, bloating and depression were the most commonly reported typical (51.7%), and atypical symptoms (72.4%). In contrast, blurred vision and neurological problems were the most common typical and atypical symptoms among T1D patients (48.3% Vs 69%). For individuals diagnosed with both CD and T1D, bloating was the most common typical symptom of CD (43.8%), while thirst emerged as the most common typical symptom associated with T1D (56.3%). Additionally, fatigue was reported as a most common atypical symptom (68.8%) (Fig. 1).
Fig. 1.
Typical and atypical symptoms in patients with (A) celiac disease (B) type 1 diabetes (C) both celiac disease and type 1 diabetes
mRNA expression of TNF-α, IL-6, IL-2 and CTLA4
The relative transcript levels of TNF-α, IL-6, IL-2 and CTLA4 genes were analyzed using β2MG as a housekeeping control. The results revealed that the expression of TNF-α mRNA was significantly increased in patients with CD (P = 0.0009), T1D (P = 0.0001), and CD and T1D simultaneously (P = 0.008), as compared to the HCs. The expression of IL-2 mRNA was found to be significantly increased in patients with CD (P = 0.01) and CD and T1D simultaneously (P = 0.01) compared to the HCs. Conversely, the expression of CTLA4 mRNA was significantly decreased in patients with CD (P = 0.0009), T1D (P = 0.0001), and CD and T1D simultaneously (P = 0.004) as compared to the control group. No significant differences were observed in the expression levels of IL-6 mRNA between patients with CD, T1D, CD and T1D simultaneously, and control subjects (P > 0.05) (Fig. 2).
Fig. 2.
Analysis of relative expression levels in CD, T1D and CD and T1D CD and T1D simultaneously compared to normal controls using real-time PCR assay. All expression levels are normalized to that of β2MG. The analyzed genes were as follows: (A) TNF-α, (B) IL-2, (C) CTLA4 and (D) IL-6. Data are presented as mean ± S.D. CD: celiac disease, T1D: type 1 diabetes, β2MG: beta-2 micro globulin
ROC curve analysis
In order to evaluate the effectiveness of TNF-α, IL-6, IL-2 and CTLA4 mRNA expression as diagnostic markers for distinguishing CD, T1D and both CD and T1D patients from controls, ROC curve analyses were conducted. The Youden index was utilized to determine the optimal cutoff values. Figure 3 illustrates that TNF-α mRNA exhibited the ability to differentiate CD patients with 40% sensitivity and 95% specificity (P = 0.001), T1D with 82% sensitivity and 40% specificity (P = 0.001), and coexisting CD and T1D with 40% sensitivity and 100% specificity (P = 0.007) from the control group (Fig. 3).
Fig. 3.
ROC curve analysis of IL-2, IL-6, CTLA4 and TNF-α mRNA levels for distinguishing between CD, T1D, both CD and T1D simultaneously patients and controls
Discussion
Due to the documented cases of co-occurrence of CD and T1D, it becomes crucial to prioritize the identification and exploration of common genes between these two conditions. Unraveling the shared genetic factors underlying CD and T1D holds immense significance in advancing our understanding of these complex autoimmune disorders. By studying the common genetic components, researchers can gain valuable insights into the potential mechanisms and pathways that contribute to the development and progression of both diseases. This knowledge can lead to improved diagnostic methods and innovative treatment approaches for individuals affected by CD and T1D. The findings of our study demonstrate significant alterations in the mRNA expression levels of IL-2, CTLA4, and TNF-α genes in patients with CD, T1D, and individuals affected by both CD and T1D compared to the control group. These observations are in line with previous studies highlighting the existence of a shared genetic background and common genes involved in the pathogenesis of CD and T1D [22, 23].
Hagopian et al. in their cohort study on children at high genetic risk of both CD and T1D, identified non-HLA genes such as TNF-α, IFN-γ, IL-2, IL-6, IL-15, CTLA4, and TLR4 as significant contributors to the development and susceptibility of CD and T1D [24]. Our results support these findings by revealing a significant increase in the expression level of IL-2 in CD patients and CD/T1D comorbid patients compared to the control group. Similar observations have been reported in other studies conducted by Carthy et al. [25] and Ganjali et al. [26], which demonstrated elevated IL-2 levels in CD patients supporting the role of IL-2 in the pathophysiology of CD. Furthermore, stimulation with gluten peptide in CD patients by Goel G et al. [27] resulted in increased IL-2, IL-6, and TNF-α levels, indicating the activation of gluten-specific TCD4 + cells and subsequent production of inflammatory cytokines. However, the expression of IL-2 in T1D patients has shown conflicting results in various studies. Some report decreased levels, while others observe no significant difference compared to healthy individuals. These discrepancies could be attributed to variations in TCR complex signaling, leading to changed IL-2 expression [28].
We also observed a significant increase in the mRNA expression of TNF-α. This increase was seen in patients with CD, T1D, and those with comorbid CD/T1D. Given TNF-α’s indispensable role as an inflammatory cytokine involved in the modulation of other inflammatory mediators, the observed elevation in its expression within these pathological conditions is anticipated [29]. While numerous studies have found an elevation of TNF-α in CD, the findings regarding TNF-α levels in T1D patients have been inconsistent [30–32]. Vorobjova et al. [33] reported no increase in TNF-α levels in CD/T1D comorbid patients, which differs from our findings. According to our results, the high sensitivity and specificity of TNF-α make it a potential diagnostic biomarker for distinguishing CD, T1D, and comorbid CD/T1D patients from HCs. This potential diagnostic value holds significant promise for improving patient’s overall healthcare management. By elucidating the role of this biomarker in shaping disease trajectories and treatment responses, we can advance towards a more tailored and patient-centric approach to healthcare. Robust assessment of this biomarker may aid in earlier diagnosis and more efficient management of these conditions.
CTLA4 mRNA showed reduced expression in PB samples of CD, T1D, and comorbid CD/T1D patients related to the HCs. A robust correlation was observed between a prevalent CTLA4 haplotype and CD previously [34]. A notable decrease in CTLA-4 expression was also observed in CD4 + helper T-cells extracted from individuals diagnosed with fulminant T1D [35]. Research has demonstrated that CTLA-4 plays a crucial role in regulating various aspects of the immune system. It is known to be essential in reducing the proliferation of effector T cells inhibited by Tregs, restraining the release of inflammatory cytokines, and promoting the maturation of inducible Treg (iTreg) cells [36]. Considering the favorable impact of CTLA4 in reducing inflammatory responses, the diminished expression of CTLA4 might have unfavorable implications for patients afflicted with these conditions, necessitating further investigations to ascertain its precise implications.
In our study, no significant differences were observed in the expression levels of IL-6 mRNA among patients with CD, T1D, CD/T1D comorbidity, and the control group. Similar finding has been reported in the study conducted by Bel’mer et al. [37]. However, previous studies have shown elevated levels of IL-6 in CD patients, which could be influenced by other cytokines such as IL-1β and IFN-γ [38]. Interestingly, Porpora M et al. [39] observed an increase in IL-6 specifically produced by intestinal enterocytes in CD patients. The diverse expression levels of IL-6 in different studies suggest complex interactions and environmental factors contributing to its regulation.
There are some limitations that should be acknowledged. The sample size of the study was relatively small consisted of young adults, which may limit the generalizability of the findings to broader populations. The study did not account for certain confounding variables, such as environmental factors, which could have impacted the results. Moreover, the methods used for data collection and analysis may have their own limitations, potentially affecting the robustness of the conclusions drawn. Future studies should consider more diverse samples and incorporate objective measures to provide a more comprehensive understanding of the complex interplay between these two disorders.
In conclusion, our study contributes to the understanding of gene expression patterns in CD, T1D, and the overlap between these conditions. The significant alterations observed in IL-2, TNF-α, and CTLA4 mRNA levels suggest their involvement in the pathogenesis of these diseases. However, it is crucial to consider the complex interplay of genetic and environmental factors influencing gene expression and disease development. Further investigations are warranted to elucidate the precise mechanisms underlying these observations and to explore additional genes contributing to the pathogenesis of CD, T1D, and CD/T1D comorbidity. Exploring epigenetic modifications can reveal the complex interplay between genetics and the environment in driving these autoimmune diseases. Longitudinal studies can provide insight into disease progression, aiding in the development of tailored treatment strategies. These research avenues offer the potential to enhance our understanding of the molecular basis of these conditions and support more personalized approaches to diagnosis and management. Our results also provide valuable insights into the potential utility of TNF-α mRNA as a diagnostic marker in distinguishing CD, T1D and the coexistence of CD and T1D from HCs, but further validation and exploration are necessary to establish its clinical sign.
CRediT authorship contribution statement
Sayyad Malekahmadi: Investigation, Methodology, Writing– original draft. Nastaran Asri: Formal analysis, Visualization, Project administration, Writing– review & editing. Flora Forouzesh: Data curation, Validation. Hedyeh Saneifard: Methodology. Mostafa Rezaei Tavirani: Writing– review & editing. Mohammad Rostami-Nejad: Conceptualization, Data curation, Validation, Writing– review & editing, Supervision.
Acknowledgements
The authors would like to acknowledge Celiac Disease and Gluten Related Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran.
Data availability
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Declarations
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Taraghikhah N, Ashtari S, Asri N, Shahbazkhani B, Al-Dulaimi D, Rostami-Nejad M, et al. An updated overview of spectrum of gluten-related disorders: clinical and diagnostic aspects. BMC Gastroenterol. 2020;20:1–12. doi: 10.1186/s12876-020-01390-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Rostami-Nejad M, Asri N, Olfatifar M, Khorsand B, Houri H, Rostami K. Systematic review and dose-response meta-analysis on the relationship between different gluten doses and risk of coeliac disease relapse. Nutrients. 2023;15(6):1390. doi: 10.3390/nu15061390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rostami Nejad M. Clinical and histological presentation of Helicobacter pylori and gluten related gastroenteropathy. Arch Iran Med. 2011;14(2):115–118. [PMC free article] [PubMed] [Google Scholar]
- 4.Kupper C. Dietary guidelines and implementation for celiac disease. Gastroenterology. 2005;128(4):S121–7. doi: 10.1053/j.gastro.2005.02.024. [DOI] [PubMed] [Google Scholar]
- 5.Barker JM, Liu E. Celiac disease: pathophysiology, clinical manifestations, and associated autoimmune conditions. Adv Pediatr. 2008;55(1):349–65. doi: 10.1016/j.yapd.2008.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Cohn A, Sofia AM, Kupfer SS. Type 1 diabetes and celiac disease: clinical overlap and new insights into disease pathogenesis. Curr Diab Rep. 2014;14:1–8. doi: 10.1007/s11892-014-0517-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Simmons KM, Michels AW. Type 1 diabetes: a predictable disease. World J Diabetes. 2015;6(3):380. doi: 10.4239/wjd.v6.i3.380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Farina F, Picascia S, Pisapia L, Barba P, Vitale S, Franzese A, et al. HLA-DQA1 and HLA-DQB1 alleles, conferring susceptibility to celiac disease and type 1 diabetes, are more expressed than non-predisposing alleles and are coordinately regulated. Cells. 2019;8(7):751. doi: 10.3390/cells8070751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Rezaei-Tavirani S, Rostami-Nejad M, Vafaee R, Khalkhal E, Keramatinia A, Ehsani-Ardakani MJ, et al. Introducing tumor necrosis factor as a prominent player in celiac disease and type 1 diabetes mellitus. Gastroenterol Hepatol Bed Bench. 2019;12(Suppl1):S123–9. [PMC free article] [PubMed] [Google Scholar]
- 10.Rezaei-Tavirani S, Rostami-Nejad M, Vafaee R, Khalkhal E, Keramatinia A, Ehsani-Ardakani MJ, et al. Introducing tumor necrosis factor as a prominent player in celiac disease and type 1 diabetes mellitus. Gastroenterol Hepatol Bed Bench. 2019;12(Suppl1):S123. [PMC free article] [PubMed] [Google Scholar]
- 11.Stephens LA, Thomas HE, Ming L, Grell M, Darwiche R, Volodin L, et al. Tumor necrosis factor-alpha-activated cell death pathways in NIT-1 insulinoma cells and primary pancreatic beta cells. Endocrinology. 1999;140(7):3219–27. doi: 10.1210/endo.140.7.6873. [DOI] [PubMed] [Google Scholar]
- 12.Zanella I, Paiardi G, Di Lorenzo D, Biasiotto G. Iron absorption in celiac disease and nutraceutical effect of 7-hydroxymatairesinol. Mini-review. Molecules. 2020;25(9):2041. doi: 10.3390/molecules25092041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Barartabar Z, Nikzamir A, Sirati-Sabet M, Aghamohammadi E, Chaleshi V, Rostami Nejad M, et al. The relationship between 174 G/C and– 572 G/C of IL-6 gene polymorphisms and susceptibility of celiac disease in the Iranian population. Prz Gastroenterol. 2018;13(4):293–8. doi: 10.5114/pg.2018.79808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Aljada B, Zohni A, El-Matary W. The gluten-free diet for celiac disease and beyond. Nutrients. 2021;13(11):3993. doi: 10.3390/nu13113993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hundhausen C, Roth A, Whalen E, Chen J, Schneider A, Long SA, et al. Enhanced T cell responses to IL-6 in type 1 diabetes are associated with early clinical disease and increased IL-6 receptor expression. Sci Transl Med. 2016;8(356):ra356119–356119. doi: 10.1126/scitranslmed.aad9943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lu J, Liu J, Li L, Lan Y, Liang Y. Cytokines in type 1 diabetes: mechanisms of action and immunotherapeutic targets. Clin Translational Immunol. 2020;9(3):e1122. doi: 10.1002/cti2.1122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Meresse B, Korneychuk N, Malamut G, Cerf-Bensussan N. Interleukin-15, a master piece in the immunological jigsaw of celiac disease. Dig Dis. 2015;33(2):122–30. doi: 10.1159/000369521. [DOI] [PubMed] [Google Scholar]
- 18.Jeker LT, Bour-Jordan H, Bluestone JA. Breakdown in peripheral tolerance in type 1 diabetes in mice and humans. Cold Spring Harbor Perspect Med. 2012;2(3):a007807. doi: 10.1101/cshperspect.a007807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gerold KD, Zheng P, Rainbow DB, Zernecke A, Wicker LS, Kissler S. The soluble CTLA-4 splice variant protects from type 1 diabetes and potentiates regulatory T-cell function. Diabetes. 2011;60(7):1955–63. doi: 10.2337/db11-0130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hoyne GF, Flening E, Yabas M, Teh C, Altin JA, Randall K, et al. Visualizing the role of Cbl-b in control of islet-reactive CD4 T cells and susceptibility to type 1 diabetes. J Immunol. 2011;186(4):2024–32. doi: 10.4049/jimmunol.1002296. [DOI] [PubMed] [Google Scholar]
- 21.Hunt KA, McGovern DP, Kumar PJ, Ghosh S, Travis SP, Walters JR, et al. A common CTLA4 haplotype associated with coeliac disease. Eur J Hum Genetics: EJHG. 2005;13(4):440–4. doi: 10.1038/sj.ejhg.5201357. [DOI] [PubMed] [Google Scholar]
- 22.Kayar Y, Dertli R. Association of autoimmune diseases with celiac disease and its risk factors. Pakistan J Med Sci. 2019;35(6):1548. doi: 10.12669/pjms.35.6.821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Nejad MR, Rostami K, Emami MH, Zali MR, Malekzadeh R. Epidemiology of celiac disease in Iran: a review. Middle East J Dig Dis. 2011;3(1):5. [PMC free article] [PubMed] [Google Scholar]
- 24.Hagopian W, Lee H-S, Liu E, Rewers M, She J-X, Ziegler A-G et al. Co-occurrence of type 1 diabetes and celiac disease autoimmunity. Pediatrics. 2017;140(5). DOI. [DOI] [PMC free article] [PubMed]
- 25.Cartee AK, King KS, Wang S, Dzuris JL, Anderson RP, Van Dyke CT, et al. Plasma IL-2 and symptoms response after acute gluten exposure in subjects with celiac disease or nonceliac gluten sensitivity. Official J Am Coll Gastroenterology| ACG. 2022;117(2):319–26. doi: 10.14309/ajg.0000000000001565. [DOI] [PubMed] [Google Scholar]
- 26.Lund-Blix NA, Dong F, Mårild K, Seifert J, Barón AE, Waugh KC, et al. Gluten intake and risk of islet autoimmunity and progression to type 1 diabetes in children at increased risk of the disease: the diabetes autoimmunity study in the Young (DAISY) Diabetes Care. 2019;42(5):789–96. doi: 10.2337/dc18-2315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Goel G, Tye-Din JA, Qiao S-W, Russell AK, Mayassi T, Ciszewski C, et al. Cytokine release and gastrointestinal symptoms after gluten challenge in celiac disease. Sci Adv. 2019;5(8):eaaw7756. doi: 10.1126/sciadv.aaw7756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Vang T, Congia M, Macis MD, Musumeci L, Orrú V, Zavattari P, et al. Autoimmune-associated lymphoid tyrosine phosphatase is a gain-of-function variant. Nat Genet. 2005;37(12):1317–9. doi: 10.1038/ng1673. [DOI] [PubMed] [Google Scholar]
- 29.Parameswaran N, Patial S. Tumor necrosis factor-α signaling in macrophages. Crit Rev Eukaryot Gene Expr. 2010;20(2):87–103. doi: 10.1615/critreveukargeneexpr.v20.i2.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gogitidze Joy N, Hedrington MS, Briscoe VJ, Tate DB, Ertl AC, Davis SN. Effects of acute hypoglycemia on inflammatory and pro-atherothrombotic biomarkers in individuals with type 1 diabetes and healthy individuals. Diabetes care. 2010;33(7):1529-35. DOI. [DOI] [PMC free article] [PubMed]
- 31.Lo H-C, Lin S-C, Wang Y-M. The relationship among serum cytokines, chemokine, nitric oxide, and leptin in children with type 1 diabetes mellitus. Clinical biochemistry. 2004;37(8):666– 72. DOI. [DOI] [PubMed]
- 32.Elfaitouri A, Berg AK, Frisk G, Yin H, Tuvemo T, Blomberg J. Recent enterovirus infection in type 1 diabetes: evidence with a novel IgM method. J Med Virol. 2007;79(12):1861–7. doi: 10.1002/jmv.21008. [DOI] [PubMed] [Google Scholar]
- 33.Vorobjova T, Tagoma A, Oras A, Alnek K, Kisand K, Talja I, et al. Celiac disease in children, particularly with accompanying type 1 diabetes, is characterized by substantial changes in the blood cytokine balance, which may reflect inflammatory processes in the small intestinal mucosa. J Immunol Res. 2019;2019. 10.1155/2019/6179243. [DOI] [PMC free article] [PubMed]
- 34.Hunt KA, McGovern DPB, Kumar PJ, Ghosh S, Travis SPL, Walters JRF, et al. A common CTLA4 haplotype associated with coeliac disease. Eur J Hum Genet. 2005;13(4):440–4. doi: 10.1038/sj.ejhg.5201357. [DOI] [PubMed] [Google Scholar]
- 35.Haseda F, Imagawa A, Murase-Mishiba Y, Sano H, Hirano-Kuwata S, Ueda H, et al. Low CTLA-4 expression in CD4 + helper T-cells in patients with fulminant type 1 diabetes. Immunol Lett. 2011;139(1):80–6. doi: 10.1016/j.imlet.2011.05.003. [DOI] [PubMed] [Google Scholar]
- 36.Hossen MM, Ma Y, Yin Z, Xia Y, Du J, Huang JY, et al. Current understanding of CTLA-4: from mechanism to autoimmune diseases. Front Immunol. 2023;14. 10.3389/fimmu.2023.1198365. [DOI] [PMC free article] [PubMed]
- 37.Freeman HJ. Iron deficiency anemia in celiac disease. World J Gastroenterology: WJG. 2015;21(31):9233. doi: 10.3748/wjg.v21.i31.9233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Vincentini O, Maialetti F, Gonnelli E, Silano M. Gliadin-dependent cytokine production in a bidimensional cellular model of celiac intestinal mucosa. Clin Experimental Med. 2015;15:447–54. doi: 10.1007/s10238-014-0325-2. [DOI] [PubMed] [Google Scholar]
- 39.Porpora M, Conte M, Lania G, Bellomo C, Rapacciuolo L, Chirdo FG, et al. Inflammation is present, persistent and more sensitive to proinflammatory triggers in celiac disease enterocytes. Int J Mol Sci. 2022;23(4):1973. doi: 10.3390/ijms23041973. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.