Skip to main content
Biology logoLink to Biology
. 2024 Jun 5;13(6):415. doi: 10.3390/biology13060415

CopG1, a Novel Transcriptional Regulator Affecting Symbiosis in Bradyrhizobium sp. SUTN9-2

Praneet Wangthaisong 1, Pongdet Piromyou 2, Pongpan Songwattana 2, Tarnee Phimphong 1, Apisit Songsaeng 1, Natcha Pruksametanan 1, Pakpoom Boonchuen 1, Jenjira Wongdee 2, Kamonluck Teamtaisong 3, Nantakorn Boonkerd 1, Shusei Sato 4, Panlada Tittabutr 1,*, Neung Teaumroong 1,*
Editors: Fengli Zhang, Zhiqiang Liu, Michel Denis
PMCID: PMC11201211  PMID: 38927295

Abstract

Simple Summary

In the process of symbiosis, ΔcopG1 in the type IV secretion system (T4SS) demonstrated the ability to invade root cells but was unable to survive and multiply within root cells. Conversely, traG1 and virD21 were found to be essential in the early stages of nodule formation. Intriguingly, copG1 is required for nod gene expression and acts as a repressor of T4SS genes. Moreover, the absence of copG1 results in certain proteins not being produced, especially T3SS (nopX and nopP) and C4-dicarboxylic acid (dct), which affects the symbiosis between Bradyrhizobium sp. SUTN9-2 and legumes. These findings support the hypothesis that the copG1 gene may serve as a new regulator of the symbiotic process.

Abstract

The symbiotic interaction between leguminous and Bradyrhizobium sp. SUTN9-2 mainly relies on the nodulation process through Nod factors (NFs), while the type IV secretion system (T4SS) acts as an alternative pathway in this symbiosis. Two copies of T4SS (T4SS1 and T4SS2) are located on the chromosome of SUTN9-2. ΔT4SS1 reduces both nodule number and nitrogenase activity in all SUTN9-2 nodulating legumes. The functions of three selected genes (copG1, traG1, and virD21) within the region of T4SS1 were examined. We generated deleted mutants and tested them in Vigna radiata cv. SUT4. ΔtraG1 and ΔvirD21 exhibited lower invasion efficiency at the early stages of root infection but could be recently restored. In contrast, ΔcopG1 completely hindered nodule organogenesis and nitrogenase activity in all tested legumes. ΔcopG1 showed low expression of the nodulation gene and ttsI but exhibited high expression levels of the T4SS genes, traG1 and trbE1. The secreted proteins from ΔT4SS1 were down-regulated compared to the wild-type. Although ΔcopG1 secreted several proteins after flavonoid induction, T3SS (nopP and nopX) and the C4-dicarboxylate transporter (dct) were not detected. These results confirm the crucial role of the copG1 gene as a novel key regulator in the symbiotic relationship between SUTN9-2 and legumes.

Keywords: symbiosis, Vigna radiata, T4SS, copG

1. Introduction

Rhizobia-legume symbiosis is a key process of mutually beneficial relationships where nitrogen-fixing Rhizobia bacteria form root nodules and convert atmospheric nitrogen into ammonia that can be used by the plant, while the plant provides the bacteria with carbohydrates [1]. This symbiosis is ecologically significant for providing a major input of nitrogen into ecosystems. It also benefits agriculture by reducing reliance on synthetic nitrogen fertilizers, which can have negative environmental impacts [2]. However, specific symbiotic relationships between rhizobia and plant species require a complex exchange of signaling compounds, which is the key factor in successful symbiosis [3]. Two crucial mechanisms are necessary for the nodulation process of many rhizobia: (i) the classical mechanism of perception of the Nod factors (NFs), which are lipochitooligosaccharides (LCOs) produced by nitrogen-fixing rhizobia. These signal molecules are essential components for successful symbiosis [4]. (ii) secretion systems, the mechanism utilized mainly by pathogens to deliver effector proteins into their hosts [5]. For plant-microbe interaction, effector proteins are recognized by resistance (R) proteins, triggering rapid defense responses called effector-triggered immunity (ETI) and causing a hypersensitive response (HR) to prevent pathogen invasion and disease [6,7]. Nevertheless, the secretion systems have become one of the key mechanisms for the successful symbiosis of many rhizobia with legumes.

Secretion systems, including type III (T3SS), type IV (T4SS), and type VI (T6SS), have been identified in various genera of rhizobia. These systems are also reported as the key determinants of symbiotic interactions during infection processes, and the T3SS is the most prevalent secretion system among rhizobia [8,9,10]. Effector proteins are secreted into the host plant to trigger effector-triggered susceptibility (ETS), enabling successful infection and survival in the host [11]. Remarkably, the Rhizobium harboring secretion systems and effectors demonstrates the ability to suppress host defenses and facilitate infection, similar to plant-pathogen interactions [12]. The secreted effector proteins from T3SS (T3Es) can have either a positive or negative impact on symbiosis efficiency, depending on the plant species [12]. For example, Bradyrhizobium vignae ORS3257 contains multiple effector proteins that are crucial for modulating symbiotic properties in different Vigna species. NopT and NopAB play essential roles in nodulation in V. unguiculata and V. mungo. Whereas, NopP2 displayed incompatibility with V. radiata [13]. Beside the T3SS, the T6SS of Rhizobium etli Mim1 and Bradyrhizobium sp. LmicA16 (A16) exhibit a positive effect on nodulation with their host [14,15]. In the case of T4SS, this secretion machinery is found in various bacteria. It functions as a molecular channel, allowing bacteria to transport diverse molecules across their cell envelope [16]. Generally, T4SS is utilized by Agrobacterium sp. to transfer T-DNA into plant hosts, causing crown gall disease [17]. Various rhizobia, including Bradyrhizobium, Rhizobium, Sinorhizobium, and Mesorhizobium, possess T4SS homologs to those found in Agrobacterium sp. These systems belong to the tra/trb operon and can be located either in the chromosome or plasmid, depending on the bacterial strain [18,19,20,21]. Interestingly, most bradyrhizobia harbor the tra/trb operon on the chromosome, but a few studies on the role of T4SS of Bradyrhizobium in the symbiotic process have been reported.

This study focuses on Bradyrhizobium sp. SUTN9-2, a broad host range strain known for its diverse ability to nodulate with various legumes. Moreover, it acts as a rice endophyte, playing a crucial role in promoting rice growth [22,23]. Previously, we found two clusters of T4SS (T4SS1 and T4SS2) located on the chromosome of SUTN9-2 with different gene arrangements (Figure S1). A specialized gene arrangement consisting of copG (a putative transcriptional factor), traG (T4SS structural), and virD2 (relaxase) was observed in the T4SS gene cluster of Bradyrhizobium species. The T4SS evolutionary analysis of the Rhizobiales order, encompassing Bradyrhizobium, Rhizobium, Sinorhizobium, and Mesorhizobium through the traG gene phylogenetic tree, demonstrates a co-evolutionary trend between Bradyrhizobium and Mesorhizobium. Upon phylogenetic examination of the copG, traG, and virD2 combination genes in Bradyrhizobium, two copies of these clusters were divided into two clades within the bradyrhizobia group [24]. Moreover, copy 1 of the copG, traG, and virD2 genes exhibits a close evolutionary association with B. yuanmingense BRP09, the main rhizobia associated with cowpea and mung bean in the subtropical region of China [25], as well as with B. diazoefficiens USDA110, a soybean inoculant [26]. Interestingly, the T4SS1 mutant (cluster deletion including copG1, traG1, and virD21 fragment) retarded nodulation ability in V. radiata cv. SUT4 and Crotalaria juncea, and both the number of nodules and nitrogenase activity were decreased compared with the wild-type. The results indicated that T4SS1 has a positive effect on symbiotic interactions with the tested plants [24]. To elucidate the role of T4SS1 in symbiosis, this study investigated the functions of individual copG1, traG1, and virD21 genes during their interaction with V. radiata cv. SUT4. Notably, this study reveals a crucial function of copG1 in regulating symbiosis not only in V. radiata but potentially across the Genistoids, Dalbergioids, and Millettioids lineages. This knowledge could be applied to develop future rhizobial inoculants that enhance nitrogen fixation capabilities in a wide range of legumes.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Growth Conditions

The bacterial strains and plasmids used in this study are listed in Table S1. Bradyrhizobium sp. SUTN9-2 was grown in an arabinose-gluconate (AG) medium [27]. The derivative mutants ΔcopG1, ΔtraG1, and ΔvirD21 were supplemented with streptomycin (sm) at 200 µg/mL. Escherichia coli strains were grown at 37 °C in Luria-Bertani (LB) medium. Antibiotics were added to the medium as required at the following concentrations: 50 µg/mL kanamycin (km), 30 µg/mL nalidixic acid (nal), and 200 µg/mL streptomycin (sm).

2.2. Plasmid Construction and Gene Deletion

The deletion mutants of copG1, copG2, traG1, and virD21 genes in Bradyrhizobium sp. SUTN9-2 (GeneBank accession number LAXE00000001) were obtained as follows: The upstream and downstream regions of copG1 (up: 575 bp, dw: 841 bp), copG2 (up: 874 bp, dw:1043 bp), traG1 (up: 1060 bp, dw:921 bp), and virD21 (up: 944 bp, dw: 738 bp) genes were obtained by PCR using the primers listed in Table 1. The target deletion genes in SUTN9-2 were obtained by double crossover. PCR fragments corresponding to the upstream and downstream flanking regions of the gene of interest were merged by overlap extension and introduced into a pNTPS129 plasmid harboring the sacB gene [28]. Then, an Ω cassette fragment (spectinomycin/streptomycin resistance genes) from pHP45 (omega) [29] was introduced between the upstream and downstream flanking regions, which were already cloned into pNTPS129. The restriction sites for antibiotic insertion were HindIII for copG1 and BamHI for copG2, traG1, and virD21. The recombinant plasmids were transferred into SUTN9-2 by triparental mating using pRK2013 as a helper plasmid [30], as described previously [24]. A single recombinant clone was obtained from antibiotic selection and PCR verification. Double recombinant clones were selected by culture on AG medium supplemented with 10% sucrose and 200 µg/mL sm. Candidate clones were verified for the loss of the sacB gene from pNTPS129, and the replacement of the Ω cassette was verified by PCR. All mutant strains were further investigated for nodulation efficiency in V. radiata cv. SUT4.

Table 1.

Primers used in this study.

Name Sequences (5′-3′) Descriptions
Primers for gene deletion
Up.copG1.
XbaI.F
CCT TGA GAT CTA GAT GTA GTC
TGC CCC GAA GTA GC
These primer sets were used to obtain the deletion of the copG1 gene of Bradyrhizobium sp. SUTN9-2 by double crossing over.
Up. copG1.
overl. HindIII. R
GAG GCG GAC ATG AAA GCT TAA
TGA AGG CGG ACG GCC ACT AG
Dw. copG1.
overl. HindIII. F
GTC CGC CTT CAT TAA GCT TTC
ATG TCC GCC TCA CAG TCC GA
Dw. copG1.
EcoRI.R
AGA TCG GGA ATT CGT TGA CCG AGG ATC TTC AGG CCA
Up. copG2.
XbaI.F
GCC GTT TCT AGA ATT GCG ACA
ACG GAC CAG GGC AA
These primer sets were used to obtain the deletion of the copG2 gene of Bradyrhizobium sp. SUTN9-2 by double crossing over.
Up. copG2.
overl. HindIII. R
GCG CGA CCG AAT GAA GCT TAA GCT GGT CAC GCT ATC GGC T
Dw. copG2.
overl. HindIII. F
GCG TGA CCA GCT TAA GCT TCA
TTC GGT CGC GCA TAT TGC C
Dw. copG2.
EcoRI. R
CTG TCC GAA TTC ATG TCG TTC
CTC GGG TTG TAC C
Up. traG1.
XbaI. F
TTC GGG TCT AGA TGT AGT CTG
CCC CGA AGT AGC
These primer sets were used to obtain the deletion of the traG1 gene of Bradyrhizobium sp. SUTN9-2 by double crossing over.
Up. traG1.
overl. BamHI
TCC CTC CAA TCA CGG ATC CAT
CCT GGT GAC GAT CTC GGA C
Dw. traG1.
overl. BamHI
TCG TCA CCA GGA TGG ATC CGT
GAT TGG AGG GAT CGT TCA CAG
Dw. traG1.
EcoRI.R
CCG GCT GAA TTC CTT GGA AAG
CCT TGG TCT CG
Up. virD21.
XbaI. F
ACC GGC TTC TAG AAG ATG CGC AGT CCG CAT CAT C These primer sets were used to obtain the deletion of the virD21 gene of Bradyrhizobium sp. SUTN9-2 by double crossing over.
Up. virD21.
overl. BamHI
GAG GAG AAG GAA TGG ATC CTG AAC GAT CCC TCC AAT CAC CG
Dw. virD21.
overl. BamHI
GAG GGA TCG TTC AGG ATC CAT
TCC TTC TCC TCA GCC ATG GC
Dw. virD21.
EcoRI. R
CCA TCG GAA TTC TTG TCG ATG
CGG AGG AGG CAT C
Primers for qRT-PCR analysis
SUTN9-2. nodA. F GTT CAA TGC GCA GCC CTT TGA G Specific primers for nodA gene expression in SUTN9-2 on the chromosome
SUTN9-2. nodA. R ATT CCG AGT CCT TCG AGA TCC G
SUTN9-2. nodC. F ATT GGC TCG CGT GCA ACG AAG A Specific primers for nodC gene expression in SUTN9-2 on the chromosome
SUTN9-2. nodC. R AAT CAC TCG GCT TCC CAC GGA A
SUTN9-2. nodD1. F ATT CGT CTC CTC AGA CCG TGC T Specific primers for nodD1 gene expression in SUTN9-2 on the chromosome
SUTN9-2. nodD1. R TTC ATG TCG AGT GCG CAC CCT A
SUTN9-2. nodD2. F TGC TTA ACT GCA ACG TGA CCC Specific primers for nodD2 gene expression in SUTN9-2 on the chromosome
SUTN9-2. nodD2. R ATG AGC ACG AGG AGC TTC TC
SUTN9-2. trbE1. F GAT TGC AGG AGA ACC GTG AGG C Specific primers for trbE1 gene expression in SUTN9-2 on the chromosome
SUTN9-2. trbE1. R AAC AGC GCC GAG GAT TCA GTC T
SUTN9-2. traG1. F TTC TCG ATC TGG TTC AGC GAC TG Specific primers for traG1 gene expression in SUTN9-2 on the chromosome
SUTN9-2. traG1. R TTG ACC GAG GAT CTT CAG GCC A
SUTN9-2. ttsI. F ATG AGT TCG TCG GTG GAC AC Specific primers for transcriptional regulator TtsI (ttsI) gene expression in SUTN9-2 on chromosome
SUTN9-2. ttsI. R CCA CAT GGT CCT GCT CGA AT
16s. F ATT ACC GCG GCT GCT GG Universal primers for 16S rRNA are used as an internal control for bacterial gene expression [31]
16s. R ACT CCT ACG CGA GGC AGC AG
dct. F CGA CTA TCA GGG CGT GAA AT Specific primers for C4-dicarboxylate transport (dct) gene expression in SUTN9-2 on chromosome
dct. R TCC AGC AAT CAG ACC TGT G
nopX. F GGGTGGTCGAGGAAGTATTG Specific primers for Type III secretion system (T3SS) gene expression in SUTN9-2 on chromosome
nopX. R GGTTATGACCCAGACCGATG
nopP. F GGTCACACCGACGAAGATAC
nopP. R CCGAAGATCCACTTGGGATG

2.3. Nodulation Test and Acetylene Reduction Assay (ARA)

V. radiata cv. SUT4 seeds were surface sterilized and germinated as previously described [32] and placed on 0.85% water agar at 28 °C overnight. One-day-old germinated seedlings were transferred into Leonard’s jars containing sterilized vermiculite and liquid buffered nodulation media (BNM) [33]. Seven days after gemination, seedlings were inoculated with a bacterial suspension of Bradyrhizobium sp. SUTN9-2 or derivative mutants (1 mL per seedling; adjusted to OD600 = 0.8). Five plants per treatment were selected for nodule counting. Symbiotic phenotypes and nitrogen activity were measured at 7, 14, and 21 dpi.

Acetylene reduction assays (ARAs) were used to evaluate nitrogenase activity. The root samples were transferred into test tubes, which were closed with a plastic stopper. The samples were then incubated with 10% (v/v) pure acetylene instead of air, which was withdrawn for 1 h at room temperature. A 1 mL sample was examined using gas chromatography (GC) with a PE-alumina-packed column to measure the conversion of acetylene (C2H2) to ethylene (C2H4). Detection was performed at an injection temperature of 150 °C and oven temperatures of 200 °C and 50 °C for flame ionization detection (FID) [34]. The experiment was conducted with five biological replicates per treatment. Nitrogenase activity is presented in nmol ethylene/h/plant dry weight [35].

The symbiotic profiles of ΔcopG1 were compared with those of SUTN9-2 using a growth pouch test and several leguminous plants, including Genistoids (Crotalaria juncea), Dalbergioids (Aeschynomene americana cv. Thai, Arachis hypogaea cv. Thainan 9 and A. hypogaea cv. Khonkaen 5), and Millettioids (Indigofera tinctoria, Macroptilium atropurpureum, V. radiata cv. SUT1, V. radiata cv. CN72, V. radiata cv. KUML4, V. radiata cv. CN36, V. radiata cv. KPS1, V. mungo cv. U thong 2 and, V. subterranean). Seeds were sterilized and germinated as previously described [32,36]. Pouches were prepared [35] and supplemented with BNM medium. Seedlings were grown at two plants per pouch (Five pouch replicates per treatment) and inoculated with 1 mL per plant of a suspension containing OD600 = 0.8. Plants were grown under the conditions mentioned above.

2.4. Bacterial Induction, RNA Isolation, and qRT–PCR Analysis of Gene Expression

For bacterial induction, the mid-log phase of bacterial cultures, including Bradyrhizobium sp. SUTN9-2 and copG1 mutant strains (OD600 = 0.4), was induced by 20 μM genistein at 28 °C for 24 h. Then, bacterial pellets were collected by centrifugation (4000× g, at 4 °C) for total RNA isolation. Total RNA was isolated from bacterial pellets using an RNeasy® Protect Cell Mini Kit (Qiagen, Chatsworth, CA, USA) according to the manufacturer’s instructions. Total RNA was treated at 37 °C for 30 min with RNase-free DNase I (New England Biolabs, Ipswich, MA, USA).

cDNA was synthesized using iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer’s protocol. A cDNA concentration of 50 ng/µL was subjected to real-time PCR using specific primers (Table 1) for nodulation genes (nodA, nodB, nodC, nodD1, and nodD2), transcriptional regulator of T3SS (ttsI), T4SS structural genes (traG1 and trbE1), and other genes. qRT-PCR reactions were performed with Luna® Universal qPCR Master Mix (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol, and thermal cycling was conducted in a CFX Opus 96 Real-Time PCR System (Bio-Rad Laboratories, Inc.). The reactions were performed in triplicate for each of the three biological replicates. Relative gene expression was analyzed by the comparative Ct method 2(−ΔΔCT), and 16s rRNA (accession number: JN578804) was used as an internal control [18]. Three biological replicates were analyzed.

2.5. Protein Preparation, Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) Analysis, and Protein Identification

Wild-type (WT) and ΔcopG1 Bradyrhizobium sp. SUTN9-2 were grown in AG medium with shaking at 200 rpm and 30 °C until they reached an OD600 of 1. One percent (v/v) of each starter was inoculated into 100 mL of AG medium with and without 20 µM genistein induction. The cultures were then incubated at 30 °C until they reached an OD600 of approximately 1.0. The bacterial supernatants were harvested by centrifugation at 4000× g and 4 °C for 1 h, followed by 8000× g for 30 min. One milliliter of 1 M dithiothreitol (DTT) and 7.5 mL of phenol solution (equilibrated with 10 mM Tris HCl at pH 8.0 with ESTA) were added into 25 mL of fresh supernatant. The solution was vigorously mixed with a vortex before centrifugation at 8000× g and 4 °C for 30 min. The water phase was discarded, and the phenol phase was added into another 25 mL of supernatant, followed by vigorous mixing and centrifugation at 8000× g and 4 °C for 30 min. Next, 20 mL of methanol containing 300 µL of 8 M ammonium acetate and 400 µL of 1 M dithiothreitol were added to remove the phenol phase. The secreted protein was precipitated overnight at 20 °C. The solution was then centrifuged at 8000× g and 4 °C for 1 h, and the supernatant was discarded. After precipitation, the protein was washed with chilled 70% (v/v) ethanol and air-dried in a laminar flow before being dissolved in phosphate-buffered saline (PBS). Protein concentrations were determined using a plate reader and the manufacturer’s protocol (PanReac, Barcelona, Spain) according to the Bradford method [37]. A standard calibration curve was constructed using 0 to 2 µg of bovine serum albumin (BSA). Denaturing SDS-PAGE was performed according to the method of Laemmli [38], in which 10 µg of each lane of protein was analyzed on a 12% SDS-PAGE gel. The protein samples were mixed with loading buffer containing β-mercaptoethanol and heated for 10 min before loading. Protein bands were stained with colloidal Coomassie brilliant blue R-250 to visualize the expression of secreted protein. The protein bands that were observed on the WT lane but not observed on the ∆T4SS1 lane were cut for protein identification by mass spectrometry. Breiftly, the protein bands were performed ingel digestion by 12.5 ng/µL trypsin (mass spectrometry grade; Promega, Madison, WI, USA). The extracted peptides were collected and dried in the Nitrogen Evaporator (Organomation, Berlin, MA, USA). The peptides were then reconstituted in 15 µL of 0.1% formic acid (FA) for LC/MS analysis. The LC-MS/MS system consists of a liquid chromatography part (Dionex Ultimate 3000, RSLCnano System, Thermo Fisher Scientific, Waltham, MA, USA) in combination with a captivespray ionization/mass spectrometer (Model Q-ToF Compact, Bruker, Germany) at the Proteomics Services, Faculty of Medical Technology, Mahidol University (Salaya Campus, Mahidol University, Nakhon Pathom, Thailand). Mass spectral data from 300 to 1500 m/z were collected in the positive ionization mode. The most abundant peptide ions were analyzed using MS/MS to determine the peptide sequence. The peptide sequence was searched on the UniProt database using the Mascot Daemon version 2.6.0 (Matrix Science, London, UK) search engine. The search parameters in the Mascot daemon MS/MS Ions search included carbamidomethyl at cysteine residues as a fixed modification and oxidation on methionine as a variable modification. The peptide tolerance was set at ±1.6 Da, and the MS/MS fragment tolerance was set at ±0.8 Da. Protein hits were selected with a p-value of ≤0.05. The obtained results were examined against the protein-NCBI database to identify and annotate proteins.

2.6. Microscopy

Nodule phenotypes and cross sections of representative nodules generated by the wild-type (WT) or mutants were examined under a stereomicroscope LEIGA EZ4 (Leica Microsystems, Wetzlar, Germany). For in-situ live or dead cell staining, the nodules were harvested and embedded in 5% agarose [39]. Three plants per treatment were selected for nodule sections with a thickness of 40–50 µm. They were prepared with a VT1000S vibratome (Leica, Nanterre, France) and incubated with live/dead staining solution (5 µM SYTO9 and 30 µM propidium iodide (PI) in PBS pH 7.0 buffer) for 30 min, followed by staining with 1 calcofluor-white stain for 20 min. Sections were washed to remove the staining solution and mounted in 10% glycerol in PBS buffer. After staining, nodules were observed by confocal microscopy using a Nikon Inverted Eclipse Ti-E Confocal Laser Scanning Microscope. Calcofluor-white was detected with emission at 460–500 nm, while SYTO9 and PI were detected at 510–570 nm and 600–650 nm, respectively [24]. Three nodules were randomly selected for imaging and bacteroid observation.

2.7. Bioinformatics

Bradyrhizobium sp. SUTN9-2 genome sequences were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov, accessed on 9 November 2021) and Genoscope (https://mage.genoscope.cns.fr, accessed on 15 February 2022) [40]. Multiple sequence alignments were determined using CLUSTALW (2.1) (https://www.genome.jp/tools-bin/clustalw, accessed on 20 April 2023). Domain architecture analysis was performed using the Simple Modular Architecture Research Tool (SMART) (https://smart.embl.de, accessed on 31 March 2023) [41] and InterPro (https://www.ebi.ac.uk/interpro, accessed on 20 April 2023) [42]. The annotation features and whole genome sequences were analyzed using SnapGene software version 7.2.0 (www.snapgene.com, accessed on 20 April 2023).

2.8. Statistical Analysis

All data were obtained from experiments performed in triplicate. For statistical analyses, one-way analysis of variance (ANOVA) followed by Tukey’s honestly significant difference (HSD) test (Tukey’s tests at p ≤ 0.05) and Student’s t-tests (p ≤ 0.05) were performed using SPSS software (SPSS version 22.0 windows: SPSS Inc., Chicago, IL, USA) and GraphPad Prism statistical software (Version 10.0.3).

3. Results

3.1. Symbiotic Properties of ΔcopG1, ΔtraG1, and ΔvirD21 in Vigna radiata cv. SUT4

Differences between the wild-type and mutants of Bradyrhizobium sp. SUTN9-2 were observed in terms of nodulation and nitrogenase activity in V. radiata cv. SUT4 (Figure 1). ΔtraG1 and ΔvirD21 induced a higher number of nodules on the plant tested than the wild-type at 7 days post-inoculation (dpi) (Figure 1Q), although the nodules produced displayed a white color (Figure 1I,M) instead of pink, indicating problems in nodule development. Moreover, there were higher numbers of dead cells in nodules inoculated with ΔtraG1 and ΔvirD21 in the symbiosome area (Figure 1J,N). At 21 dpi, there was no difference in the number of nodules obtained using ΔtraG1, ΔvirD21, or the wild-type (Figure 1R).

Figure 1.

Figure 1

Symbiotic phenotypes of Bradyrhizobium sp. SUTN9-2 mutants during symbiosis with Vigna radiata cv. SUT4. Nodule phenotype at 7 and 21 dpi were generated by wild-type (A,C), ΔcopG1 (E,G), ΔtraG1 (I,K), and ΔvirD21 (M,O). Cytological analysis of the nodules (at 7 dpi and 21 dpi) induced by SUTN9-2 with wild-type (B,D), ΔcopG1 (F,H), ΔtraG1 (J,L), and ΔvirD21 (N,P) observed by confocal microscopy after staining with propidium iodide, PI (red; infected plant nuclei and dead bacteria), SYTO9 (green: live bacteria), and calcofluor-white (blue: plant cell wall). Number of nodules at 7 dpi (Q) and 21 dpi (R). Nitrogen fixation activity was determined by the acetylene reduction assay (ARA) of plants infected with the indicated bacterial mutants at 7 dpi (S) and 21 dpi (T). Values represent the mean ± SD (n = 5). Scale bars: white bars indicate 1 mm, yellow bars indicate 100 µm (20X), and 50 µm (40X). p values based on Tukey’s test (* p < 0.05, ** p < 0.01, *** p < 0.001).

In addition, there were different results of nitrogenase activities in each mutant at 21 dpi; ΔtraG1 was identical to that of the wild-type, whereas low nitrogenase activity was obtained with ΔvirD21 (Figure 1T). Interestingly, ΔcopG1 showed a significant effect on nodulation in that nodule formation was abolished (Figure 1E,G,Q,R). Although nodule organogenesis was not observed in the plant inoculated with ΔcopG1, both live and dead cells were detected in the cortex and vascular tissue instead (Figure 1H). According to the results, ΔcopG1 could infect plant cells, but it was no longer capable of surviving in host cells.

Interestingly, copG1 has the potential to regulate symbiosis not only in V. radiata but also across diverse lineages such as Genistoids, Dalbergioids, and Millettioids (Table S2). These findings suggest that copG1 may have a conserved role in governing symbiosis interactions across various plant species by controlling the primary symbiotic interaction system.

3.2. The copG Genes Are Involved in Nodulation Efficiency of Bradyrhizobium sp. SUTN9-2

The copG gene typically encodes the CopG protein, which is a transcription factor consisting of ribbon helix-turn-helix (RHH) motifs. Bradyrhizobium sp. SUTN9-2 has two copies of the copG gene located downstream of the traG and virD2 genes. These gene clusters are located in distinct locations on the SUTN9-2 chromosome. Although two copies of the copG genes were present on the chromosome, they did not share the same gene sequences. The copG gene copies 1 and 2 (copG1 and copG2) revealed a low degree of similarity, with 52.35% DNA sequence identity (Figure S2) and 51.77% amino acid sequence identity (Figure S3), which differ in both the N- and C-terminals. Domain architecture analysis identified CopG1 as an unidentified domain, which shows similarities with B. yuanmingense BRP09, CCBAU05623, and, more distantly, in P10 130. While, CopG2 was identified as a Pfam:RHH domain that is also found in B. diazoefficiens USDA110, B. diazoefficiens SEMIA5080, and B. japonicum J5 (Figure S4).

To gain a more complete understanding of the functions of copG1 and copG2, we constructed ΔcopG2, inoculated it into V. radiata cv. SUT4, and compared it with ΔcopG1 and wild-type strains (Figure 2). Contrary to ΔcopG1 (Figure 2B), ΔcopG2 was able to produce pink nodules (Figure 2C) that were smaller than those generated by the wild-type (Figure 2A). At 14 and 21 dpi, ΔcopG2 produced the highest number of nodules compared with the other strains (Figure 2G,H). Despite the high number of nodules generated by ΔcopG2, the nitrogenase activity was significantly lower than that of the wild-type (Figure 2I,J). Confocal microscopic examination showed dead cells in nodules generated by ΔcopG2 (Figure 2F) in the symbiosome, as seen in red after staining with PI, in contrast with the wild-type (Figure 2D), which contains more live cells as seen in green by SYTO9 staining. These findings indicate that both copG1 and copG2 genes are essential for the symbiotic relationship between SUTN9-2 and legume plants. copG1 is necessary for nodulation, whereas copG2 is crucial for nitrogenase efficiency. Lack of copG2 leads to decreased nitrogenase activity, despite the presence of high nodule numbers.

Figure 2.

Figure 2

Derivative copG mutants of Bradyrhizobium sp. SUTN9-2 exhibit different symbiotic interactions with Vigna radiata cv. SUT4. Nodule phenotypes induced by wild-type (A), ΔcopG1 (B), and ΔcopG2 (C). Cytological analysis of live and dead cells of section nodules infected with wild-type (D), ΔcopG1 (E), and ΔcopG2 (F) at 14 dpi was performed using confocal microscopy, and bacteroids were stained with PI (red; infected plant nuclei and dead bacteria), SYTO9 (green: live bacteria), and calcofluor-white (blue: plant cell wall). Number of nodules at 14 dpi (G) and 21 dpi (H). Nitrogen fixation activity was determined by the ARA of plants infected with the indicated bacterial mutants at 14 (I) and 21 dpi (J). Values represent the mean ± SD (n = 5). Scale bars: white bars indicate 1 mm, and yellow bars indicate 50 µm (40X). p values based on Tukey’s test (** p < 0.01, *** p < 0.001).

3.3. The copG1 Gene Plays a Crucial Role in the Expression of Nodulation (nod) Genes and Transcriptional Regulator TtsI (ttsI)

To examine whether copG1 affects the structuring of the NF backbone, transcript levels of nodABC and transcriptional activator nodD (nodD1 and nodD2) were examined with and without 20 µM genistein induction (Figure 3). The nodA, nodC, nodD1, and nodD2 genes were almost not expressed in ΔcopG1 (Figure 3A,C–E), whereas the expression of nodB was not affected by a mutation in copG1 (Figure 3B). The results indicated that copG1 modulates, either directly or indirectly, the expression of nod genes, especially the nodD gene (Figure 3D,E), which is a transcriptional activator of NFs [43]. Beside NF biosynthesis, NodD1 also activates the transcriptional regulator TtsI (ttsI), a gene encoding for T3SS secretion and synthesis [44]. Similar to the nod genes, the expression level of ttsI was not determined in ΔcopG1 in all conditions (Figure 3F). The loss of nodule formation in ΔcopG1 may be caused by the suppression of NF synthesis and T3SS due to the absence of nodD expression.

Figure 3.

Figure 3

qRT-PCR analysis of nod genes from wild-type Bradyrhizobium sp. SUTN9-2 (WT) and ΔcopG1 grown in the absence and presence of 20 μM genistein (G). Expression of structural genes nodA (A), nodB (B), nodC (C), regulatory genes nodD1 (D), nodD2 (E), and transcriptional regulator of T3SS, ttsI (F). The data were normalized in relation to the endogenous control (16S rRNA). Values represent the mean ± SD (n = 3). p values based on Tukey’s test (** p < 0.01, *** p < 0.001).

3.4. Bradyrhizobium sp. SUTN9-2 copG1 Is Involved in the Repression of the T4SS Structural Genes traG1 and trbE1

To understand the relationship between the T4SS and copG1 genes more clearly, the gene expression fold changes were examined. T4SS with the trbE1 and traG1 genes showed high expression levels under non-symbiotic conditions when copG1 was deleted (Figure 4A,B). These results indicate that copG1 of SUTN9-2 may act as a suppressor of trbE1 and traG1 under non-symbiotic conditions. However, under mimicked symbiotic conditions with 20 µM genistein induction, the expression of the trbE1 gene significantly decreased in ΔcopG1 compared to the wild-type. The expression of the traG1 gene did not differ between the wild-type and the ΔcopG1 (Figure 4C,D). However, it is noteworthy that under mimicked symbiosis conditions, CopG1 can induce the expression of trbE1 and traG1, resulting in significantly higher levels than those observed under non-induction conditions. These results suggest that copG1 might act as a synergistic regulator of the T4SS gene in SUTN9-2 under flavonoid induction (Figure 4C,D).

Figure 4.

Figure 4

Relative expression of representative T4SS structural genes, including trbE1 (A,C) and traG1 genes (B,D) in Bradyrhizobium sp. SUTN9-2 (WT) and ΔcopG1 with and without 20 μM genistein (G) induction. The 16S rRNA gene was used as an internal control. Values represent the mean ± SD (n = 3). p values based on the student’s t-test (ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001). The green and red arrows represent a statistical increase and decrease, respectively, in gene expression when comparing experiments with and without genistein.

3.5. Effect of T4SS and copG1 on the Secreted Protein Pattern after 48 h of Genistein Induction

The secreted protein patterns of Bradyrhizobium sp. SUTN9-2, ∆T4SS1, and ∆copG1 with 20 µM genistein after 48 h of induction were analyzed by SDS-PAGE. The results revealed distinct protein band patterns under the different conditions (Figure 5). The amino acid sequences of each selected band were examined using mass spectrometry (MS) with the MASCOT program (Table S3 and Figures S5–S8). In the wild-type, genistein induction (band 1) contained a protein matched with the T3SS translocon protein NopX (27%), whereas this band was absent at the same position as ∆T4SS1. Similarly, a protein band was observed in the wild-type with genistein induction (band 6), and a match was found with the T3SS host specificity protein NopP (18%). This protein was not observed in ∆T4SS1 (band 7) at the same position. While protein bands from the wild-type (band 3) and ∆T4SS1 (band 4) were found to be proteins matched with Dct; C4-dicarboxylate ABC transporter (31%), it was not observed in ∆copG1 (band 5). Nevertheless, ∆copG1 (band 5) was associated with the amino acid ABC transporter substrate-binding protein glutamate/aspartate transporter subunit (38%).

Figure 5.

Figure 5

SDA-PAGE analysis of protein secretion into the external medium of Bradyrhizobium sp. SUTN9-2 (WT), ΔT4SS1, and ΔcopG1 with 20 μM genistein (+Gen) and without 20 μM genistein (−Gen) induction. Numbers on the left indicate molecular size markers in kilodaltons. The arrowhead indicates bands identified by mass spectrometry (MS) analysis of WT (1, 3, 6), ΔT4SS1 (2, 4, 7), and ΔcopG1 (5). (The original SDS-PAGE image was included in the Supplementary Materials as Figure S9).

qRT-PCR was performed to identify the gene expression of T3SS (nopP and nopX) and C4-dicarboxylate transporter (dct), which was not in the secreted protein from ∆copG1. The results showed that the expression of T3Es (nopP and nopX) and the C4-dicarboxylate transporter (dct) under genistein induction was down-regulated in ∆copG1 (Figure 6). This indicated that these genes required copG1 to mediate the regulation under genistein induction.

Figure 6.

Figure 6

Relative expression of Nodulation outer protein X (nopX) (A), C4-dicarboxylate transporter (dct) (B), and nopP genes (C) in Bradyhizobium sp. SUTN9-2 (WT) and ΔcopG1 under 20 μM genistein induction (+G). The data were normalized in relation to the endogenous control (16S rRNA). Values represent the mean ± SD (n = 3). p values based on the student’s t-test (** p < 0.01, *** p < 0.001).

4. Discussion

At an early nodulation stage of V. radiata cv. SUT4, ΔtraG1 and ΔvirD21 generated a high number of nodules with smaller sizes compared with the wild-type (Figure 1I,M,Q,R). The symbiosome space of ΔtraG1 and ΔvirD21 infecting nodules revealed some dead cells that were not found in the wild-type under confocal microscopy (Figure 1J,N). According to these findings, T4SS is beneficial in the early stages of symbiotic interactions between SUTN9-2 and legumes. Bradyrhizobia have a TraG/Trb operon on the chromosome in the symbiosis island that is similar to that of mesorhizobia based on the traG gene’s phylogenetic and gene organization [24]. Beside the structural protein, various bacteria containing T4SS also identified ATPase/Coupling protein, VirD4/TraG, and relaxase VirD2 [45]. The traG is commonly found in conjugative plasmids that are responsible for horizontal gene transfer between bacteria. The traG gene required to encode the T4SS component served as an ATPase to generate energy during secretion [46]. In addition, TraG also acts as a substrate receptor of T4SS called coupling protein, a substrate receptor that mediates the substrate such as effector proteins, DNA, or a DNA-protein complex through the T4SS channel [16,47,48,49]. In the Pfam prediction, the TraG protein was matched with the Pfam family T4SS-DNA_transfer (PF02534), TrwB_AAD_bound (PF10412), and TraG-D_C (PF12696) (Figure S8A). The C-terminal of this protein can interact with the relaxosome, which is essential for DNA transfer and conjugation in bacteria [46,47,48]. In mesorhizobia, traG plays an important role in the early stage of infection, and its expression was observed during induction with root exudate and early nodules generated by M. mediterraneum Ca36T. Corresponding to mesorhizobia, traG1 of SUTN9-2 may play a crucial role in the initiation of symbiotic interaction with legumes [49]. In Agrobacterium, the VirD2 protein is a part of the relaxase family that plays a crucial role in conjugating and mobilizing plasmids that are required for translocation and integration of T-strands into recipient plant cells [50,51]. The conjugative transfer of ICEMlSymR7A in M. loti R7A requires VirD2 relaxase to initiate rolling-circle replication [52]. VirD21 of SUTN9-2 possesses a domain of unknown function (DUF), DUF3363, which is an uncharacterized protein (Figure S8B). Although ΔvirD21 had no effect on the number of nodules in V. radiata cv. SUT4, nitrogen fixation activity was reduced (Figure 1S,T).

Nodules generated by ΔvirD21 showed many uninfected cells (Figure 1N,P). This finding showed that the communication between SUTN9-2 and the legume at the beginning of nodule organogenesis plays an important role in enhancing infection efficiency and nitrogenase activity after infection. These results strongly indicate that the traG1 and virD21 genes may be necessary for symbiotic interaction during the early infection stage. Unlike ΔtraG1 and ΔvirD21, ΔcopG1 has an impact on the symbiotic interaction between SUTN9-2 and legumes because this mutant was unable to generate nodules with the tested plant (Figure 1E,G). For that reason, copG1 was located downstream of traG1 and virD21 within the same cluster, it is assumed that copG1 shares a common promoter with traG1 and virD21. This observation was supported by a previous study in which T4SS complementation successfully restored nodule formation [24]. Several bacteria, such as Pseudomonas aeruginosa [53], Streptococcus agalactiae [54], Vibrio cholerae [55], Bradyrhizobium sp., and Mesorhizobium sp., contain the copG gene in their genomes [24]. This gene encodes CopG protein, a small transcriptional repressor containing a helix-turn-helix motif domain, which is similar to that of regulatory repressors such as Mnt, Arc, and MetJ in Salmonella typhimurium bacteriophage P22 and Escherichia coli [45,56,57]. The CopG protein was first discovered in the streptococcal plasmid pMV158 as a transcriptional repressor that interacts with RepB to control the copy number of the plasmid [44,46,58]. In addition, copper resistance was also demonstrated to be influenced by CopG in P. aeruginosa and V. cholerae [53,55].

In SUTN9-2, the CopG1 protein was classified as an uncharacterized conserved protein, whereas CopG2 was annotated as the Pfam;RHH_1 domain (PF01402), which may serve as a transcriptional regulator within the CopG family (Figure S4) [59]. The removal of both copG genes from SUTN9-2 resulted in distinct nodulation efficiency. Even without a nodule generated by ΔcopG1, it can still infect plants because we can monitor both live and dead cells within plant tissues. Surprisingly, live cells were found mostly in the vascular bundle tissue, which is similar to the way of endophytic bacteria behave. These findings imply that copG1 may be crucial for SUTN9-2 in protecting the survival of bacterial cells in the host plant. Bacteria can evolve and adapt to their environment through horizontal gene transfer, usually facilitated by conjugation. Conjugation is a significant biological process because it is the primary way to spread antibiotic resistance genes [60]. Integrative and conjugative elements (ICEs) are another essential mechanism that contributes to conjugation. ICEs are recognized as elements encoded for excision and transferred by conjugation and integration, regardless of the specific mechanisms involved [61]. The T4SS found in SUTN9-2 is classified as a tra/trb operon and is recognized for its crucial role in facilitating conjugal transfer. Although SUTN9-2 lacks a conjugation plasmid, ICE is still present on the chromosome. The genes encoding the T4SS1 cluster are presented in this ICE, which is an alternative mechanism of genetic exchange in this bacterial strain [24]. To study the impaired nodulation phenotype of ΔcopG1 in V. radiata cv. SUT4, we analyzed the expression of nod genes with and without genistein induction. Common nod genes in SUTN9-2, including nodA and nodC genes, were not expressed even with a lack of copG1 under the flavonoid induction condition, but this did not affect nodB expression. In addition, copG1 acts as a stimulator for nodD1 and nodD2, which are the primary transcription factors responsible for NF production. In addition to nod genes, the expression level of ttsI was not determined in ΔcopG1. The TtsI protein is a transcriptional regulator (previously called y4xI) that is activated by flavonoids and NodD1 that bind to conserved sequences called tts-boxes [44,56,62]. These proteins are predominantly expressed during the initial infection stages and within mature nodules, and they play a crucial role in enhancing nodulation [57]. During symbiotic interaction, SUTN9-2 required copG1 to mediate the expression of nod genes and ttsI under flavonoid induction. These results indicate that CopG1 may positively mediate the expression of nod genes via NodD activation before stimulating NF production, nodule organogenesis, and T3SS. Furthermore, copG1 plays a role as a repressor in T4SS gene expression, suppressing trbE and traG expression under flavonoid stimulation (Figure 4C,D). In contrast, these genes were not affected by flavonoids in the absence of the copG1 gene.

The protein expression profiles of SUTN9-2, ∆T4SS1, and ∆copG1 with genistein treatment were analyzed by SDS-PAGE. The results revealed distinct protein band patterns under different conditions (Figure 5). ∆copG1 exhibited a deficiency in producing nodules in various plant species and a striking increase in protein expression compared with the wild-type. According to the analysis of the copG1 domain protein (Figure S4), CopG1 was predicted to be a transcriptional regulator that might play a role in the regulation of gene expression. The ΔcopG1 lane appears to have much more protein intensity overall because the proportion of protein in this lane might be less than in other lanes. Therefore, 10 µg might show a higher band intensity. A comparative proteomic analysis of the whole secretome should be conducted further to identify additional target proteins involved in this interaction. It was found that several proteins were secreted, but the C4-dicarboxylate transport system (dct) protein was not identified in ∆copG1, and this result corresponded to the downregulation of the dct gene quantified by qRT-PCR (Figure 6). The dct gene plays a crucial role in symbiosis numerous rhizobia [58]. For example, the dct mutant of S. meliloti and R. trifolii can generate ineffective nodules with the host legume [58,63]. In addition to the dct gene, other genes are expressed in the same pattern, including nopX and nopP, which are also essential for symbiosis (Figure 6). NopX is a component of T3SS as a translocation pore (translocon) apparatus that is important for host-specific interaction between the rhizobium and host plant. The NGRΔnopX has a significant effect on nodule number because this mutant forms fewer nodules in all plant species tested, including Flemingia congesta, Tephrosia vogelii, Pachyrhizus tuberosus, and Lablab purpureus [64]. NopP is a T3SS-effector protein that is phosphorylated by plant kinases [65]. Lack of NopP in Rhizobium sp. NGR234 reduces the capacity of nodule organogenesis in tropical legumes. This indicates a positive effect of NopP on symbiosis [64]. NopP of B. diazoefficiens USDA122 is necessary and causes Rj2-dependent incompatibility [66]. The T3SS of SUTN9-2 has no impact on its symbiotic relationship with V. radiata [18]. However, based on the protein secretion results of T3Es (NopP and NopX) and nodD gene expression, it is evident that copG1 regulates the function of nodD and T3SS. Previous reports indicated that nodD controls the function of the nod cluster by binding to the nod box region. Similarly, nodD can regulate T3SS function by binding to ttsI [62]. Therefore, the results of this experiment confirm that CopG1 controls the function of nodD, influencing the expression of nod cluster genes and T3SS. Perhaps CopG1 is a crucial factor in the early stages of legume and SUTN9-2 communication. It is plausible that the regulatory system governing the expression of nod genes does not solely depend on the interaction between flavonoids and NodD. Another factor, CopG1, also collaborates with flavonoids and NodD to regulate the expression of nod genes and T3SS. Carbon and nitrogen metabolism are the primary mechanisms necessary for the exchange of nutrients between plant and bacterial partners. The proteins secreted from ∆copG1 matched the periplasmic binding proteins of the glutamate/aspartate ABC transporter. Glutamate is a significant contributor to the total metabolite content, which plays an essential role in nitrogen metabolism, amino acid metabolism, transamination, and carbon sources [67,68]. During symbiosis, the main carbon source utilized by rhizobia is C4-dicarboxylic acid [69,70]. In the mimicked symbiotic conditions, ∆copG1 lost the ability to establish a symbiotic interaction. Thereafter, increasing the glutamate/aspartate ABC transporter may promote carbon and nitrogen uptake to support bacterial cell survival, but it is not necessary for symbiotic interaction. This again suggests that copG1 may act as a regulator of nodD and T4SS gene expression under symbiotic conditions. The deeper insights into the genetic mechanisms of T4SS genes involved in rhizobia and legume symbiosis should be further investigated through the transcriptomics analysis to obtain the comprehensive gene expression profiles as well as may explore gene expression on the host side for more understanding.

5. Conclusions

This is the first report about genes related T4SS in Bradyrhizobium sp. SUTN9-2 that involved in the symbiosis interaction with legumes. This finding reveals that T4SS1 containing copG1, traG1, and virD21 has beneficial effects on symbiotic interactions with diverse legumes. The early stage of infection and nodulation is influenced by traG1 and virD21. While, copG1 is necessary for nodulation, the essential role of copG2 is nitrogen fixation efficiency. Additionally, copG1 served as a suppressor of T4SS genes under non-induction conditions and was required to stimulate the expression of T4SS genes through flavonoid induction. copG1 also acted as a suppressor of secreted protein under flavonoid induction conditions. In addition, a lack of copG1 led to suppressed expression of nopX, nopP, and dct, which are important for infection and nodulation during symbiosis. Thus, copG1 is most likely responsible for regulation via functions in T3SS, nodD regulation, and the carbon and nitrogen exchange systems, which are significant for SUTN9-2 during symbiosis. In this study, copG1 was discovered as a new transcriptional factor in the T4SS cluster and is important for host specificity and competition during symbiosis with their host. Knowledge from this research serves as a model for studying the interaction between the host plant and the secretion systems of Bradyrhizobium that further facilitates scientists to identify effectors required for better colonization, enhancing nodulation and nitrogen fixation, which lead to an increase in legume crop yields under sustainable agriculture.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology13060415/s1. Figure S1. Genetic organization of type IV secretion system cluster 1 (T4SS1) and cluster 2 (T4SS2) on the chromosome of Bradyrhizobium sp. SUTN9-2; Figure S2. CLUSTALW (2.1) Multiple sequence alignments of copG1 and copG2 gene sequences in Bradyrhizobium sp. SUTN9-2; Figure S3. CLUSTALW (2.1) Multiple sequence alignments of CopG1 and CopG2 amino acid sequences in Bradyrhizobium sp. SUTN9-2; Figure S4. Protein domain architecture analysis of CopG proteins in bradyrhizobia; Figure S5. Amino acid sequences of protein selected band 1; Figure S6. Amino acid sequences of protein selected band 3; Figure S7. Amino acid sequences of protein selected band 6; Figure S8. Protein domain architecture analysis of TraG1 (A) and VirD21 (B) protein sequences in Bradyrhizobium sp. SUTN9-2; Figure S9. Original SDS-PAGE of proteins secretion into the external medium of Bradyrhizobium sp. SUTN9-2 (WT) and mutant strains with 20 μM genistein (+Gen) and without 20 μM genistein (−Gen) induction. Table S1. Nodulation pouch test inoculated with Bradyrhizobium sp. SUTN9-2 and ∆copG1 in various legumes; Table S2. Bacterial strains and plasmids used in this study; Table S3. Identification and characterization of selected protein bands from Bradyrhizobium sp. SUTN9-2 with genistein induction.

Author Contributions

Conceptualization, P.W. and N.T.; Methodology, P.W., P.P., P.S., T.P., A.S., N.P. and P.B.; Validation, P.P., P.S., P.B., P.T. and S.S.; Formal analysis, P.W.; Investigation, P.W.; Resources, K.T.; Data curation, P.W.; Writing—original draft, P.W.; Writing—review & editing, P.W.; Visualization, P.P., P.S., P.B., J.W., K.T., N.B., S.S. and N.T.; Supervision, P.T. and N.T.; Project administration, P.T. and N.T.; Funding acquisition, P.T. and N.T. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the required data are available in the manuscript and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This work was supported by (i) the Royal Golden Jubilee Ph.D. Programme (RGJ) scholarship under the Thailand Research Fund (TRF), (ii) Suranaree University of Technology (SUT), the National Science, Research, and Innovation Fund (NSRF), (iii) the NSRF via the Program Management Unit for Human Resources & Institutional Development, Research, and Innovation (grant number B16F640113), and (iv) the National Research Council of Thailand (NRTC) and Suranaree University of Technology (grant number N42A650322). The APC was funded by the Office of the Permanent Secretary of the Ministry of Higher Education, Science, Research, and Innovation.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Goyal R.K., Habtewold J.Z. Evaluation of legume–rhizobial symbiotic interactions beyond nitrogen fixation that help the host survival and diversification in hostile environments. Microorganisms. 2023;11:1454. doi: 10.3390/microorganisms11061454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Rascio N., La Rocca N. Reference Module in Earth Systems and Environmental Sciences. Elsevier; Amsterdam, The Netherlands: 2013. Biological Nitrogen Fixation; p. B9780124095489006850. [Google Scholar]
  • 3.Granada Agudelo M., Ruiz B., Capela D., Remigi P. The role of microbial interactions on rhizobial fitness. Front. Plant Sci. 2023;14:1277262. doi: 10.3389/fpls.2023.1277262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Dénarié J., Debellé F., Promé J.-C. Rhizobium lipo-chitooligosaccharide nodulation factors: Signaling molecules mediating recognition and morphogenesis. Annu. Rev. Biochem. 1996;65:503–535. doi: 10.1146/annurev.bi.65.070196.002443. [DOI] [PubMed] [Google Scholar]
  • 5.Green E.R., Mecsas J. Bacterial secretion systems: An overview. Microbiol. Spectr. 2016;4:213–239. doi: 10.1128/microbiolspec.VMBF-0012-2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gassmann W., Bhattacharjee S. Effector-triggered immunity signaling: From gene-for-gene pathways to protein-protein interaction networks. Mol. Plant-Microbe Interact. 2012;25:862–868. doi: 10.1094/MPMI-01-12-0024-IA. [DOI] [PubMed] [Google Scholar]
  • 7.Jones J.D.G., Dangl J.L. The plant immune system. Nature. 2006;444:323–329. doi: 10.1038/nature05286. [DOI] [PubMed] [Google Scholar]
  • 8.Fauvart M., Michiels J. Rhizobial secreted proteins as determinants of host specificity in the Rhizobium–legume symbiosis. FEMS Microbiol. Lett. 2008;285:1–9. doi: 10.1111/j.1574-6968.2008.01254.x. [DOI] [PubMed] [Google Scholar]
  • 9.Nelson M.S., Sadowsky M.J. Secretion systems and signal exchange between nitrogen-fixing rhizobia and legumes. Front. Plant Sci. 2015;6:491. doi: 10.3389/fpls.2015.00491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zboralski A., Biessy A., Filion M. Bridging the gap: Type III secretion systems in plant-beneficial bacteria. Microorganisms. 2022;10:187. doi: 10.3390/microorganisms10010187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Luo L., Lu D. Immunosuppression during Rhizobium -legume symbiosis. Plant Signal. Behav. 2014;9:e28197. doi: 10.4161/psb.28197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jiménez-Guerrero I., Medina C., Vinardell J.M., Ollero F.J., López-Baena F.J. The rhizobial type 3 secretion system: The Dr. Jekyll and Mr. Hyde in the Rhizobium–legume symbiosis. Int. J. Mol. Sci. 2022;23:11089. doi: 10.3390/ijms231911089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Songwattana P., Chaintreuil C., Wongdee J., Teulet A., Mbaye M., Piromyou P., Gully D., Fardoux J., Zoumman A.M.A., Camuel A., et al. Identification of type III effectors modulating the symbiotic properties of Bradyrhizobium vignae strain ORS3257 with various Vigna species. Sci. Rep. 2021;11:4874. doi: 10.1038/s41598-021-84205-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Salinero-Lanzarote A., Pacheco-Moreno A., Domingo-Serrano L., Durán D., Ormeño-Orrillo E., Martínez-Romero E., Albareda M., Palacios J.M., Rey L. The type VI secretion system of Rhizobium etli Mim1 has a positive effect in symbiosis. FEMS Microbiol. Ecol. 2019;95:fiz054. doi: 10.1093/femsec/fiz054. [DOI] [PubMed] [Google Scholar]
  • 15.Tighilt L., Boulila F., De Sousa B.F.S., Giraud E., Ruiz-Argüeso T., Palacios J.M., Imperial J., Rey L. The Bradyrhizobium sp. LmicA16 type VI secretion system is required for efficient nodulation of Lupinus spp. Microb. Ecol. 2022;84:844–855. doi: 10.1007/s00248-021-01892-8. [DOI] [PubMed] [Google Scholar]
  • 16.Fronzes R., Christie P.J., Waksman G. The structural biology of type IV secretion systems. Nat. Rev. Microbiol. 2009;7:703–714. doi: 10.1038/nrmicro2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Smith E.F., Townsend C.O. A plant-tumor of bacterial origin. Science. 1907;25:671–673. doi: 10.1126/science.25.643.671. [DOI] [PubMed] [Google Scholar]
  • 18.Piromyou P., Songwattana P., Teamtisong K., Tittabutr P., Boonkerd N., Tantasawat P.A., Giraud E., Göttfert M., Teaumroong N. Mutualistic co-evolution of T3SSs during the establishment of symbiotic relationships between Vigna radiata and bradyrhizobia. MicrobiologyOpen. 2019;8:e00781. doi: 10.1002/mbo3.781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kaneko T., Maita H., Hirakawa H., Uchiike N., Minamisawa K., Watanabe A., Sato S. Complete genome sequence of the soybean symbiont Bradyrhizobium japonicum strain USDA6T. Genes. 2011;2:763–787. doi: 10.3390/genes2040763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cytryn E.J., Jitacksorn S., Giraud E., Sadowsky M.J. Insights learned from pBTAi1, a 229-Kb accessory plasmid from Bradyrhizobium sp. strain BTAi1 and prevalence of accessory plasmids in other Bradyrhizobium sp. strains. ISME J. 2008;2:158–170. doi: 10.1038/ismej.2007.105. [DOI] [PubMed] [Google Scholar]
  • 21.Okazaki S., Noisangiam R., Okubo T., Kaneko T., Oshima K., Hattori M., Teamtisong K., Songwattana P., Tittabutr P., Boonkerd N., et al. Genome analysis of a Novel Bradyrhizobium sp. DOA9 carrying a symbiotic plasmid. PLoS ONE. 2015;10:e0117392. doi: 10.1371/journal.pone.0117392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Piromyou P., Songwattana P., Greetatorn T., Okubo T., Kakizaki K.C., Prakamhang J., Tittabutr P., Boonkerd N., Teaumroong N., Minamisawa K. The type III secretion system (T3SS) is a determinant for rice-endophyte colonization by non-photosynthetic Bradyrhizobium. Microbes Environ. 2015;30:291–300. doi: 10.1264/jsme2.ME15080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Greetatorn T., Hashimoto S., Sarapat S., Tittabutr P., Boonkerd N., Uchiumi T., Teaumroong N. Empowering rice seedling growth by endophytic Bradyrhizobium sp. SUTN 9-2. Lett. Appl. Microbiol. 2019;68:258–266. doi: 10.1111/lam.13114. [DOI] [PubMed] [Google Scholar]
  • 24.Wangthaisong P., Piromyou P., Songwattana P., Wongdee J., Teamtaisong K., Tittabutr P., Boonkerd N., Teaumroong N. The type IV secretion system (T4SS) mediates symbiosis between Bradyrhizobium sp. SUTN9-2 and legumes. Appl. Environ. Microbiol. 2023;89:e00040-23. doi: 10.1128/aem.00040-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhang Y.F., Wang E.T., Tian C.F., Wang F.Q., Han L.L., Chen W.F., Chen W.X. Bradyrhizobium elkanii, Bradyrhizobium yuanmingense and Bradyrhizobium japonicum are the main rhizobia associated with Vigna unguiculata and Vigna radiata in the subtropical region of China. FEMS Microbiol. Lett. 2008;285:146–154. doi: 10.1111/j.1574-6968.2008.01169.x. [DOI] [PubMed] [Google Scholar]
  • 26.Albareda M., Rodríguez-Navarro D.N., Temprano F.J. Soybean inoculation: Dose, N fertilizer supplementation and rhizobia persistence in soil. Field Crops Res. 2009;113:352–356. doi: 10.1016/j.fcr.2009.05.013. [DOI] [Google Scholar]
  • 27.Sadowsky M.J., Tully R.E., Cregan P.B., Keyser H.H. Genetic diversity in Bradyrhizobium Japonicum serogroup 123 and its relation to genotype-specific nodulation of soybean. Appl. Environ. Microbiol. 1987;53:2624–2630. doi: 10.1128/aem.53.11.2624-2630.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tsai J.-W., Alley M.R.K. Proteolysis of the McpA chemoreceptor does not require the Caulobacter major chemotaxis operon. J. Bacteriol. 2000;182:504–507. doi: 10.1128/JB.182.2.504-507.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Blondelet-Rouault M.-H., Weiser J., Lebrihi A., Branny P., Pernodet J.-L. Antibiotic resistance gene cassettes derived from the π interposon for use in E. coli and Streptomyces. Gene. 1997;190:315–317. doi: 10.1016/S0378-1119(97)00014-0. [DOI] [PubMed] [Google Scholar]
  • 30.Ditta G., Stanfield S., Corbin D., Helinski D.R. Broad host range DNA cloning system for Gram-negative bacteria: Construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA. 1980;77:7347–7351. doi: 10.1073/pnas.77.12.7347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Muyzer G., De Waal E.C., Uitterlinden A.G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993;59:695–700. doi: 10.1128/aem.59.3.695-700.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Teamtisong K., Songwattana P., Noisangiam R., Piromyou P., Boonkerd N., Tittabutr P., Minamisawa K., Nantagij A., Okazaki S., Abe M., et al. Divergent nod-containing Bradyrhizobium sp. DOA9 with a megaplasmid and its host range. Microbes Environ. 2014;29:370–376. doi: 10.1264/jsme2.ME14065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ehrhardt D., Atkinson E. Long depolarization of Alfalfa root hair membrane potential by Rhizobium meliloti Nod factors. Science. 1992;256:998–1000. doi: 10.1126/science.10744524. [DOI] [PubMed] [Google Scholar]
  • 34.Renier S., Hébraud M., Desvaux M. Molecular biology of surface colonization by Listeria monocytogenes: An additional facet of an opportunistic Gram-positive Foodborne Pathogen. Environ. Microbiol. 2011;13:835–850. doi: 10.1111/j.1462-2920.2010.02378.x. [DOI] [PubMed] [Google Scholar]
  • 35.Somasegaran P., Hoben H.J. Handbook for Rhizobia. Springer; New York, NY, USA: 1994. [Google Scholar]
  • 36.Phimphong T., Sibounnavong P., Phommalath S., Wongdee J., Songwattana P., Piromyou P., Greetatorn T., Boonkerd N., Tittabutr P., Teaumroong N. Selection and evaluation of Bradyrhizobium inoculum for Peanut, Arachis hypogea production in the Lao People’s Democratic Republic. J. Appl. Nat. Sci. 2023;15:137–154. doi: 10.31018/jans.v15i1.4270. [DOI] [Google Scholar]
  • 37.Bradford M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 38.Laemmli U.K. Cleavage of structural proteins during the assembly of the head of Bacteriophage T4. Nature. 1970;227:680–685. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]
  • 39.Haag A.F., Baloban M., Sani M., Kerscher B., Pierre O., Farkas A., Longhi R., Boncompagni E., Hérouart D., Dall’Angelo S., et al. Protection of Sinorhizobium against host cysteine-rich antimicrobial peptides is critical for symbiosis. PLoS Biol. 2011;9:e1001169. doi: 10.1371/journal.pbio.1001169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Vallenet D., Calteau A., Dubois M., Amours P., Bazin A., Beuvin M., Burlot L., Bussell X., Fouteau S., Gautreau G., et al. MicroScope: An integrated platform for the annotation and exploration of microbial gene functions through genomic, pangenomic and metabolic comparative analysis. Nucleic Acids Res. 2019;48:gkz926. doi: 10.1093/nar/gkz926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Letunic I., Khedkar S., Bork P. SMART: Recent updates, New developments and status in 2020. Nucleic Acids Res. 2021;49:D458–D460. doi: 10.1093/nar/gkaa937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Paysan-Lafosse T., Blum M., Chuguransky S., Grego T., Pinto B.L., Salazar G.A., Bileschi M.L., Bork P., Bridge A., Colwell L., et al. InterPro in 2022. Nucleic Acids Res. 2023;51:D418–D427. doi: 10.1093/nar/gkac993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Heidstra R., Bisseling T. Nod factor-induced host responses and mechanisms of Nod factor perception. New Phytol. 1996;133:25–43. doi: 10.1111/j.1469-8137.1996.tb04339.x. [DOI] [Google Scholar]
  • 44.Marie C., Deakin W.J., Ojanen-Reuhs T., Diallo E., Reuhs B., Broughton W.J., Perret X. TtsI, a key regulator of Rhizobium species NGR234 is required for type III-dependent protein secretion and synthesis of rhamnose-rich polysaccharides. Mol. Plant-Microbe Interact. 2004;17:958–966. doi: 10.1094/MPMI.2004.17.9.958. [DOI] [PubMed] [Google Scholar]
  • 45.Tegtmeyer N., Linz B., Yamaoka Y., Backert S. Unique TLR9 activation by Helicobacter pylori depends on the cag T4SS, but not on VirD2 relaxases or VirD4 coupling proteins. Curr. Microbiol. 2022;79:121. doi: 10.1007/s00284-022-02813-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Schröder G., Krause S., Zechner E.L., Traxler B., Yeo H.-J., Lurz R., Waksman G., Lanka E. TraG-like proteins of DNA transfer systems and of the Helicobacter pylori ype IV secretion system: Inner membrane gate for exported substrates? J. Bacteriol. 2002;184:2767–2779. doi: 10.1128/JB.184.10.2767-2779.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gunton J.E., Gilmour M.W., Baptista K.P., Lawley T.D., Taylor D.E. Interaction between the co-inherited TraG coupling protein and the TraJ membrane-associated protein of the H-plasmid conjugative DNA transfer system resembles chromosomal DNA translocases. Microbiology. 2007;153:428–441. doi: 10.1099/mic.0.2006/001297-0. [DOI] [PubMed] [Google Scholar]
  • 48.Lu J., Wong J.J.W., Edwards R.A., Manchak J., Frost L.S., Glover J.N.M. Structural basis of specific TraD-TraM recognition during F plasmid-mediated bacterial conjugation. Mol. Microbiol. 2008;70:89–99. doi: 10.1111/j.1365-2958.2008.06391.x. [DOI] [PubMed] [Google Scholar]
  • 49.Paço A., Da-Silva J.R., Eliziário F., Brígido C., Oliveira S., Alexandre A. TraG Gene Is Conserved across Mesorhizobium Spp. Able to Nodulate the Same Host Plant and Expressed in Response to Root Exudates. BioMed Res. Int. 2019;2019:3715271. doi: 10.1155/2019/3715271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Byrd D.R., Matson S.W. Nicking by transesterification: The reaction catalysed by a relaxase. Mol. Microbiol. 1997;25:1011–1022. doi: 10.1046/j.1365-2958.1997.5241885.x. [DOI] [PubMed] [Google Scholar]
  • 51.Van Kregten M., Lindhout B.I., Hooykaas P.J.J., Van Der Zaal B.J. Agrobacterium-mediated T-DNA transfer and integration by minimal VirD2 consisting of the relaxase domain and a type IV secretion system translocation signal. Mol. Plant-Microbe Interact. 2009;22:1356–1365. doi: 10.1094/MPMI-22-11-1356. [DOI] [PubMed] [Google Scholar]
  • 52.Ramsay J.P., Sullivan J.T., Stuart G.S., Lamont I.L., Ronson C.W. Excision and Transfer of the Mesorhizobium loti R7A symbiosis island requires an integrase IntS, a novel recombination directionality factor RdfS, and a putative relaxase RlxS. Mol. Microbiol. 2006;62:723–734. doi: 10.1111/j.1365-2958.2006.05396.x. [DOI] [PubMed] [Google Scholar]
  • 53.Hausrath A.C., Ramirez N.A., Ly A.T., McEvoy M.M. The bacterial copper resistance protein CopG contains a cysteine-bridged tetranuclear copper cluster. J. Biol. Chem. 2020;295:11364–11376. doi: 10.1074/jbc.RA120.013907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Gomis-Ruth F.X. The structure of plasmid-encoded transcriptional repressor CopG unliganded and bound to its operator. EMBO J. 1998;17:7404–7415. doi: 10.1093/emboj/17.24.7404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Marrero K., Sánchez A., González L.J., Ledón T., Rodríguez-Ulloa A., Castellanos-Serra L., Pérez C., Fando R. Periplasmic proteins encoded by VCA0261–0260 and VC2216 genes together with copA and cueR products are required for copper tolerance but not for virulence in Vibrio cholerae. Microbiology. 2012;158:2005–2016. doi: 10.1099/mic.0.059345-0. [DOI] [PubMed] [Google Scholar]
  • 56.Kobayashi H., Graven Y.N., Broughton W.J., Perret X. Flavonoids induce temporal shifts in gene-expression of nod-box controlled loci in Rhizobium sp. NGR234. Mol. Microbiol. 2004;51:335–347. doi: 10.1046/j.1365-2958.2003.03841.x. [DOI] [PubMed] [Google Scholar]
  • 57.Cao Y., Halane M.K., Gassmann W., Stacey G. The role of plant innate immunity in the legume-Rhizobium symbiosis. Annu. Rev. Plant Biol. 2017;68:535–561. doi: 10.1146/annurev-arplant-042916-041030. [DOI] [PubMed] [Google Scholar]
  • 58.Yurgel S.N., Kahn M.L. Sinorhizobium meliloti dctA mutants with partial ability to transport dicarboxylic acids. J. Bacteriol. 2005;187:1161–1172. doi: 10.1128/JB.187.3.1161-1172.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Acebo P., García De Lacoba M., Rivas G., Andreu J.M., Espinosa M., Solar G.D. Structural features of the plasmid pMV158-encoded transcriptional repressor CopG, a protein sharing similarities with both helix-turn-helix and β-sheet DNA binding proteins. Proteins Struct. Funct. Genet. 1998;32:248–261. doi: 10.1002/(SICI)1097-0134(19980801)32:2<248::AID-PROT11>3.0.CO;2-D. [DOI] [PubMed] [Google Scholar]
  • 60.Guglielmini J., Quintais L., Garcillán-Barcia M.P., de la Cruz F., Rocha E.P.C. The Repertoire of ICE in prokaryotes underscores the unity, diversity, and ubiquity of conjugation. PLoS Genet. 2011;7:e1002222. doi: 10.1371/journal.pgen.1002222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Bellanger X., Payot S., Leblond-Bourget N., Guédon G. Conjugative and mobilizable genomic islands in bacteria: Evolution and diversity. FEMS Microbiol. Rev. 2014;38:720–760. doi: 10.1111/1574-6976.12058. [DOI] [PubMed] [Google Scholar]
  • 62.Krause A., Doerfel A., Göttfert M. Mutational and transcriptional analysis of the type III secretion system of Bradyrhizobium Japonicum. Mol. Plant-Microbe Interact. 2002;15:1228–1235. doi: 10.1094/MPMI.2002.15.12.1228. [DOI] [PubMed] [Google Scholar]
  • 63.Ronson C.W., Lyttleton P., Robertson J.G. C4-dicarboxylate transport mutants of Rhizobium trifolii form ineffective nodules on Trifolium repens. Proc. Natl. Acad. Sci. USA. 1981;78:4284–4288. doi: 10.1073/pnas.78.7.4284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Marie C., Deakin W.J., Viprey V., Kopciñska J., Golinowski W., Krishnan H.B., Perret X., Broughton W.J. Characterization of Nops, nodulation outer proteins, secreted via the type III secretion system of NGR234. Mol. Plant-Microbe Interact. 2003;16:743–751. doi: 10.1094/MPMI.2003.16.9.743. [DOI] [PubMed] [Google Scholar]
  • 65.Bartsev A.V., Boukli N.M., Deakin W.J., Staehelin C., Broughton W.J. Purification and phosphorylation of the effector protein NopL from Rhizobium sp. NGR234. FEBS Lett. 2003;554:271–274. doi: 10.1016/S0014-5793(03)01145-1. [DOI] [PubMed] [Google Scholar]
  • 66.Sugawara M., Takahashi S., Umehara Y., Iwano H., Tsurumaru H., Odake H., Suzuki Y., Kondo H., Konno Y., Yamakawa T., et al. Variation in bradyrhizobial NopP effector determines symbiotic incompatibility with Rj2-soybeans via effector-triggered immunity. Nat. Commun. 2018;9:3139. doi: 10.1038/s41467-018-05663-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Streeter J.G. Effect of nitrate on the organic acid and amino acid composition of legume nodules. Plant Physiol. 1987;85:774–779. doi: 10.1104/pp.85.3.774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Forde B.G., Lea P.J. Glutamate in plants: Metabolism, regulation, and signalling. J. Exp. Bot. 2007;58:2339–2358. doi: 10.1093/jxb/erm121. [DOI] [PubMed] [Google Scholar]
  • 69.Finan T.M., Wood J.M., Jordan D.C. Symbiotic properties of C4-dicarboxylic acid transport mutants of Rhizobium leguminosarum. J. Bacteriol. 1983;154:1403–1413. doi: 10.1128/jb.154.3.1403-1413.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Jording D., Sharma P.K., Schmidt R., Engelke T., Uhde C., Pühler A. Regulatory aspects of the C4-dicarboxylate transport in Rhizobium meliloti: Transcriptional activation and dependence on effectave symbiosis. J. Plant Physiol. 1993;141:18–27. doi: 10.1016/S0176-1617(11)80846-1. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

All the required data are available in the manuscript and Supplementary Materials.


Articles from Biology are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES