Skip to main content
Antioxidants logoLink to Antioxidants
. 2024 May 31;13(6):682. doi: 10.3390/antiox13060682

Palm Kernel Cake Extracts Obtained from the Combination of Bacterial Fermentation and Enzymic Hydrolysis Promote Swine Small Intestine IPEC-J2 Cell Proliferation and Alleviate LPS-Induced Inflammation In Vitro

Hui Zeng 1, Jingna Miao 1, Jinghong Liao 1, Zhiyuan Sui 1, Meixin Hou 1, Suqin Hang 1,*
Editors: Serkos A Haroutounian1, José Ángel Rufián-Henares1
PMCID: PMC11200965  PMID: 38929121

Abstract

Co-fermentation with bacteria and enzymes can reduce sugar content in palm kernel cake (PKC); however, the chemical changes and their effects on cell functionality are unclear. This study investigated the active components in pre-treated PKC extracts and their effects on pig small intestine IPEC-J2 cell proliferation and LPS-induced inflammation. The extracts contained 60.75% sugar, 36.80% mannose, 1.75% polyphenols and 0.59% flavone, as determined by chemical analyses, suggesting that the extracts were palm kernel cake oligosaccharides (PKCOS). Then, we found that 1000 µg/mL PKCOS counteracted the decrease in cell viability (CCK8 kit) caused by LPS induction by 5 µg/mL LPS (p < 0.05). Mechanistic studies conducted by RNA-seq and qPCR analyses suggested PKCOS promoted cell proliferation through the upregulation of TNF-α, PI3KAP1, MAP3K5 and Fos in the PI3K/MAPK signalling pathway; alleviated inflammation caused by LPS via the downregulation of the target genes Casp3 and TNF-α in association with apoptosis; and regulated the expression of the antioxidant genes SOD1, SOD2 and GPX4 to exert positive antioxidant effects (p < 0.05). Furthermore, PKCOS upregulated SLC5A1 (encoding SLGT1), HK and MPI in the glycolytic pathway (p < 0.05), suggesting cell survival. In summary, PKCOS has positive effects on promoting swine intestine cell proliferation against inflammation.

Keywords: proliferation, PI3K/MAPK pathway, anti-inflammatory, CASP3, SLC5A1

1. Introduction

Palm kernel cake (PKC), a by-product of the mannan-rich palm oil industry [1], has received close attention in recent years as an unconventional feed resource. Treatment with enzymes and microorganisms can increase the nutritional value of PKC, primarily by reducing the amount of cellulose and mannan [2]. Numerous active substances are produced during the process, including volatile organic compounds (VOCs), such as ketones, aromatic hydrocarbons and short-chain fatty acids (SCFAs); microbial metabolites, such as amino acids, enzymes and antibiotics [3,4]; and oligosaccharides [5], thus promoting PKCs’ use in livestock, particularly in monogastric animals which cannot secrete various cellulases. Oligosaccharides are short-chain polymers with a low molecular weight, and they consist of 2–10 monosaccharide units [6] and present specific biological activities, such as aiding in the proliferation of Bifidobacteria, the regulation of gastrointestinal function, anti-inflammatory responses and the reduction in disease [7,8].

Free radicals can be produced in many situations, such as physical conditions, chemical reactions and metabolic processes. When the body is subjected to an inflammatory stimulus, a significant increase in the production of free radicals occurs, resulting in their accumulation. The hydroxyl radical, one of the reactive oxygen species, is commonly formed in vivo and can cause serious damage to biomolecules, such as lipids, proteins and nucleic acids [9]. This damage can lead to inflammation-related diseases, such as inflammatory bowel disease (IBD) and bacterial diarrhoea, particularly severe diarrhoea, in weaned piglets [10]. Saccharides, which originate either from synthetic chemicals [11] or natural substances [12], were revealed to have strong radical scavenging abilities [13]. Natural antioxidants from organism extracts have recently received increased interest due to consumer concerns.

The small intestine is not only the main compartment of digestion and absorption but is also the first physical barrier against external factors. Pathogenic microorganisms, harsh environmental sanitation (such as unsuitable temperature and humidity) and weaning stress often cause reduced immunity and intestinal structural abnormalities, leading to dysfunction in piglets [14]. Lipopolysaccharide (LPS) is a major culprit in porcine intestinal injury and is associated with inflammation, apoptosis, proliferation, differentiation and host immune activation [15]. Therefore, gut health is crucial to maintaining the integrity of small intestine functions and host health [16,17]. Porcine epithelial cells (IPECs) are the first barrier against exogenous antigens, pathogens and toxins entering the circulatory system, including cyto-inflammatory factors, such as tumour necrosis factor-α (TNF-α) and interleukin-6 (IL-6) [18]. The IPEC-J2 cell line, well-known as the swine jejunal epithelial cell line, is isolated from newborn piglets and is widely used for studying gut inflammation responses, immunity and barrier integrity in vitro [19,20]. A study showed that chitosan oligosaccharides could attenuate LPS-induced inflammation in IPEC-J2 cells by modulating the TLR4/NF-κB signalling pathway [21]. However, it is worth noting that cellular life processes, particularly cell proliferation and anti-inflammation, are linked to glycolysis [22]. For example, cell proliferation and differentiation, free radical scavenging and autophagy all require energy [23,24].

Our previous study demonstrated that the use of bacterial fermentation integration with complex enzymatic hydrolysis effectively degraded cellulose in PKC and produced a large amount of reducing sugars [25], which may be rich in potentially positive functional substances, such as oligosaccharides [26]. However, studies focused on extracts, mainly oligosaccharides derived from PKC and their potential effects, particularly on gut intestinal health, are rare and have yet to be further explored. Our hypothesis is that palm kernel cake oligosaccharides (PKCOS) can enter the cell via glucose transporters and have a positive impact on the life process of IPEC-J2. In this study, PKCOS was first extracted from pre-treated PKC and then partially characterised to evaluate its antioxidant activity. Finally, the effects of PKCOS on gut epithelial functions using the IPEC-J2 cell line as a model were investigated. This study will contribute to the development of novel multifunctional substances that can strengthen the health of animal gut intestines.

2. Materials and Methods

2.1. Materials and Chemicals

Lipopolysaccharide (LPS), purchased from Yuanye Lot., Shanghai, China, was prepared by dissolution in phosphate buffer saline (PBS) purchased from Solaibold Lot., Beijing, China, and then stored at −20 °C. Foetal bovine serum (FBS) was purchased from Tianhang Lot. (Huzhou, China). TRIzol was purchased from Biosharp Lot. (Beijing, China). Gene sequences were designed by Accurate Biology Lot. (Changsha, China) and purchased from Qingke Lot. (Nanjing, China). All the primer sequences are shown in Table 1. Other reagents were purchased from Solaibold Lot. (Beijing, China), such as dimethyl sulfoxide (DMSO) and Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12).

2.2. Preparation of PKCOS and Content Analysis

According to the description of the previous study by Xiang [27], slight modifications were made. In brief, pre-treated PKC were extracted twice using 50% ethanol at a ratio of 1:20 (PKC to ethanol, m/v) for 1 h at 60 °C. The extracted solution was centrifuged at 4000 rpm/min for 5 min, and then the supernatant was freeze-dried (LGJ-10, Deyang Yibang Lot., Shanghai, China). Finally, the freeze-dried powder was dissolved in DMSO to prepare a stock solution of 1000 µg/mL for cell assays or a stock solution of PBS 20 mg/mL for chemical analysis including total sugars, mannose and polyphenols. Everything was stored at −20 °C.

The total sugars and proteins were determined using the phenol–sulphuric acid colorimetric method [28] and Coomassie Bright Blue (Beyotime Lot., Beijing, China), respectively. Mannose was analysed using the procedure reported by Qi [29]. The determination of polyphenols and flavonoids referred to Adom’s method [30], and were denoted as rutin and gallic acid equivalents (mg/g PKCOS).

2.3. In Vitro Antioxidant Evaluation of PKCOS

Total antioxidant capacity (T-AOC), hydroxyl radical (•OH) inhibition rate and 1,1-diphenyl-2-picryl-hydrazyl radical scavenging rate (•DPPH) were all measured according to the kit instructions (Jiancheng, Lot., Nanjing, China).

2.4. IPEC-J2 Cell Line and Culture In Vitro

IPEC-J2 cells were donated by Weiyun Zhu, a faculty member at Nanjing Agricultural University. The thawed IPEC-J2 cells were first seeded in T75 cell culture dishes (Corning Lot., Corning, NY, USA) and then cultured in DMEM/F12 supplemented with 10% FBS and 1% penicillin–streptomycin at 37 °C in humidified air containing 5% CO2 until the cell density reached nearly 80%. The cells were passaged for the following experiments.

2.5. Effects of PKCOS on Cell Viability and Underlying Mechanisms

2.5.1. Effects of PKCOS and LPS on IPEC-J2 Cell Viability

The IPEC-J2 cells were seeded in 96-well plates (Corning Lot., Corning, NY, USA) at a density of 4 × 104 cells/mL in the culture medium overnight. Then, the cells were treated by either 0, 1, 20, 50, 100, 250, 500 or 1000 µg/mL PKCOS contained in DMEM/F12 medium for 6 h or treated by 0, 0.1, 1, 5, 10 or 20 µg/mL LPS contained in DMEM/F12 medium for 12 h, respectively. In the end, the cell survival rate was detected. The trial was repeated for three batches, each containing 6 replicates. Then, appropriate concentrations of PKCOS and LPS were obtained based on survival for further studies.

The cells were treated with the appropriate concentration of LPS (5 µg/mL) for 12 h, and then the appropriate concentration of PKCOS (0, 250, 500 µg/mL or 1000 µg/mL) was added in each well and cultured for 6 h to determine whether PKCOS could alleviate the damage induced by LPS on IPEC-J2. Similarly, cell viability was determined at the end of the culture, and the trial was repeated for three batches, with 6 replicates in each batch.

2.5.2. Mechanistic Exploration of PKCOS’s Effects on the Survival Rate of IPEC-J2 Cells with or without LPS

To explore the underlying mechanisms of the effects of PKCOS on cell survival rate with or without LPS, cells were cultured in 10 cm cell culture dishes (Corning, USA) and divided into five groups, namely, the control group, named CT, treated by PBS; the DMSO group, treated by DMSO (PKCOS was dissolved in DMSO); the PKCOS group, treated by the appropriate concentration of PKCOS selected from above (1000 µg/mL) for 6 h; the LPS group, treated by the selected appropriate concentration of LPS above (5 µg/mL) for 12 h; and the LPS-PKCOS group, treated by LPS for 12 h and then supplemented with PKCOS for 6 h. Finally, cells from the five treatments were collected, and the RNA was extracted by TRIzol reagent and then stored at −80 °C for future RNA-seq and qPCR analyses. Three replicates were performed in each group/treatment (n = 3).

2.6. Cell Survival Rate Assay

The cell survival rate was determined via the CCK-8 assay according to the manufacturer’s instructions (Baiscience Lot., Beijing, China) and expressed as a viability percentage according to the following formula:

Cell survival rate %=absorbance of treatment- absorbance of blankabsorbance of control- absorbance of blank × 100%

2.7. Bioinformatics Analysis and qPCR

According to a previous study [31], the procedure of RNA extraction from the IPEC-J2 cells was performed based on the manufacturer’s instructions (Invitrogen, Waltham, MA, USA), and genomic DNA was removed using DNase I (TaKara. Lot., Beijing, China). RNA quality was tested using a 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA) and quantified by ND-2000 NanoDrop (Thermo Scientific, Wilmington, DE, USA), respectively. Subsequently, cDNA libraries were created following the instructions of the TruSeqTM RNA sample preparation kit (RS-122-2101, Illumina, San Diego, CA, USA), and sequencing was performed via Illumina NovaSeq 6000 sequencing (BIOZERON Co. Ltd., Shanghai, China). A p-value < 0.05 was used as a criterion to identify differentially expressed genes (DEGs). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed using Kobas (http://Kobas.cbi.pku.edu.cn/home.do, accessed on 15 November 2023).

All samples were kept at a constant RNA concentration of 500 ng/μL using enzyme-free water. qPCR was conducted using the SYBR Green Premix Pro Taq HS qPCR Kit (AG11718, Agbio Lot., Changsha, China) on a QuantantStudio7 Flex (ABI). The reaction system for qPCR consisted of 20 μL, with a template addition of 20 ng. The qPCR procedure was as follows: Step 1: 95 °C for 30 s, repeated 1 time; Step 2: 95 °C for 5 s, followed by 60 °C for 30 s, repeated 40 times. The primer sequences used are listed in Table 1, showing that the antioxidant gene primers are consistent with those reported in the literature [32,33]. Finally, using the 2−ΔΔCq method, the relative expression of the target genes was assessed.

Table 1.

Real-time fluorescence quantification of gene sequences and primer information.

Gene Version Forward Primer (5′-3′) Reverse Primer (5′-3′)
β-actin XM_021086047.1 AACTACCTTCAACTCCATCAT GATCTCCTTCTGCATCCTGT
TNF-α NM_214022.1 CACGCTCTTCTGCCTACTGC ACGATGATCTGAGTCCTTGG
IL-6 NM_214399.1 GCTTCTGGTGATGGCTACTG GCCGAGGATGTACTTAATGAGTTC
PIK3AP1 NM_001244503.1 TCCAGCACAGCAAGCAG GTAACCTCGGGCACTTCATT
CASP3 NM_214131.1 GGACTGCTGTAGAACTCTAACTGG CAAGAAGTCTGCCTCAACTGGTA
CMKLR1 NM_001123100.1 CAAGAAAGAAGTCGGGGAACAC CTCTGGGAGCTGGCTGTGAT
FOS NM_001123113.1 CCCCAGAAGAAGAAGAGAAAAGG GTCTGTCTCCGCTTGGAGTGT
SOCS3 NM_001123196.1 ATCCCTCTGGTGTTGAGCCG GCCGTTGACTGTTTTCCGAC
MAP3K5 XM_021072505.1 CACCGGGATATAAAGGGTGACAA CAAATGTCTGCTGCCTTCCC
BCL2L1 XM_021077294.1 GTGAACTGGGGTCGCATTGT CCTTGTCTACGCTCTCCACG
LIF NM_214402.2 TGTACCGCATCATCGCCTAC CAGGTTCACAGCACCAGGAT
SLC5A1 XM_021072101.1 TCATCATCGTCCTGGTCGTCTCC TGAATGTCCTCCTCCTCTGCATCC
SLC2A2 NM_001097417.1 TGCTCTGGTCTCTGTCTGTGTCC ATTCTTCCAAGCCGATCTCCAAGC
MPI NM_001253921.1 ACCTTTCTGACGAAGGTGCC AGATCCGCTTCACCAACAGG
PMM2 XM_021086654.1 CCGAAACGGGATGTTGAACG GCTGATCTGGCCTCCTATGG
SOD1 NM_214201.1 CGTGCAACCAGTTTGGACAT AGCATGAAGTTGGGCTCGAA
SOD2 NM_214127.2 CTTGCAGATTGCCGCTTGTT CGGCGTATCGCTCAGTTACA
GPX1 XM_021081498.1 TGTACCCGCTATTCTGGGGA TCACACAGGCGTTTCCTCTC
GPX4 NM_001190422.1 AACCAGATGACTTGGGCAGA AGACCATGGCATGAGGGAAT
CAT NM_214407.1 TGTGGTTTACGGATTCTGG CCTTGGGCTGGACTTTCA
NRF2 XM_005654811.3 TACATGCACTTTGGGGAGGT AGATCGTCCCGGCTAATGAG
KEAP1 XM_021075132.1 AGAGCCCAGTCTTCATTGCT TGTCCTGTTGCATACCGTCT

2.8. Statistical Analysis

The data were expressed as the mean ± standard deviation (SD). The results of figures were analysed via one-way analysis of variance (ANOVA) using SPSS 25.0 software and plotted using GraphPad Prism 8.0.2. The volcano plots of DEGs were plotted by http://www.biozeron.com, and the KEGG pathway enrichment analyses of DEGs were conducted on https://www.omicstudio.cn/. A p-value less than 0.05 indicated statistical significance.

3. Results

3.1. Contents of PKCOS

As shown in Table 2, the acquisition rate of PKCOS is nearly 9.62%, and they are mainly composed of sugars and mannose, accounting for 60.75% and 36.80%, respectively, and a very small amount of protein, which accounts for nearly 0.19%. It also contains small amounts of polyphenols and flavonoids, the values of which are 17.30 ± 0.02 (gallic acid equivalents) mg/g PKCOS and 5.90 ± 0.01 (rutin equivalent) mg/g PKCOS, respectively.

Table 2.

The contents of PKCOS. The data are expressed as mean ± SD; n = 3.

Items PKCOS
Freeze-dried powder, mg/g PKC 96.19 ± 2.21
PKCOS acquisition rate, % 9.62 ± 0.22
Sugar, % in powder 60.75 ± 0.45
Mannose, % in powder 36.80 ± 0.58
Protein, % in powder 0.19 ± 0.005
Polyphenols, gallic acid equivalents, mg/g PKCOS 17.30 ± 0.02
Flavone, rutin equivalent, mg/g PKCOS 5.90 ± 0.01

3.2. Evaluation of Antioxidant Activity of PKCOS In Vitro

PKCOS (20 mg/mL) demonstrates certain antioxidant activity in vitro, in which the total antioxidant capacity (T-AOC) reached 0.296 ± 0.007 mM Trolox, the hydroxyl (•OH) radical scavenging rate reached 419.14 ± 5.76 U/mL, equating to an inhibition percentage of 53.91 ± 1.62%, and the •DPPH radical scavenging rate reached 2934.41 ± 13.14%.

3.3. Effect of PKCOS or LPS on IPEC-J2 Cell Viability

IPEC-J2 cell survival rates were increased in a dose-dependent pattern by the different concentrations of PKCOS treatment, particularly at the concentrations of 250, 500 and 1000 µg/mL PKCOS (Figure 1A, p < 0.05). In contrast, IPEC-J2 cell viability induced by LPS in a range of 5 to 20 µg/mL presented a dose-dependent reduction (Figure 1B, p < 0.05), indicating that the cells could be damaged by LPS, and the appropriate concentration is 5 µg/mL. Figure 1C shows that PKCOS alleviates LPS-induced (5 µg/mL) cell apoptosis (p < 0.05); in particular, the addition of 250 µg/mL PKCOS returned the value of cell viability to normal, while the 1000 µg/mL concentration of PKCOS improved cell viability by around 150% (p < 0.05).

Figure 1.

Figure 1

Cell survival rate of IPEC-J2 cells with different treatments. (A) Cell survival rate of different concentrations of PKCOS on the viability of IPEC-J2 cells. (B) Cell survival rate of different concentrations of LPS on the viability of IPEC-J2 cells. (C) IPEC-J2 cells were treated with PBS or 5 µg/mL LPS at the indicated concentrations for 24 h and then treated with 250, 500 or 1000 µg/mL PKCOS. Data are presented as mean ± SD, and the experiment consisted of 3 batches, with each batch containing 6 replicates. Bars without a common letter (a,b,c,d) and ‘*’ denote statistically significant differences (p < 0.05).

3.4. PKCOS Enhanced Cell Viability and Altered Gene Transcription Expression

A total of 347 upregulated and 471 downregulated DEGs were identified in the DMSO group, and 743 upregulated and 724 downregulated DEGs were identified in the PKCOS group compared with those identified in the CT group (Figure 2A,B), while 815 upregulated and 610 downregulated DEGs were identified in the PKCOS group compared with those identified in the DMSO group (Figure 2C). Furthermore, a series of signalling pathways were enriched by KEGG pathway analysis of DEGs, such as the metabolism of cell proliferation, including the MAPK signalling pathway, the PI3K-Akt signalling pathway, the TNF signalling pathway and cytokine–cytokine receptor interaction (Figure 2D). Therefore, qRT-PCR was performed to confirm that the above pathways were related to the metabolism of cell proliferation.

Figure 2.

Figure 2

PKCOS vs. DMSO vs. CT transcriptome analysis. (A) Volcano plot of DEGs in the DMSO and CT groups. (B) Volcano plot of DEGs in the PKCOS and CT groups. (C) Volcano plot of DEGs in the PKCOS and DMSO groups. Upregulated genes are shown in red, downregulated genes are shown in blue and genes with no significant difference in expression are indicated in black; p < 0.05 indicates significance. (D) KEGG pathway enrichment analysis of DEGs in the DMSO and CT groups, the PKCOS and DMSO groups and the PKCOS and CT groups. The size and colour of the circles represent the number of enriched genes and the p-value; n = 3.

Compared with the CT treatment, DMSO showed a trend towards the decreased mRNA expression of genes PI3KAP1, MAP3K5, Fos and BCL2L1 (Figure 3A–D, p < 0.05), while PKCOS showed a trend towards the increased expression of genes PI3KAP1, MAP3K5 and Fos and the restored mRNA expression of BCL2L1 (p < 0.05). Compared with the CT and DMSO groups, PKCOS enhanced the expression of cytokine TNF-α (Figure 3E, p < 0.05), while the expressions of cytokine IL-6 in both the DMSO group and the PKCOS group were lower than that in the CT group (Figure 3F, p < 0.05). Similar to the IL-6 expressions, the expression of CMKLR1, a member of the G protein-coupled receptor (GPCR) family, demonstrated lower values in both the DMSO and PKCOS groups than in the CT group (Figure 3G, p < 0.05).

Figure 3.

Figure 3

Real-time PCR verified the key genes in the three groups of KEGG-enrichment pathways (PKCOS vs. DMSO vs. CT). The relative mRNA expressions of PI3KAP1, MAP3K5, FOS, BCL2L1, TNF-α, IL-6, CMKLR1 among the CT, DMSO, PKCOS groups (A–G). “*” indicates a statistically significant difference, p < 0.05, while “ns” indicates no statistical difference. The data are expressed as mean ± SD; n = 3.

3.5. PKCOS Attenuated IPEC-J2 Cell Apoptosis Induced by LPS

In total, 441 upregulated and 447 downregulated DEGs were identified in the LPS group (Figure 4A), and 549 upregulated and 582 downregulated DEGs were identified in the LPS-PKCOS group compared with the CT group (Figure 4B), while 634 upregulated and 477 downregulated DEGs were identified in the LPS-PKCOS group compared with the LPS group (Figure 4C). The predominantly enriched pathways based on a KEGG pathway analysis of DEGs were mainly associated with cell apoptosis, including the IL-17 signalling pathway, the PI3K-Akt signalling pathway, the TNF signalling pathway, focal adhesion and ECM–receptor interaction (Figure 4D). Similar to the above, qPCR was performed to confirm those predominantly enriched pathways.

Figure 4.

Figure 4

LPS-PKCOS vs. LPS vs. CT transcriptome analysis. (A) Volcano plot of DEGs in the LPS and CT groups. (B) Volcano plot of DEGs in the LPS-PKCOS and CT groups. (C) Volcano plot of DEGs in the LPS-PKCOS and LPS groups. Upregulated genes are shown in red, downregulated genes are shown in blue and genes with no significant difference in expression are indicated in black; p < 0.05 indicated significance. KEGG pathway enrichment analysis of DEGs in the LPS and CT groups, the LPS-PKCOS and LPS groups and the LPS-PKCOS and CT groups. (D) The size and colour of the circles represent the number of enriched genes and the p-value; n = 3.

The qPCR results showed that the expression of genes CASP3 and TNF-α was increased in the LPS group compared with the CT group (Figure 5A,B, p < 0.05); however, the expression of two genes in LPS-PKCOS decreased to the value close to that in the CT group. A significant difference in IL-6 expression was observed among the three groups (CT, LPS and LPS-PKCOS; Figure 5C, p < 0.05), and it was slightly lower in the LPS group and the lowest in the LPS-PKCOS group compared to the CT group. The expression of SOCS3, a major regulator of infection and inflammation associated with IL-6 and LIF, was observed to have lower values in both the LPS and LPS-PKCOS groups than in the CT group, and no difference was revealed between the LPS and LPS-PKCOS groups (Figure 5D), while the expression of the LIF gene showed no difference among the three groups (CT, LPS and LPS-PKCOS; Figure 5E). Similarly, the expressions of the genes PI3KAP1 and MAP3K5 in the PI3K/MAPK signalling pathways showed no differences across the three groups (Figure 5F,G).

Figure 5.

Figure 5

Real-time PCR verified the key genes in the three groups of KEGG-enrichment pathways (LPS-PKCOS vs. LPS vs. CT). The relative mRNA expressions of CASP3, TNF-α, IL-6, SOCS3, LIF, PI3KAP1, MAP3K5 among the CT, LPS, LPSS-PKCOS groups (A–G). “*” indicates a statistically significant difference, p < 0.05 while “ns” indicates no statistical difference. The data are expressed as mean ± SD; n = 3.

3.6. PKCOS Promotes the Glycolysis of Cells via HK and MPI Enzymes

Based on the significant amount of mannose contained in PKCOS, the expression of genes SLC2A2 and SLC5A1, encoding the glucose transporters GLUT2 and SGLT1, respectively, was paid close attention. The SLC2A2 expression detected by qPCR in the DMSO group was close to the value in the CT group, while its expression in the other three groups (PKCOS, LPS and LPS-PKCOS) was reduced (p < 0.05). There was no difference in the relative mRNA expression of SLC2A2 between the PKCOS and LPS-PKCOS groups, and the values in both groups were the lowest (Figure 6A, p < 0.05). In contrast, the transcriptional expressions of SLC5A1 increased in the other four groups compared to the CT group. Interestingly, the transcription of SLC5A1 increased in the LPS group and decreased in the LPS-PKCOS group (Figure 6B, p < 0.05). Regarding the enzymes involved in mannose metabolism (Figure 6C), the gene mRNA expressions of three key enzymes—HK, MPI and PMM2—were evaluated by qPCR. The mRNA expression of HK and MPI in the PKCOS and LPS-PKCOS groups exhibited an increase compared with that in the CT group (Figure 6D,F, p < 0.05). However, the mRNA expressions of PMM2 showed no difference among any of the five treatments (Figure 6E).

Figure 6.

Figure 6

Possible glucose transporters of the cellular uptake of mannose and the gene expression of three key enzymes involved in mannose metabolism. Relative mRNA expression of SLC2A2 and SLC5A1 (A,B). GLUT2, glucose transporter protein 2, edited by SLC2A2; SGLT1, Na+/Glucose Cotransporter 1, edited by SLC5A1. Schematic diagram of the mannose metabolism pathway (C). Relative mRNA expression of genes for key enzymes in mannose metabolism (D–F). MPI, the gene for mannose phosphate isomerase; PMM2, the gene for phosphomannomutase 2; HK, the gene for hexokinase. Data are presented as mean ± SD (n = 3). Bars without a common letter (a,b,c) denote statistically significant differences (p < 0.05).

3.7. PKCOS Readjusted the Antioxidant Genes’ mRNA Expressions

Given that the PKCOS extract demonstrated antioxidant properties in an in vitro antioxidant assay, we postulated that PKCOS may also modulate oxidative stress in the LPS model of inflammation. Consequently, we examined the expression of antioxidant genes among the CT, LPS and LPS-PKCOS groups. As a result, PKCOS downgraded the trend of high levels of SOD1, SOD2 and KEAP1 caused by LPS, upgraded the tendency of low levels of GPX4 caused by LPS and decreased CAT and NRF2 mRNA expression (Figure 7, p < 0.05); it had no effect on GPX1.

Figure 7.

Figure 7

Relative mRNA expression of antioxidant genes, including SOD1, SOD2, GPX1, GPX4, CAT, NRF2 and KEAP1. Data are presented as mean ± SD (n = 3). Bars without a common letter (a,b) denote statistically significant differences (p < 0.05).

4. Discussion

Our study showed that PKCOS extracted by 50% alcohol is composed of sugar, particularly mannose, and a very small amount of phenols, flavonoids and proteins. The explanation for this may be attributed to sugar also being able to bind covalently to other molecules, such as phenols [34]. It has been previously reported that 50% ethanol is an effective solvent for the extraction of oligosaccharides [35], and polysaccharides are not soluble in such high concentrations of ethanol [36]. Therefore, it is speculated that oligosaccharides are the major components of PKCOS. The •OH and •DPPH radicals are an extremely active free radical in biological systems and can cause oxidative damage to DNA [37]. In our study, PKCOS exhibited higher T-AOC activity than açai fermentation extracts [38] but lower than Buddleja scordioides Kunth [39], higher •DPPH radical scavenging activity in vitro than BHA [40] and higher •OH radical percentage of inhibition than gallic acid [41], which may indicate that PKCOS acts as a potential antioxidant agent.

Cell activity and proliferation are frequently associated with sugar levels and their metabolism [42]. In the present study, 1000 µg/mL PKCOS demonstrated an enhancement of IPEC-J2 cell viability, which is consistent with previous findings of oligosaccharides in promoting intestinal cell proliferation in piglets [43] and periodontal ligament stem cell proliferation in humans [44]. The results of the gene expression conducted by qPCR demonstrated a higher expression of TNF-α, PI3KAP1, MAP3K5 and FOS in the PKCOS group than in the CT group. TNF-α is an upstream transcriptional regulator, while Fos and Bcl2L1 are downstream transcriptional regulators in PI3K/MAPK signalling pathways [45]. c-Fos (edited by Fos) is a nucleophosphoprotein that heterodimerises with c-Jun and then forms an AP-1 (activator-1) complex, which binds to DNA at specific sites in the promoter and enhancer regions of the target gene and takes on the role of signal transduction [46]. Studies have shown that the activation of the PI3K/MAPK pathway promotes the proliferation of zebrafish subintestinal vascular epithelial cells [47] and restoration of platelet function [48]. Therefore, PKCOS may play an important role in promoting IPEC-J2 cell proliferation, and the promotion was performed through the PI3K/MAPK signalling pathway. Bcl2L1 (Bcl-XL), belonging to the Bcl-2 family, is the main antiapoptotic protein [49,50], and its mRNA expressions in the CT and PKCOS groups were similar, implying that there was no damage to IPEC-J2 cell viability treated by PKCOS. Ultimately, the pro-cellular proliferative mechanisms of PKCOS can be summarised as upregulating the expression of TNF-α, PI3KAP1, MAP3K5 and Fos in PI3K/AMPK signalling pathways.

From the metric of cell viability, it was clear that the 1000 µg/mL concentration of PKCOS was the applicable dose for relieving LPS-induced damage. Further investigation of the potential pathway by which it alleviated LPS-induced cell inflammation and apoptosis may indicate the involvement of the IL-17/TNF-α signalling pathway. Programmed cell death (PCD) is the process in which cells eliminate themselves in a controlled manner [51]. Caspases (particularly caspase-3) are mediators of the signalling pathways for apoptosis and cell breakdown and play a role in chromatin condensation and DNA degradation during apoptosis [52,53]. TNF-α acts as a signalling molecule in the inflammatory response [54]. Increased levels of CASP-3 and TNF-α were observed in this study, which is in agreement with a previous study that APAP-induced inflammation in HepG2 Cells [55], suggesting that TNF-α and IL-17 signalling pathways were significantly enhanced by LPS treatment, based on findings from transcriptome analysis, which may be associated with cellular inflammatory and immune processes [56]. LPS-induced intestinal injury is usually characterised by the overproduction of inflammatory cytokines, such as TNF-α, iNOS and IL-1β. Chitosan oligosaccharides can block LPS-induced inflammatory responses and reduce the death of cells [57]. As expected, the levels of CASP-3 and TNF-α mRNA were significantly decreased after PKCOS treatment, so that the cell survival rate of IPEC-J2 was significantly increased. These results suggest that the regulation of PKCOS on the mRNA expression of TNF-α and CASP3 may result from multi-target genes and play a protective role in the LPS-induced apoptosis of IPEC cells. Similar to the other oligosaccharides obtained from plant/food/feed reported by other researchers [58], PKCOS presented anti-inflammatory effects through downregulating the expressions of target genes associated with cell death, such as CASP3 and TNF-α.

In addition, LPS caused high SOD1 and SOD2 levels in the IPEC-J2 cells, while PKCOS restored levels of SOD1 and SOD2 nearly to that in the CT group. High SOD1 and SOD2 levels were main indicators of cellular inflammation and oxidative stress [59,60,61]. This suggests that PKCOS can alleviate LPS-induced oxidative stress and inflammatory responses in IPEC-J2 cells. Increased GPX4 may inhibit the onset of cellular iron death [62,63]. It is noteworthy that our study showed that PKCOS can reverse the downregulation of GPX4 induced by LPS. CAT was also a closely related indicator of cell death [64], and the qPCR results showed that PKCOS downregulated the mRNA expression of this gene. This indicates that the active substances in the feed have antioxidant capacity, likely through the NRF2/KEAP1 pathway [65]. In our study, PKCOS was known to downregulate the expression of NRF2 and normalise the expression of KEAP1. These alterations in antioxidant genes indicated that PKCOS also served as an antioxidant in the LPS-induced IPEC-J2 inflammation model. Considering that PKCOS has a role in regulating the expression of antioxidant genes, we concluded that PKCOS has antioxidant and anti-inflammatory capacities.

Sugar metabolism is a determinant of cell death and cell proliferation [66]. Thus, the question is whether PKCOS affects the glycolytic pathway during IPEC-J2 proliferation and apoptosis. Mannose, an isoform of glucose, generally enters cells through glucose transporters. Therefore, a new question of whether mannose in PKCOS can enter cells through glucose transporters is posed. SGLT1 and GLUT2 are the main glucose transporters in the gut [67,68]. The high level of SLC5A1 mRNA expression and the tendency towards a low mRNA expression level of SLC2A2 in the PKCOS and LPS-PKCOS groups compared to those in the CT group suggest that mannose in PKCOS may enter cells through SGLT1. The expression pattern of SLC5A1 in LPS-PKCOS was consistent with previous findings, in which stevia leaf extracts promoted the activity and expression of SGLT1 and enhanced the intestinal capacity to absorb glucose in rabbits [69]. After entering into cells, mannose can be catalysed by hexokinase (HK) to produce 6-phospho-mannose (M6P), which is then catalysed by phosphomannose isomerase (MPI) into the glycolytic pathway or catalysed by phosphomannose mutase (PMM2) into the glycosylation pathway [70,71]. Interestingly, the transcriptional expression of gene HK/MPI was increased by PKCOS treatment with and without added LPS, while the mRNA expression of PMM2 did not show a difference across the five groups, suggesting that PKCOS promoted the glycolytic pathway in IPEC-J2 cells, which may be associated with cell proliferation and alleviation of inflammation-induced apoptosis [72]. Thus, one possible regulatory pathway is that PKCOS may enter cells through the transporter SGLT1 and promote the glycolytic pathway associated with cell proliferation and the alleviation of inflammation-induced apoptosis. However, further research is needed, first to determine whether PKCOS affects ATP production in terms of glycolytic pathways and energy involvement in cell proliferation and then to determine the appropriate supplemental dose for gut health and disease prevention in pigs.

Overall, these findings suggest that the potential roles of PKCOS can be summarised as promoting cell proliferation and alleviating oxidative stress and apoptosis caused by LPS (Figure 8). IPEC-J2 cell proliferation was promoted at a concentration of 1000 µg/mL PKCOS through the upregulated expression of TNF-α, PI3KAP1, MAP3K5 and Fos in PI3K/AMPK signalling pathways, while cell viability was damaged at a concentration of 5 µg/mL LPS. PKCOS alleviated the cell apoptosis induced by LPS through downregulating expressions of target genes associated with cell death, such as CASP3 and TNF-α, and regulated the expression of antioxidant genes, such as SOD1, SOD2 and GPX4, to exert positive antioxidant effects. PKCOS may enter cells through the transporter SGLT1 and promote the glycolytic pathway associated with cell proliferation and the alleviation of inflammation-induced apoptosis.

Figure 8.

Figure 8

Effect of PKCOS on the survival rate of IPEC-J2 cells with or without LPS treatment. Red arrows up represent gene upregulation and red arrows down represent gene downregulation.

However, although some achievements were obtained, the present study has limitations that should be further investigated. For example, the antioxidant and anti-inflammatory properties could be attributed to other components, such as flavones. Furthermore, the key regulatory molecules of PKCOS affecting IPEC-J2 cells were not subjected to additional functional validation, such as protein expression or direct observation by immunofluorescence (other than qPCR).

5. Conclusions

In this study, an extract (PKCOS) from pre-treated PKCs was obtained, and it largely contained sugar and mannose, plus a very small number of polyphenols and flavones. In vitro studies have demonstrated that PKCOS has antioxidant activity and regulates the expression of antioxidant genes in IPEC-J2 cells. Furthermore, PKCOS has been shown to promote cell proliferation through the activation of the PI3K/MAPK signalling pathway and to regulate the expression of key target genes to alleviate LPS-induced apoptosis. The process of PKCOS-regulated cell survival may be related to glycolysis. This study provides a new approach for the exploitation of derivatives from fermented feeds as antioxidants and prebiotics.

Author Contributions

Conceptualization, H.Z. and S.H.; Investigation, H.Z., J.M., J.L. and M.H.; Resources, S.H.; Writing—original draft, H.Z.; Writing—review and editing, S.H.; Visualization, J.M., J.L. and Z.S.; Funding acquisition, S.H. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

This study does not involve humans or animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was funded by the National Key Research and Development Program of China, grant number 2021YFD1300301-5.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Stein H.H., Casas G.A., Abelilla J.J., Liu Y., Sulabo R.C. Nutritional value of high fiber co-products from the copra, palm kernel, and rice industries in diets fed to pigs. J. Anim. Sci. Biotechnol. 2015;6:56. doi: 10.1186/s40104-015-0056-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kwon W.B., Park S.K., Kong C., Kim B.G. The effect of various inclusion levels of β-mannanase on nutrient digestibility in diets consisting of corn, soybean meal and palm kernel expellers fed to growing pigs. Am. J. Anim. Vet. Sci. 2015;10:9–13. doi: 10.3844/ajavsp.2015.9.13. [DOI] [Google Scholar]
  • 3.Tao R., Chen Q.Y., Li Y., Guo L., Zhou Z.Q. Physicochemical, nutritional, and phytochemical profile changes of fermented citrus puree from enzymatically hydrolyzed whole fruit under cold storage. LWT-Food Sci Technol. 2022;169:114009. doi: 10.1016/j.lwt.2022.114009. [DOI] [Google Scholar]
  • 4.Zhang L.H., Zhang M., Mujumdar A.S. New technology to overcome defects in production of fermented plant products-a review. Trends Food Sci. Technol. 2021;116:829–841. doi: 10.1016/j.tifs.2021.08.014. [DOI] [Google Scholar]
  • 5.Díaz S., Ortega Z., Benítez A.N., Marrero M.D., Carvalheiro F., Duarte L.C., Matsakas L., Krikigianni E., Rova U., Christakopoulos P., et al. Oligosaccharides production by enzymatic hydrolysis of banana pseudostem pulp. Biomass Convers. Biorefin. 2021;13:10677–10688. doi: 10.1007/s13399-021-02033-4. [DOI] [Google Scholar]
  • 6.Schloss P.D., Westcott S.L., Ryabin T., Hall J.R., Hartmann M., Hollister E.B., Lesniewski R.A., Oakley B.B., Parks D.H., Robinson C.J., et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009;75:7537–7541. doi: 10.1128/AEM.01541-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bali V., Panesar P.S., Bera M.B., Panesar R. Fructo-oligosaccharides: Production, Purification and Potential Applications. Crit. Rev. Food Sci. Nutr. 2015;55:1475–1490. doi: 10.1080/10408398.2012.694084. [DOI] [PubMed] [Google Scholar]
  • 8.Courtois J. Oligosaccharides from land plants and algae: Production and applications in therapeutics and biotechnology. Curr. Opin. Microbiol. 2009;12:261–273. doi: 10.1016/j.mib.2009.04.007. [DOI] [PubMed] [Google Scholar]
  • 9.Chung H.Y., Lee G.S., Nam S.H., Lee J.H., Han J.P., Song S., Kim G.D., Jung C., Hyeon D.Y., Hwang D., et al. Morc2a variants cause hydroxyl radical-mediated neuropathy and are rescued by restoring GHKL ATPase. Brain. 2024:awae017. doi: 10.1093/brain/awae017. [DOI] [PubMed] [Google Scholar]
  • 10.Treml J., Smejkal K. Flavonoids as Potent Scavengers of Hydroxyl Radicals. Compr. Rev. Food Sci. Food Saf. 2016;15:720–738. doi: 10.1111/1541-4337.12204. [DOI] [PubMed] [Google Scholar]
  • 11.Liu F., Ooi V.E.C., Chang S.T. Free radical scavenging activities of mushroom polysaccharide extracts. Life Sci. 1997;60:763–771. doi: 10.1016/S0024-3205(97)00004-0. [DOI] [PubMed] [Google Scholar]
  • 12.Del-Castillo-Llamosas A., Eibes G., Ferreira-Santos P., Perez-Perez A., Del-Rio P.G., Gullon B. Microwave-assisted autohydrolysis of avocado seed for the recovery of antioxidant phenolics and glucose. Bioresour. Technol. 2023;385:129432. doi: 10.1016/j.biortech.2023.129432. [DOI] [PubMed] [Google Scholar]
  • 13.Li Y.X., Yi P., Liu J., Yan Q.J., Jiang Z.Q. High-level expression of an engineered beta-mannanase (mRmMan5A) in Pichia pastoris for manno-oligosaccharide production using steam explosion pretreated palm kernel cake. Bioresour. Technol. 2018;256:30–37. doi: 10.1016/j.biortech.2018.01.138. [DOI] [PubMed] [Google Scholar]
  • 14.Cutler S.A., Lonergan S.M., Cornick N., Johnson A.K., Stahl C.H. Dietary Inclusion of Colicin E1 Is Effective in Preventing Postweaning Diarrhea Caused by F18-Positive Escherichia coli in Pigs. Antimicrob. Agents Chemother. 2007;51:3830–3835. doi: 10.1128/Aac.00360-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Omonijo F.A., Liu S., Hui Q., Zhang H., Lahaye L., Bodin J.C., Gong J., Nyachoti M., Yang C. Thymol Improves Barrier Function and Attenuates Inflammatory Responses in Porcine Intestinal Epithelial Cells during Lipopolysaccharide (LPS)-Induced Inflammation. J. Agric. Food. Chem. 2019;67:615–624. doi: 10.1021/acs.jafc.8b05480. [DOI] [PubMed] [Google Scholar]
  • 16.Merga Y., Campbell B.J., Rhodes J.M. Mucosal barrier, bacteria and inflammatory bowel disease: Possibilities for therapy. Dig. Dis. 2014;32:475–483. doi: 10.1159/000358156. [DOI] [PubMed] [Google Scholar]
  • 17.Okumura R., Takeda K. Roles of intestinal epithelial cells in the maintenance of gut homeostasis. Exp. Mol. Med. 2017;49:e338. doi: 10.1038/emm.2017.20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hansson G.C., Johansson M.E.V. The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Gut Microbes. 2010;1:51–54. doi: 10.4161/gmic.1.1.10470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Na K., Wei J., Zhang L., Fang Y., Li X., Lu S., Guo X. Effects of chitosan oligosaccharides (COS) and FMT from COS-dosed mice on intestinal barrier function and cell apoptosis. Carbohydr. Polym. 2022;297:120043. doi: 10.1016/j.carbpol.2022.120043. [DOI] [PubMed] [Google Scholar]
  • 20.Niu X., Hu C., Chen S., Wen J., Liu X., Yong Y., Yu Z., Ma X., Li C., Warda M., et al. Chitosan-gentamicin conjugate attenuates heat stress-induced intestinal barrier injury via the TLR4/STAT6/MYLK signaling pathway: In vitro and in vivo studies. Carbohydr. Polym. 2023;321:121279. doi: 10.1016/j.carbpol.2023.121279. [DOI] [PubMed] [Google Scholar]
  • 21.Shi L., Fang B., Yong Y.H., Li X.W., Gong D.L., Li J.Y., Yu T.Y., Gooneratne R., Gao Z.H., Li S.D., et al. Chitosan oligosaccharide-mediated attenuation of LPS-induced inflammation in IPEC-J2 cells is related to the TLR4/NF-κB signaling pathway. Carbohydr. Polym. 2019;219:269–279. doi: 10.1016/j.carbpol.2019.05.036. [DOI] [PubMed] [Google Scholar]
  • 22.Soto-Heredero G., Gomez de Las Heras M.M., Gabande-Rodriguez E., Oller J., Mittelbrunn M. Glycolysis—A key player in the inflammatory response. FEBS J. 2020;287:3350–3369. doi: 10.1111/febs.15327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Leng L., Yuan Z., Pan R., Su X., Wang H., Xue J., Zhuang K., Gao J., Chen Z., Lin H., et al. Microglial hexokinase 2 deficiency increases ATP generation through lipid metabolism leading to beta-amyloid clearance. Nat. Metab. 2022;4:1287–1305. doi: 10.1038/s42255-022-00643-4. [DOI] [PubMed] [Google Scholar]
  • 24.Huang C.Y., Kuo W.T., Huang C.Y., Lee T.C., Chen C.T., Peng W.H., Lu K.S., Yang C.Y., Yu L.C. Distinct cytoprotective roles of pyruvate and ATP by glucose metabolism on epithelial necroptosis and crypt proliferation in ischaemic gut. J. Physiol. 2017;595:505–521. doi: 10.1113/JP272208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hang S.Q., Zeng H., Zhu W.Y. A method and Application of Lactobacillus plantarum LY19 and Its Co-Fermentation for Enzymatic Hydrolysis of Palm Kernel Cake. CN116676223A. Patent. 2023 September 1;
  • 26.da Silva I.M., Rabelo M.C., Rodrigues S. Cashew juice containing prebiotic oligosaccharides. J. Food Sci. Technol. 2014;51:2078–2084. doi: 10.1007/s13197-012-0689-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Xiang X., Yang L., Hua S., Li W., Sun Y., Ma H., Zhang J., Zeng X. Determination of oligosaccharide contents in 19 cultivars of chickpea (Cicer arietinum L) seeds by high performance liquid chromatography. Food Chem. 2008;111:215–219. doi: 10.1016/j.foodchem.2008.03.039. [DOI] [Google Scholar]
  • 28.Yao L., Shi X., Chen H., Zhang L., Cen L., Li L., Lv Y., Qiu S., Zeng X., Wei C. Major Active Metabolite Characteristics of Dendrobium officinale Rice Wine Fermented by Saccharomyces cerevisiae and Wickerhamomyces anomalus Cofermentation. Foods. 2023;12:2370. doi: 10.3390/foods12122370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Qi J., Zhang S.R., Azam M., Shaibu A.S., Abdelghany A.M., Feng Y., Huai Y., Feng H., Liu Y., Ma C., et al. Profiling seed soluble sugar compositions in 1164 Chinese soybean accessions from major growing ecoregions. Crop J. 2022;10:1825–1831. doi: 10.1016/j.cj.2022.04.015. [DOI] [Google Scholar]
  • 30.Adom K.K., Sorrells M.E., Liu R.H. Phytochemical profiles and antioxidant activity of wheat varieties. J. Agric. Food Chem. 2003;51:7825–7834. doi: 10.1021/jf030404l. [DOI] [PubMed] [Google Scholar]
  • 31.Cui L., Zeng H., Hou M., Li Z., Mu C., Zhu W., Hang S. Lactiplantibacillus plantarum L47 and inulin alleviate enterotoxigenic Escherichia coli induced ileal inflammation in piglets by upregulating the levels of alpha-linolenic acid and 12,13-epoxyoctadecenoic acid. Anim. Nutr. 2023;14:370–382. doi: 10.1016/j.aninu.2023.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kim K.C., Sin S.I., Ri M.R., Jo C.H., Mun S.H. Effect of dietary Pinus densiflora bark extract on activity and mRNA expression of antioxidant enzyme in weaning piglets. Livest. Sci. 2022;260:104931. doi: 10.1016/j.livsci.2022.104931. [DOI] [Google Scholar]
  • 33.Zhou X.J., Wang L.Q., Zhang Z.Y., Qin X.Y., Qiu B.Q., Cao J.D., Han D.D., Wang J.J., Zhao J.B. 25-Hydroxyvitamin D3 improved growth performance, bone characteristics and polyunsaturated fatty acid deposition by activating calcium ion channel proteins expression in growing pigs. J. Funct. Foods. 2023;105:105581. doi: 10.1016/j.jff.2023.105581. [DOI] [Google Scholar]
  • 34.Guo Q.B., Xiao X.Y., Lu L.F., Ai L.Z., Xu M.G., Liu Y., Goff H.D. Polyphenol-Polysaccharide Complex: Preparation, Characterization, and Potential Utilization in Food and Health. Annu. Rev. Food Sci. Technol. 2022;13:59–87. doi: 10.1146/annurev-food-052720-010354. [DOI] [PubMed] [Google Scholar]
  • 35.Jovanovic-Malinovska R., Kuzmanova S., Winkelhausen E. Application of ultrasound for enhanced extraction of prebiotic oligosaccharides from selected fruits and vegetables. Ultrason. Sonochem. 2015;22:446–453. doi: 10.1016/j.ultsonch.2014.07.016. [DOI] [PubMed] [Google Scholar]
  • 36.Liu Q., Huang X., Yang D., Si T., Pan S., Yang F. Yield improvement of exopolysaccharides by screening of the Lactobacillus acidophilus ATCC and optimization of the fermentation and extraction conditions. EXCLI J. 2016;15:119–133. doi: 10.17179/excli2015-356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yuan H., Zhang W., Li X., Lu X., Li N., Gao X., Song J. Preparation and in vitro antioxidant activity of kappa-carrageenan oligosaccharides and their oversulfated, acetylated, and phosphorylated derivatives. Carbohydr. Res. 2005;340:685–692. doi: 10.1016/j.carres.2004.12.026. [DOI] [PubMed] [Google Scholar]
  • 38.Lais Alves Almeida Nascimento A., Sampaio da Silveira de Souza M., Lorrane Rodrigues Borges L., Renon Eller M., Augusto Ribeiro de Barros F., Correa Mendonca A., Azevedo L., Araujo Vieira do Carmo M., Dos Santos Lima A., da Silva Cruz L., et al. Influence of spontaneous and inoculated fermentation of acai on simulated digestion, antioxidant capacity and cytotoxic activity. Food Res. Int. 2023;173:113222. doi: 10.1016/j.foodres.2023.113222. [DOI] [PubMed] [Google Scholar]
  • 39.Macias-Cortes E., Gallegos-Infante J.A., Rocha-Guzman N.E., Moreno-Jimenez M.R., Cervantes-Cardoza V., Castillo-Herrera G.A., Gonzalez-Laredo R.F. Antioxidant and anti-inflammatory polyphenols in ultrasound-assisted extracts from salvilla (Buddleja scordioides Kunth) Ultrason. Sonochem. 2022;83:105917. doi: 10.1016/j.ultsonch.2022.105917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jeddou K.B., Bouaziz F., Helbert C.B., Nouri-Ellouz O., Maktouf S., Ellouz-Chaabouni S., Ellouz-Ghorbel R. Structural, functional, and biological properties of potato peel oligosaccharides. Int. J. Biol. Macromol. 2018;112:1146–1155. doi: 10.1016/j.ijbiomac.2018.02.004. [DOI] [PubMed] [Google Scholar]
  • 41.Fejer J., Kron I., Grulova D., Eliasova A. Seasonal Variability of Juniperus communis L. Berry Ethanol Extracts: 1. In Vitro Hydroxyl Radical Scavenging Activity. Molecules. 2020;25:4114. doi: 10.3390/molecules25184114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ai Y.L., Wang W.J., Liu F.J., Fang W., Chen H.Z., Wu L.Z., Hong X., Zhu Y., Zhang C.X., Liu L.Y., et al. Mannose antagonizes GSDME-mediated pyroptosis through AMPK activated by metabolite GlcNAc-6P. Cell Res. 2023;33:904–922. doi: 10.1038/s41422-023-00848-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jang K.B., Kim S.W. Role of milk carbohydrates in intestinal health of nursery pigs: A review. J. Anim. Sci. Biotechnol. 2022;13:6. doi: 10.1186/s40104-021-00650-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Li Y., Yu F., Liu Y., Liang Q., Huang Y., Xiang Q., Zhang Q., Su Z., Yang Y., Zhao Y. Sulfonated chitosan oligosaccharide alleviates the inhibitory effect of basic fibroblast growth factor on osteogenic differentiation of human periodontal ligament stem cells. J. Periodontol. 2020;91:975–985. doi: 10.1002/JPER.19-0273. [DOI] [PubMed] [Google Scholar]
  • 45.Li P., Gan Y., Xu Y., Song L., Wang L., Ouyang B., Zhang C., Zhou Q. The inflammatory cytokine TNF-alpha promotes the premature senescence of rat nucleus pulposus cells via the PI3K/Akt signaling pathway. Sci. Rep. 2017;7:42938. doi: 10.1038/srep42938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Matsuoka K., Bakiri L., Bilban M., Toegel S., Haschemi A., Yuan H., Kasper M., Windhager R., Wagner E.F. Metabolic rewiring controlled by c-Fos governs cartilage integrity in osteoarthritis. Ann. Rheum. Dis. 2023;82:1227–1239. doi: 10.1136/ard-2023-224002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kwon H.W., Shin J.H., Rhee M.H., Park C.E., Lee D.H. Anti-thrombotic effects of ginsenoside Rk3 by regulating cAMP and PI3K/MAPK pathway on human platelets. J. Ginseng Res. 2023;47:706–713. doi: 10.1016/j.jgr.2023.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Wang X., Tan X., Zhang J., Wu J., Shi H. The emerging roles of MAPK-AMPK in ferroptosis regulatory network. Cell Commun. Signal. 2023;21:200. doi: 10.1186/s12964-023-01170-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Xu J., Guo Z., Yuan S., Li H. BCL2L1 is identified as a target of naringenin in regulating ovarian cancer progression. Mol. Cell. Biochem. 2022;477:1541–1553. doi: 10.1007/s11010-022-04389-1. [DOI] [PubMed] [Google Scholar]
  • 50.Moriishi T., Kawai Y., Fukuyama R., Matsuo Y., He Y.W., Akiyama H., Asahina I., Komori T. Bcl2l1 Deficiency in Osteoblasts Reduces the Trabecular Bone Due to Enhanced Osteoclastogenesis Likely through Osteoblast Apoptosis. Int. J. Mol. Sci. 2023;24:17319. doi: 10.3390/ijms242417319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Holme J.A., Gorria M., Arlt V.M., Ovrebo S., Solhaug A., Tekpli X., Landvik N.E., Huc L., Fardel O., Lagadic-Gossmann D. Different mechanisms involved in apoptosis following exposure to benzo[a]pyrene in F258 and Hepa1c1c7 cells. Chem.-Biol. Interact. 2007;167:41–55. doi: 10.1016/j.cbi.2007.01.008. [DOI] [PubMed] [Google Scholar]
  • 52.Kuo W.T., Shen L., Zuo L., Shashikanth N., Ong M., Wu L., Zha J., Edelblum K.L., Wang Y., Wang Y., et al. Inflammation-induced Occludin Downregulation Limits Epithelial Apoptosis by Suppressing Caspase-3 Expression. Gastroenterology. 2019;157:1323–1337. doi: 10.1053/j.gastro.2019.07.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Ma X.Y., Zhang M., Fang G., Cheng C.J., Wang M.K., Han Y.M., Hou X.T., Hao E.W., Hou Y.Y., Bai G. Ursolic acid reduces hepatocellular apoptosis and alleviates alcohol-induced liver injury via irreversible inhibition of CASP3 in vivo. Acta Pharmacol. Sin. 2021;42:1101–1110. doi: 10.1038/s41401-020-00534-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Luo J., Li Y., Zhai Y., Liu Y., Zeng J., Wang D., Li L., Zhu Z., Chang B., Deng F., et al. D-Mannose ameliorates DNCB-induced atopic dermatitis in mice and TNF-alpha-induced inflammation in human keratinocytes via mTOR/NF-kappaB pathway. Int. Immunopharmacol. 2022;113:109378. doi: 10.1016/j.intimp.2022.109378. [DOI] [PubMed] [Google Scholar]
  • 55.Zhao J.H., Li J., Zhang X.Y., Shi S., Wang L., Yuan M.L., Liu Y.P., Wang Y.D. Confusoside from Anneslea fragrans Alleviates Acetaminophen-Induced Liver Injury in HepG2 via PI3K-CASP3 Signaling Pathway. Molecules. 2023;28:1932. doi: 10.3390/molecules28041932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Brumatti G., Salmanidis M., Ekert P.G. Crossing paths: Interactions between the cell death machinery and growth factor survival signals. Cell. Mol. Life Sci. 2010;67:1619–1630. doi: 10.1007/s00018-010-0288-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Li X., Gui R., Wang X., Ning E., Zhang L., Fan Y., Chen L., Yu L., Zhu J., Li Z., et al. Oligosaccharides isolated from Rehmannia glutinosa protect LPS-induced intestinal inflammation and barrier injury in mice. Front. Nutr. 2023;10:1139006. doi: 10.3389/fnut.2023.1139006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Taranu I., Pistol G.C., Anghel A.C., Marin D., Bulgaru C. Yeast-Fermented Rapeseed Meal Extract Is Able to Reduce Inflammation and Oxidative Stress Caused by Escherichia coli Lipopolysaccharides and to Replace ZnO in Caco-2/HTX29 Co-Culture Cells. Int. J. Mol. Sci. 2022;23:11640. doi: 10.3390/ijms231911640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Bodor C., Matolcsy A., Bernath M. Elevated expression of Cu, Zn-SOD and Mn-SOD mRNA in inflamed dental pulp tissue. Int. Endod. J. 2007;40:128–132. doi: 10.1111/j.1365-2591.2006.01196.x. [DOI] [PubMed] [Google Scholar]
  • 60.Sciskalska M., Oldakowska M., Marek G., Milnerowicz H. Changes in the Activity and Concentration of Superoxide Dismutase Isoenzymes (Cu/Zn SOD, MnSOD) in the Blood of Healthy Subjects and Patients with Acute Pancreatitis. Antioxidants. 2020;9:948. doi: 10.3390/antiox9100948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kruidenier L., Kuiper I., van Duijn W., Marklund S.L., van Hogezand R.A., Lamers C.B., Verspaget H.W. Differential mucosal expression of three superoxide dismutase isoforms in inflammatory bowel disease. J. Pathol. 2003;201:7–16. doi: 10.1002/path.1407. [DOI] [PubMed] [Google Scholar]
  • 62.Chen H., Peng F., Xu J., Wang G., Zhao Y. Increased expression of GPX4 promotes the tumorigenesis of thyroid cancer by inhibiting ferroptosis and predicts poor clinical outcomes. Aging. 2023;15:230–245. doi: 10.18632/aging.204473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Wang X., Bao R., Fu J. The Antagonistic Effect of Selenium on Cadmium-Induced Damage and mRNA Levels of Selenoprotein Genes and Inflammatory Factors in Chicken Kidney Tissue. Biol. Trace Elem. Res. 2018;181:331–339. doi: 10.1007/s12011-017-1041-z. [DOI] [PubMed] [Google Scholar]
  • 64.Cao Y.Y., Chen Y.Y., Wang M.S., Tong J.J., Xu M., Zhao C., Lin H.Y., Mei L.C., Dong J., Zhang W.L., et al. A catalase inhibitor: Targeting the NADPH-binding site for castration-resistant prostate cancer therapy. Redox Biol. 2023;63:102751. doi: 10.1016/j.redox.2023.102751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Ren L., Zhan P., Wang Q., Wang C., Liu Y., Yu Z., Zhang S. Curcumin upregulates the Nrf2 system by repressing inflammatory signaling-mediated Keap1 expression in insulin-resistant conditions. Biochem. Biophys. Res. Commun. 2019;514:691–698. doi: 10.1016/j.bbrc.2019.05.010. [DOI] [PubMed] [Google Scholar]
  • 66.Kunz H.E., Hart C.R., Gries K.J., Parvizi M., Laurenti M., Dalla Man C., Moore N., Zhang X., Ryan Z., Polley E.C., et al. Adipose tissue macrophage populations and inflammation are associated with systemic inflammation and insulin resistance in obesity. Am. J. Physiol. Endocrinol. Metab. 2021;321:E105–E121. doi: 10.1152/ajpendo.00070.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Han L., Qu Q., Aydin D., Panova O., Robertson M.J., Xu Y., Dror R.O., Skiniotis G., Feng L. Structure and mechanism of the SGLT family of glucose transporters. Nature. 2022;601:274–279. doi: 10.1038/s41586-021-04211-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Niu Y., Liu R., Guan C., Zhang Y., Chen Z., Hoerer S., Nar H., Chen L. Structural basis of inhibition of the human SGLT2-MAP17 glucose transporter. Nature. 2022;601:280–284. doi: 10.1038/s41586-021-04212-9. [DOI] [PubMed] [Google Scholar]
  • 69.Moran A.W., Al-Rammahi M.A., Daly K., Grand E., Ionescu C., Bravo D.M., Wall E.H., Shirazi-Beechey S.P. Consumption of a Natural High-Intensity Sweetener Enhances Activity and Expression of Rabbit Intestinal Na(+)/Glucose Cotransporter 1 (SGLT1) and Improves Colibacillosis-Induced Enteric Disorders. J. Agric. Food Chem. 2020;68:441–450. doi: 10.1021/acs.jafc.9b04995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Xiao P., Hu Z., Lang J., Pan T., Mertens R.T., Zhang H., Guo K., Shen M., Cheng H., Zhang X., et al. Mannose metabolism normalizes gut homeostasis by blocking the TNF-alpha-mediated proinflammatory circuit. Cell. Mol. Immunol. 2023;20:119–130. doi: 10.1038/s41423-022-00955-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Zhang R., Yang Y., Dong W., Lin M., He J., Zhang X., Tian T., Yang Y., Chen K., Lei Q.Y., et al. D-mannose facilitates immunotherapy and radiotherapy of triple-negative breast cancer via degradation of PD-L1. Proc. Natl. Acad. Sci. USA. 2022;119:e2114851119. doi: 10.1073/pnas.2114851119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Liang W., Huang L., Whelchel A., Yuan T., Ma X., Cheng R., Takahashi Y., Karamichos D., Ma J.X. Peroxisome proliferator-activated receptor-alpha (PPARalpha) regulates wound healing and mitochondrial metabolism in the cornea. Proc. Natl. Acad. Sci. USA. 2023;120:e2217576120. doi: 10.1073/pnas.2217576120. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are contained within the article.


Articles from Antioxidants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES