Abstract
The P/C mRNA of Sendai virus (SeV) encodes a nested set of accessory proteins, C′, C, Y1, and Y2, referred to collectively as C proteins, using the +1 frame relative to the open reading frame of phospho (P) protein and initiation codons at different positions. The C proteins appear to be basically nonstructural proteins as they are found abundantly in infected cells but greatly underrepresented in the virions. We previously created a 4C(−) SeV, which expresses none of the four C proteins, and concluded that the C proteins are categorically nonessential gene products but greatly contribute to viral full replication and infectivity (A. Kurotani et al., Genes Cells 3:111–124, 1998). Here, we further characterized the 4C(−) virus multiplication in cultured cells. The viral protein and mRNA synthesis was enhanced with the mutant virus relative to the parental wild-type (WT) SeV. However, the viral yields were greatly reduced. In addition, the 4C(−) virions appeared to be highly anomalous in size, shape, and sedimentation profile in a sucrose gradient and exhibited the ratios of infectivity to hemagglutination units significantly lower than those of the WT. In the WT infected cells, C proteins appeared to colocalize almost perfectly with the matrix (M) proteins, pretty well with an external envelope glycoprotein (hemagglutinin-neuraminidase [HN]), and very poorly with the internal P protein. In the absence of C proteins, there was a significant delay of the incorporation of M protein and both of the envelope proteins, HN and fusion (F) proteins, into progeny virions. These results strongly suggest that the accessory and basically nonstructural C proteins are critically required in the SeV assembly process. This role of C proteins was further found to be independent of their recently discovered function to counteract the antiviral action of interferon-α/β. SeV C proteins thus appear to be quite versatile.
Sendai virus (SeV) is an enveloped virus with a linear, nonsegmented, negative-sense RNA genome of 15,384 nucleotides. It belongs to the genus Respirovirus of the family Paramyxoviridae. The genome encodes, in a 3′-to-5′ order, the nucleocapsid (N) protein, phospho (P) protein, matrix (M) protein, fusion (F) protein, hemagglutinin-neuraminidase (HN), and large (L) protein. The genome RNA is tightly encapsidated with the N protein subunits and is further complexed to the polymerase comprising the L and P protein subunits (14). This ribonucleoprotein (RNP) complex represents the internal core structure of the virion. The viral envelope contains two glycoproteins, HN and F. The former mediates viral attachment to the surface of susceptible cells, and the latter is required for the fusion of the envelope with the cellular membrane to introduce the genomic material into the cytoplasm. The envelope lipid bilayer is derived from the host cell plasma membrane during the final step of assembly by budding. There is a layer of M proteins between the envelope and RNP (30). The M protein has been thought to play a critical role in assembly (29, 34, 45, 46).
There is only a single promoter at the 3′ end for the polymerase. By recognizing the stop (termination/polyadenylation) and restart signals present at each gene boundary, the polymerase gives rise to each mRNA (reviewed in reference 23). The gene expression is usually monocistronic, generating a single mRNA, which directs a single primary translation product. However, the P gene of Paramyxovirinae is a notable exception, because it gives rise to multiple protein species by means of overlapping frames and by a process known as RNA editing, or pseudotemplated insertion of nucleotide(s) into the transcript at a specific genome locus (reviewed in references 23, 24, and 26).
In SeV RNA editing, the pseudotemplated addition of one G residue produces an mRNA that encodes the protein termed V, while the unedited mRNA that is the exact copy of the P gene encodes P protein. Thus, P and V proteins are N coterminal, while the −1 frame is used to generate the C-terminal half of the V protein. By disrupting the editing locus in a cDNA plasmid generating a full-length copy of SeV antigenome RNA, we succeeded in recovering a virus that was defective in G insertion and V protein production. Although categorized as a nonessential gene product completely dispensable for viral replication in cells in culture, the V protein was essential for maintaining a high viral load in mice, the natural host, and producing fatal pneumonia (17). This luxury function required for pathogenesis has been primarily mapped to the unique C-terminal half that is cysteine rich (18).
An open reading frame (ORF) that overlaps the N-terminal portion of the SeV P ORF in the +1 frame produces a nested set of proteins which are C coterminal, called C′, C, Y1, and Y2, and referred to collectively as the C proteins (5, 6). Translation of C′ is initiated on a non-AUG codon, ACG at the position 81 of P mRNA, whereas the other three start on AUGs at positions 114, 183, and 201, respectively (3, 13). The C-related proteins are expressed from the P gene of all members of the genera Paramyxovirus and Morbillivirus but not Rubulavirus. No C protein exists in the subfamily Pneumovirinae, except for the pneumonia virus of the mouse, whose P gene contains a C-like ORF and expresses two C-like proteins (1). The number of C proteins expressed from these viral P genes varies due to the use of a variable number of in-phase start codons. There are four from SeV, two or three from human parainfluenza virus type 1 (hPIV-1), but only one from hPIV-3 and measles virus (MV) P genes (reviewed in reference 23). The C protein sequences are conserved at least within a genus but are divergent between the genera (reviewed in reference 26). Commonly, C proteins are relatively small (180 to 204 amino acids [aa]) and highly basic. Even in a distantly related rhabdovirus, vesicular stomatitis virus (VSV), a C-like ORF overlapping the P ORF is present, and two C proteins are expressed from this frame (38).
The C protein is regarded as the major species of SeV C-related proteins because it is expressed in infected cells at a molar ratio severalfold higher than those of the other three (C′, Y1, and Y2). As the SeV C protein was originally found abundantly in virus-infected cells but was apparently absent in virions, it was thought to be a nonstructural protein (22). Subsequent observations indicated that it is detectable in small quantities in both virions and nucleocapsids isolated from cells and virions (32, 43). The estimated copy number of C protein in virions was as low as 40 molecules per nucleocapsid (43), indicating that SeV C protein is not a major structural protein component. The C protein was previously found to inhibit viral mRNA synthesis (3, 4), probably by binding the L polymerase protein (15). The C protein was also found to inhibit the amplification of the SeV minigenome in cells in a promoter-specific fashion, because the inhibitory action was exerted on an internally deleted defective interfering (DI) genome but not on a copy-back DI genome (2, 41). Thus, a presumable role of SeV C protein would be to down-regulate both genome replication and mRNA synthesis to the levels optimal for viral replication and/or to increase replication selectivity toward the optimum (reviewed in reference 26).
Previously, we used reverse genetics to create mutant viruses in which C-protein frames are silenced, in order to address the question of how C proteins contribute to the actual viral life cycle in vitro and viral pathogenesis in vivo. Silencing of C′ and C frames, but not Y1 and Y2 expression, suggested that C proteins greatly contribute to tissue culture replication and are indispensable for multiplication and pathogenesis in mice. Despite such strong dependency of both in vitro and in vivo replication on C proteins, it was possible to further silence Y1 and Y2 frames to create a critically attenuated but still viable clone, 4C(−) virus, in which all four C proteins were knocked out, indicating that SeV C proteins are categorically nonessential, accessory gene products (21). SeV was shown to suppress the antiviral action of alpha/beta interferon (IFN-α/β) (9, 44), and this antiviral function was now attributed to the C proteins by using various C knockout mutants (11, 12). In this study, we attempted to further characterize the 4C(−) SeV. Our data suggested that SeV C proteins facilitate the incorporation of intracellular viral proteins into progeny virions. The SeV C proteins thus appeared to play a critical role in virus assembly, although they can be regarded as basically nonstructural proteins. This role in virus assembly was further found to be independent of anti-IFN-α/β action of the C proteins. The SeV C proteins are, therefore, quite versatile.
MATERIALS AND METHODS
Viruses.
The recovery of wild-type (WT) SeV and 4C(−) SeV from the respective cDNA plasmids, pSeV(+) and pSeV(+)/4C(−), was described previously (19, 21). Recovered viruses were amplified in the allantoic cavity of 10-day-old chicken embryos, and their titers were expressed in hemagglutination units (HAU), cell infectious units (CIU), or PFU per milliliter as described previously (19); 1 CIU is almost equivalent to 1 PFU. The stock virus titers were 109 to 1010 CIU/ml for the WT SeV and as low as about 105 CIU/ml for 4C(−) SeV.
Cell cultures and virus infection.
Monkey kidney-derived cell lines CV1 and Vero were grown in minimal essential medium (MEM) supplemented with 10% fetal bovine serum. Monolayer cultures of these cells were infected with 4C(−) SeV or the WT SeV at an input multiplicity of infection (MOI) of 5 CIU/cell unless otherwise mentioned and maintained in serum-free MEM. At various hours postinfection (p.i.), the culture supernatants were assayed for CIU and HAU as previously described (20).
Northern blotting and semiquantitative RT-PCR.
Total RNA was extracted using Trizol (Gibco BRL, Bethesda, Md.) from approximately 106 infected CV1 cells at various hours p.i. The RNAs were ethanol precipitated, dissolved in formamide-formaldehyde solution, and then electrophoresed in a 0.9% agarose-formamide–MOPS (morpholinepropanesulfonic acid) gel and capillary transferred onto Hibond-N filter (Amersham Pharmacia Biotech, Uppsala, Sweden). The filter was hybridized with a viral N gene-specific [PstI571-RuI1760 fragment of pSeV(+)] probe, which had been labeled with [α-32P]dCTP using Multiprime DNA Labeling System (Amersham Pharmacia) (17). The same filter was also hybridized with an [α-32P]dCTP-labeled cellular glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific probe. The semiquantitative reverse transcription (RT) and PCR amplification to detect the genomic and antigenomic RNA fragments separately were performed exactly as described previously (17, 40) with two pairs of primers, pHv1 (5′ 1ACCAAACAAGAGAAAAAACA20 3′) and pHvNPr1 (5′ 358CCATGGCAAACAGCAAGACG339 3′) specific for the leader-N region and pHvL1 (5′ 14907TCTAGAAGACTTGTGCTATC14926 3′) and pHvt (5′ 15384ACCAGACAAGAGTTTAAGAG15365 3′) for the L-trailer region. The same RNA samples used for Northern hybridization were reverse transcribed either with pHvL1 primer for the genomic RNA detection or with pHvNPr1 for the antigenomic RNA detection. The reverse transcripts were then amplified by 10, 15, and 20 cycles with the primer specific for each genomic or antigenomic strand. PCR cycles yielding a linear correlation between the amounts of RNA template and PCR products were taken (17).
Antibodies.
Anti-C and anti-P sera were raised in rabbits with the respective recombinant proteins (17). Polyclonal anti-L serum raised in rabbits was a gift from K. Mizumoto (Kitasato University). Mouse monoclonal antibodies against P, M, and HN were kindly provided by A. Portner (St. Judes Research Institute), and those against HN and H were provided by H. Taira (Iwate University). Anti-SeV rabbit polyclonal serum was described previously (19).
Western blotting.
Infected cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in 15% (for C proteins) or 12.5% (for others) polyacrylamide gels. The proteins in the gels were electrotransferred onto polyvinylidene difluoride membranes (Millipore, Bedford, Mass.) and probed with the anti-SeV and the anti-C polyclonal antibodies as previously described (19).
Pulse-chase experiments and immunoprecipitation.
CV1 and Vero cells grown to subconfluency in six-well culture plates were infected with WT or 4C(−) SeV. Infected cells maintained in serum-free MEM for 20 h were washed three times with phosphate-buffered saline (PBS), then pulse labeled for 1 h with 20 μCi of Tran35S protein labeling mix (ICN Biomedicals, Costa Mesa, Calif.) per ml in cysteine- and methionine-free MEM (Nissui, Tokyo, Japan), and then chased for 0, 1, 2, 3, and 4 h with regular MEM. Collected supernatants at each chase point were centrifuged for 10 min at 500 × g to remove cell debris. The clarified supernatants were then recentrifuged at 13,000 × g for 2 h to pellet down the virions. The pellets were then resuspended in SDS-PAGE sample buffer, boiled, and electrophoresed in SDS–12.5% PAGE under reducing conditions. Dried gels were exposed to an image plate, and radiolabeled proteins were visualized by using a Fujix BAS2000 image analyzer (Fuji Photo Film, Tokyo, Japan). In addition, CV1 cells labeled as described above for 1 h were washed twice with PBS and lysed in 1 ml of radioimmunoprecipitation assay (RIPA) buffer (10 mM HEPES [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 10 μg of aprotinin/ml) on ice, and centrifuged at 9,500 × g for 10 min to remove cell debris. Then, anti-SeV serum was added to the supernatants of cell lysates and incubated on ice overnight. The immune complexes generated were recovered with Protein A-Sepharose (Gibco BRL), washed three times with RIPA buffer, and then analyzed by SDS–12.5% PAGE as described above.
Sucrose gradient centrifugation of virions.
CV1 cells grown to subconfluency in 175-cm2 culture bottles were infected with either WT or 4C(−) SeV at an input MOI of 1 CIU/cell and incubated in serum-free MEM for 16 h, washed three times with PBS, and labeled with 20 μCi of Tran35S protein labeling mix per ml for 24 h. The supernatants were collected and centrifuged for 10 min at 500 × g to remove cell debris. The clarified supernatant was then incubated with 1% ice-cold chicken red blood cells (RBC) and kept for 30 min to allow adsorption of viral particles onto RBC. This was followed by centrifugation at 500 × g for 10 min and quick washing of the pellet three times with ice-cold PBS. The pellets were then resuspended in 500 μl of PBS and incubated at 37°C for 45 min to release the viruses from the RBC. Virus-containing solutions (each 500 μl) were collected after removing the RBC by centrifugation at 500 × g for 10 min and then centrifuged through 4.5 ml of 20 to 60% (vol/wt) sucrose linear gradient at 30,000 rpm for 90 min using a Beckman SW 50 rotor. After fractionation into 20 fractions (250 μl each), 40 μl of each fraction was electrophoresed through SDS–12.5% PAGE gels. Autoradiographies were obtained as described above.
Immunoelectron microscopy of virions.
Volumes of 10 to 20 μl of infected CV1 culture supernatants were adsorbed on a nickel-made mesh (Nissin EM, Tokyo, Japan). A few seconds later, excess fluid was removed with a filter paper and blocked with 5% skim milk in PBS for 10 min. Then, the samples were incubated with anti-SeV serum for 10 min. After several washings with the blocking solution, samples were incubated with anti-rabbit immunoglobulin G (IgG) labeled with 10-nm-diameter gold particles for 30 min and then washed with water several times. The immunogold-labeled virions were stained with 2% phosphotungstate solution (pH 7.0) for 90 s, and the excess solution was removed with filter paper and observed under a Hitachi H-800MU electron microscope.
Immunofluorescent microscopy.
Monolayer cultures of CV1 cells were grown on collagen-coated eight-well slide chambers (Becton Dickinson, Franklin Lakes, N.J.) and infected with WT or 4C(−) SeV at an input MOI of 0.5 CIU/cell and incubated in serum-free MEM for 20 and 40 h. After washing with PBS, cells were fixed with 3.7% formaldehyde in PBS for 15 min at room temperature and then washed five times with PBS. The fixed cells were then treated with 0.2% Triton-X 100 in PBS to permeabilize. SeV antigens were detected by incubating them with a polyclonal anti-P or anti-L rabbit serum, each at a dilution of 1:200 in PBS or anti-HN mouse monoclonal antibody at a dilution of 1:100 in PBS. This was followed by labeling with fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgG (ICN Biomedicals) or Texas Red conjugated anti-mouse IgG (Leinco Technologies, Inc., St. Louis, Mo.). All antibody reactions were performed at 37°C for 45 min. Cells were washed five times with PBS after each incubation. After mounting with an antifade reagent in glycerol buffer (Vector Laboratories, Inc., Burlingame, Calif.), cells were observed under an epifluorescence microscope (Olympus, Tokyo, Japan). For double staining, fixed cells were incubated with rabbit anti-C polyclonal and mouse monoclonal anti-M, anti-P, or anti-HN antibody together and stained by FITC-conjugated anti-rabbit IgG and Texas Red conjugated anti-mouse IgG. After washing and mounting as described above, the cells were observed under an MRC-1024 confocal laser scanning microscope (Bio-Rad, Hercules, Calif.).
Determination of cellular IFN-α/β responses.
CV1 and Vero cells grown in six-well plates (5 × 105 cells/well) were transfected with a plasmid (pISRE-luci) containing a luciferase gene fused with an IFN-stimulated responsive element (ISRE) (provided by K. Ozato, National Institutes of Health) at a concentration of 1 μg/ml for 14 h. After washing with PBS, cells were treated with or without human IFN-α/β (1,000 U/ml) and harvested at different times. Then, luciferase activity from ∼104 cells was measured with a luminometer (Luminos CT-9000D; Diaiatron, Tokyo, Japan).
RESULTS
4C(−) SeV replication in CV1 cells.
Figure 1A shows a detailed comparison of virus replication between WT and 4C(−) SeVs in CV1 cells under single- and multiple-cycle growth conditions with input MOIs of 5 and 0.01 CIU/cell, respectively. In single-cycle growth, 4C(−) SeV exhibited a slower kinetics throughout the experimental period. The virus titer was reduced by 100- to 400-fold in CIU and by 8- to 16-fold in HAU. Thus, the ratio of CIU to HAU also declined by about 10-fold in the case of 4C(−) virus infection (Fig. 1B). Under multiple-cycle growth conditions, attenuation of 4C(−) virus was still more severe, yielding a CIU/ml value more than 3 logs lower than that of the WT throughout (Fig. 1A). In addition, the CIU-to-HAU ratio of 4C(−) virus at 60 h p.i. was as low as about 104, while that of the WT was above 106 (Fig. 1B).
FIG. 1.
(A) Replication of WT and 4C(−) viruses in CV1 cells. (B) CIU-to-HAU ratios of the yields. (C) Immunoelectron micrographs of CV1-grown WT and 4C(−) virions. Bar = 100 nm.
One can assume that the CIU-to-HAU ratio reflects the ratio of infectious particles to noninfectious physical particles in a paramyxovirus population. Thus, the above results suggested that 4C(−) SeV not only replicated very poorly in CV1 cells but also appeared to accumulate in the culture supernatant as largely noninfectious particles. This prompted us to see whether morphology would differ between the WT and 4C(−) viruses. The virus particles were pelleted from the respective supernatants of infected CV1 cultures, immunostained, and observed under an electron microscope as described in Materials and Methods. As expected, the WT preparation displayed a relatively homogenous population of spherical particles with a diameter of around 200 nm (Fig. 1C), which is characteristic of SeV virions. Typical nucleocapsid strands were also clearly seen, and they were enclosed with the envelope typical of SeV. In contrast, 4C(−) particles were highly heterogeneous, consisting mainly of filamentous particles (Fig. 1C). Smaller spherical particles as well as particles of a standard size and shape were also seen (Fig. 1C). It has to be noted that neither typical nucleocapsid strands nor characteristic envelope structures were clearly seen for these filamentous or spherical particles.
As reported previously, it was remarkable that 4C(−) virus was able to produce clear plaques, though a little smaller compared with those of the WT, on the same cell monolayers, suggesting that its cell-to-cell spreading was not greatly impaired (21).
Viral macromolecular synthesis in CV1 cells.
Under the single-cycle growth conditions in CV1 cells, expression of viral genes was compared for the WT and 4C(−) viruses by Western blotting using anti-SeV and anti-C antibodies. The data confirmed that all 4C proteins were knocked out in the 4C(−) virus (Fig. 2A). However, the major structural proteins P, HN, F0, and N of the 4C(−) virus were detected with intensities comparable to those of the WT counterparts early in infection up to 20 h p.i., and later (26 and 38 h p.i.) they were increased. Northern blot patterns of the same infected cells with the N-specific probe (Fig. 2B) and other viral-specific probes (not shown) also demonstrated no appreciable suppression but increased levels of viral transcription from 4C(−) SeV, at least late in infection (26 and 38 h p.i.) (Fig. 2B). These findings support the earlier notion that C proteins inhibit SeV mRNA synthesis (4). SeV genomic RNAs are detected at the 50S position in Northern blotting, but the aggregates of mRNAs sometimes migrate to the same position. Thus, to measure the abundance of genomic RNAs in infected cells, we have routinely used an RT-PCR-based assay with specific primers (17, 40). The results also demonstrated no impairment of genomic RNA synthesis for 4C(−) SeV (Fig. 2C). As the assay system involved the amplification of the far (3′) ends of genome and antigenome RNAs, the results further indicated that processivity for the 4C(−) virus was not impaired either. In addition, the RNA levels again appeared to be even higher for 4C(−) virus than for WT virus, at least late in infection. It may have to be also noted that in WT infection, genomic RNA was more prominent than the anti-genomic RNA, while in the absence of C proteins the situation was reversed (Fig. 2C), suggesting promoter specificity of the effect of C proteins on genome replication.
FIG. 2.
Western blotting (A) and Northern blotting (B) of CV1 cells infected with WT and 4C(−) viruses and RT-PCR-based analysis of genome replication of the infected cells (C).
Incorporation of newly synthesized proteins into mature virions.
In the above sections we have shown that viral gene expression as well as the genome replication in 4C(−)-infected cells are largely comparable to those in WT infection or even augmented, whereas the viral yield was decreased dramatically in the absence of C proteins. These results suggested an impaired maturation or assembly of 4C(−) virion. Alternatively, mature 4C(−) virions might form normally but be poorly released into the supernatant. Indeed, mature paramyxovirus virions are sometimes tightly bound to the cell surface and can only be recovered after the freezing and thawing of the cells (28). In the case of 4C(−) infection as well as WT infection, however, freezing and thawing of cells did not increase the virus yields significantly (data not shown).
Then, the kinetics of viral protein incorporation into mature virions were studied. Infected CV1 cells were labeled with Tran35S protein labeling mix for 1 h at 6, 14, and 20 h p.i. The pulse labeling patterns confirmed a level of 4C(−) viral protein synthesis comparable to that of the WT (Fig. 3A). The cells labeled at 20 h p.i. were further incubated with a chase medium for 0 to 4 h, and the virion fractions in each culture supernatants were subjected to SDS-PAGE. As shown in Fig. 3B, the P and N proteins were already detected after a 1-h chase in both WT and 4C(−) virions. In the WT infection, the HN and F0 glycoproteins, as well as the M protein, were also detected after a 1-h chase and increased in amount with chase time. In sharp contrast, there was a significant delay of incorporation into 4C(−) virions of all three of these proteins. Also remarkably, relative to the amounts of P and N proteins, the HN, F0, and M proteins were significantly less abundant in the 4C(−) virions than in the WT virions (Fig. 3B). These results strongly suggested that the C proteins somehow facilitated the incorporation of the envelope and matrix proteins into virions and thereby could regulate the virus assembly.
FIG. 3.
Synthesis and incorporation into virions of viral proteins. (A) CV1 cells infected with WT and 4C(−) viruses were pulse labeled with Tran35S protein labeling mix for 1 h at various hours p.i. indicated on the top of each gel lane, and the cell lysates were processed for immunoprecipitation with anti-SeV polyclonal antibody and SDS-PAGE. (B) At 20 h p.i., the labeled cells were chased for the periods indicated and the virions isolated from culture supernatants were analyzed by SDS-PAGE. The dots on the left of WT Chase lane 1 indicate the positions of HN, F0, and M proteins. (C) 35S-labeled WT and 4C(−) viruses were isolated from the supernatants of infected CV1 cells by adsorption onto and elution from chicken RBC and centrifuged through a 20 to 60% linear gradient of sucrose. Fractionated materials were analyzed by SDS-PAGE (t, top; b, bottom).
Highly anomalous sedimentation profile of 4C(−) virus.
We then compared the sedimentation profiles of WT and 4C(−) virions. After adsorbing to and elution from RBC, the virion-containing materials were centrifuged through a linear gradient of sucrose as described in Materials and Methods. As shown in Fig. 3C, WT virions largely sedimented into bottom fractions (fraction no. 13 to 19). In contrast, 4C(−) particles were found to distribute throughout from the top to bottom fractions (Fig. 3C). The amounts of viral proteins were even greater in the top-half fractions (fraction no. 1 to 9) than in the bottom-half fractions (fraction no. 10 to 20). These results suggested that 4C(−) viral particles recovered from the culture supernatant contained a fraction of particles of significantly lower density and/or smaller sizes that were not seen in the WT preparation. This might be relevant to highly anomalous particle structures and sizes seen in the electron micrographs (Fig. 1C). We therefore tried but failed to see the morphology of the top and bottom components separately because of extremely low yields of 4C(−) virus in CV1 cells.
Immunofluorescent staining of WT- and 4C(−)-infected cells.
CV1 cells infected with WT or 4C(−) SeV were singly or doubly stained with various antibodies presently available. When stained with anti-P or anti-L antibody, the specific fluorescence was highly granulous in WT infected cells (Fig. 4). These structures were seen predominantly in the perinuclear region and could represent inclusions formed by nucleocapsids in the natural life cycle of SeV (32). In marked contrast, in 4C(−)-infected cells, both viral proteins were found to distribute diffusely throughout the cytoplasm (Fig. 4). When stained with anti-HN antibody, the specific antigens distributed rather diffusely in the cytoplasm in the WT infection and, in contrast, clearly tended to aggregate in the 4C(−) infection (Fig. 4). Thus, SeV C proteins strongly affected the intracellular distribution patterns of the other viral proteins, and interestingly, its effect upon the viral internal proteins (P and L) and upon the external protein (HN) was inverse.
FIG. 4.
Intracellular distribution of SeV proteins. CV1 cells infected with WT and 4C(−) viruses were fixed, permeabilized, and stained with anti-P, anti-L, and anti-HN antibodies separately at 20 h p.i. (for P and HN) or 40 h p.i. (for L).
To visualize the interaction of C proteins with the external HN protein, internal P protein, and the M protein, double staining and confocal laser scanning were done for WT-infected cells. As shown in Fig. 5, the P proteins appeared to be very poorly colocalized with the C proteins. In contrast, the M and C proteins were almost perfectly colocalized with each other at the perinuclear region as well as in the entire cytoplasm. Though not as good as this, colocalization was also remarkable between the HN and C proteins.
FIG. 5.
Double antibody staining of WT-infected cells with anti-C antibody (green) and anti-P, anti-M, or anti-HN antibody (red). Cells were fixed at 20 h p.i. Merged images in each combination are also shown.
C-mediated effect on assembly is independent of IFN action.
Recently it was reported that C proteins of SeV were able to counteract the antiviral action of IFN-α/β (11, 12). Thus, in the presence of C proteins, SeV replication is refractory to exogenously added IFN-α/β, and in their absence, viral replication is strongly inhibited not only by the exogenously added IFN-α/β but also by autocrine and paracrine IFN-α/β induced by the virus itself [4C(−) virus] (12). IFN-α/β-mediated signaling is known to involve the phosphorylation of Stat 1 molecules. This phosphorylation was blocked in the presence of C proteins (unpublished data). On the other hand, IFN-α/β is known to inhibit the viral assembly or maturation at least in some virus-cell systems (33, 35, 39). Thus, the question was raised whether the defect in the assembly of 4C(−) virus was mediated by such autocrine and paracrine IFN-α/β, if the CV1 cell line responded to IFN-α/β. A reporter plasmid, pISRE-luci, was transfected to CV1 cells. When treated with human IFN-α/β, the cells clearly responded, expressing luciferase activity increasing with time after exposure to IFN-α/β (Fig. 6A, left). On the other hand, another monkey kidney cell line, Vero, was hardly or only very poorly able to do so (Fig. 6A, right). Thus, as previously demonstrated (8), Vero cells were regarded as an IFN-α/β nonresponder. Then, a pulse-chase experiment was done with Vero cells exactly as was done previously with CV1 cells (Fig. 3B) to evaluate the kinetics of incorporation of intracellular viral proteins to the virion fractions in the supernatants. The results indicated that the incorporation of viral glycoproteins and matrix protein was significantly delayed in 4C(−) infection (Fig. 6B) exactly as was seen in CV1 cells (Fig. 3B). Therefore, this delay and probably the assembly defect of 4C(−) virus have nothing to do with the failure to block IFN-α/β-mediated signaling.
FIG. 6.
Response of CV1 and Vero cells to IFN-α/β and incorporation of viral proteins into virions in Vero cells. (A) CV1 and Vero cells transfected with pISRE-luci were incubated in the presence (filled bars) or absence (open bars) of human IFN-α/β for the different hours indicated and assayed for luciferase activities. (B) Incorporation of viral proteins synthesized in infected Vero cells into the virion fractions of the supernatants was analyzed by pulse-chase labeling exactly as was done in Fig. 3. The dots on the left of WT chase lane 1 indicate the positions of HN, F0, and M proteins.
DISCUSSION
Previously, we created by reverse genetics the 4C(−) virus that expresses none of the four C proteins and concluded that the SeV C proteins are categorically nonessential gene products but greatly contribute to full replication in tissue culture cells and pathogenicity for mice (21). Here, we attempted to reveal how the C proteins would contribute to full virus replication in tissue culture cells by comparing replication kinetics and viral macromolecular synthesis in CV1 cells infected with the WT and 4C(−) viruses. Under single-cycle replication conditions, 4C(−) replicated much more slowly and to titers about 2 logs lower than those of the WT (Fig. 1). Nevertheless, the synthesis of viral mRNAs, proteins, and genomic RNAs was not suppressed at all or even augmented in 4C(−) infection (Fig. 2). This suggested that the assembly process was impaired in 4C(−) infection. Indeed, when the incorporation of intracellular viral proteins into the virion fraction of the culture supernatants was analyzed by pulse-chase labeling, it turned out that there was a considerable delay of incorporation of the M protein as well as both of the envelope proteins, HN and F0 (Fig. 3B). Additional pieces of evidence supporting the role of C proteins in virus assembly were the anomalous sedimentation profile in the sucrose gradient (Fig. 3C) and anomalous morphology (Fig. 1C), which were characteristics of 4C(−) virions.
SeV C proteins counteract the antiviral action of IFN-α/β possibly by blocking the IFN-α/β-mediated signaling and therefore play a critical role in viral evasion of innate immunity (11, 12). They also appear to down-regulate viral mRNA and genomic RNA synthesis, probably in order to optimize the virus replication (2, 4, 41). The fact that 4C(−) virus displayed essentially the same assembly defect in an IFN-α/β-nonresponding Vero cell line (Fig. 6) clearly indicates that IFN-α/β blocking function and the role in virus assembly of the C proteins have nothing to do with each other. It remains to be determined whether the role in assembly and the role in RNA synthesis are related to each other.
SeV C protein was initially regarded as a nonstructural protein expressed in cells in large amounts and absent in virions. Although the presence in the virions was later demonstrated, the C protein as well as three other C-related proteins are greatly underrepresented in the virions, compared with those in infected cells. It is, therefore, quite unexpected that the seemingly nonstructural C proteins are required for assembly. It is also very difficult to conceptualize how such basically nonstructural C proteins contribute to virus assembly.
The most acceptable model of the assembly of paramyxoviruses and other enveloped RNA viruses involves the condensation of external glycoproteins expressed on the entire cell surface into a patch of membrane, an immediate precursor of the envelope, by the association of M proteins or the M and RNP complex from the inside (29, 45). The cross-linking of SeV external glycoproteins and internal RNP was possible only in the presence of the M proteins (36, 46). The M proteins may further provide force (“push”) from the inside for the patch of membranes to bud. Bending of membranes from the outside (“pull”) may be provided by glycoproteins (25, 31, 37). It was found for influenza A virus that the interaction between the cytoplasmic tail of neuraminidase with an internal protein (probably the M1 protein) was necessary to drive pinching off the virions (16). Without this interaction, the virus attained highly irregular shape and morphology.
In the present study, we observed strict colocalization of M proteins with the C proteins in the cytoplasm, suggesting their interaction with each other in the natural life cycle (Fig. 5). This presumable association, however, must be transient because the M protein is one of the most abundant components in the virions while the C proteins are one of the least abundant. Newly synthesized M proteins alone may be unable to initiate virus assembly. The C protein may act as a chaperon to convert those M proteins to an assembly-initiating form. In this context it is worthy to note that another viral or host factor would also be required for the assembly of the nucleocapsid-M protein complex of vesicular stomatitis virus (10). The presumed role of SeV C proteins in assembly also is reminiscent of the Vif protein of human immunodeficiency virus type 1. It is also required during virus assembly, but only the traces of this protein are present in the virion itself (42). Alternatively, the intracellular pool of SeV M proteins or their nascent chains may be constitutively associated with the C protein, and only those M proteins which are then dissociated from the C proteins may enter the assembly pathway.
Actual association between the M and C proteins remains to be demonstrated. However, there is circumstantial evidence supporting this. The 4C(−) virus stock used here was prepared after four successive passages of the virus in eggs. We found that two additional egg passages casually resulted in generation of a virus, which displayed faster and better replication compared with that of the fourth-passage virus but still was impaired compared with that of the WT virus. This partial revertant possessed an M protein mutated such that it migrated faster than that of the WT or the 4C(−) virus. This novel phenotype of the M protein was attributed to a single point mutation, Ala to Thr, at position 311 (unpublished data). Thus, this point mutation in the M protein appeared to compensate at least in part for the loss of C proteins, suggesting that the M protein can be a target of C proteins.
Though not as strikingly as the M proteins, the HN proteins were pretty well colocalized with the C proteins (Fig. 5). In addition, delayed incorporation into virions was observed not only for the M protein but also for the HN and F0 proteins (Fig. 3 and 6). Thus, it also has to be defined whether the C proteins interact with the envelope glycoproteins. The altered intracellular distribution of HN glycoproteins due to the absence of C proteins (Fig. 4) may be an indirect result of the impaired virus assembly or, alternatively, suggests the possibility of direct C-HN interaction in the natural infection in the presence of C proteins. The differences in intracellular distribution of the internal P and L proteins in the presence and absence of C proteins were also striking (Fig. 4). The formation of RNP inclusion bodies characteristic of normal SeV infection was no longer seen in the absence of C proteins. This suggests that the C proteins may contribute to RNP formation. To test this possibility, we isolated nucleocapsids from WT- and 4C(−)-infected cells and compared the SDS-PAGE profiles. However, no significant differences were found; both nucleocapsids contained the N, P, and L proteins as the major protein components in similar proportions but were poorly associated with either the M or C protein (data not shown). Thus, the altered distribution of P and L proteins in the absence of C proteins might be an indirect result caused by impaired virus assembly.
As noted above, SeV C proteins are expressed as a nested set of four C proteins. The Y1 and Y2 proteins were previously found to be unable to fully compensate for the loss of C and C′ in maintaining a normal level of viral replication, even though Y1 and Y2 were overexpressed in the C/C′ knockout virus (21). Thus, there appear to be functional differences at least between C-C′ and Y1-Y2 groups. It remains to be defined whether one, some, or all of the C proteins will be required in the assembly process. The same is true for the other functions of C proteins, such as anti-IFN-α/β action.
In summary, SeV C proteins were previously found to regulate RNA synthesis and also appeared to be essential for the virus to counteract the innate immunity of the host to clear the virus by IFN-α/β. It is now clear that SeV C proteins play an essential role in virus assembly. Thus, SeV C proteins are quite versatile. Reverse genetics has now become available for many members of paramyxoviruses, representing all four genera (27). Similar reverse genetics studies of other C-protein-encoding members will greatly facilitate the understanding of this extremely interesting and versatile accessory gene product of members of the Paramyxoviridae family.
ACKNOWLEDGMENTS
We thank K. Ozato, A. Portner, H. Taira, and K. Mizumoto for providing us with pISRE-luci or SeV-specific antibodies. We also thank K. Kiyotani and S. Kuge for their technical help and suggestion.
This work was supported by research grants from the Ministry of Education, Science, Sports and Culture, Japan, and from the Bio-oriented Technology Research Advancement Institution (BRAIN), Japan. M.K.H. is a recipient of a BRAIN fellowship.
REFERENCES
- 1.Barr J, Chambers P, Harriott P, Pringle C R, Easton A J. Sequence of the phosphoprotein gene of pneumonia virus of mice: expression of multiple proteins from two overlapping reading frames. J Virol. 1994;68:5330–5334. doi: 10.1128/jvi.68.8.5330-5334.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cadd T, Garcin D, Tapparel C, Itoh M, Homma M, Roux L, Curran J, Kolakofsky D. The Sendai paramyxovirus accessory C proteins inhibit viral genome amplification in a promoter specific fashion. J Virol. 1996;70:5067–5074. doi: 10.1128/jvi.70.8.5067-5074.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Curran J, Boeck R, Kolakofsky D. The Sendai virus P gene expresses both an essential protein and an inhibitor of RNA synthesis by shuffling modules via mRNA editing. EMBO J. 1991;10:3079–3085. doi: 10.1002/j.1460-2075.1991.tb07860.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Curran J, Marq J-B, Kolakofsky D. The Sendai virus nonstructural C proteins specifically inhibit viral mRNA synthesis. Virology. 1992;189:647–656. doi: 10.1016/0042-6822(92)90588-g. [DOI] [PubMed] [Google Scholar]
- 5.Curran J, Kolakofsky D. Ribosomal initiation from an ACG codon in the Sendai virus P/C mRNA. EMBO J. 1988;7:245–251. doi: 10.1002/j.1460-2075.1988.tb02806.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Curran J, Kolakofsky D. Scanning independent ribosomal initiation of the Sendai virus Y proteins in vitro and in vivo. EMBO J. 1989;8:521–526. doi: 10.1002/j.1460-2075.1989.tb03406.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Curran J, Kolakofsky D. Sendai virus P gene produces multiples proteins from overlapping open reading frames. Enzymes. 1990;44:244–249. doi: 10.1159/000468762. [DOI] [PubMed] [Google Scholar]
- 8.Diaz M O, Ziemin S, Le Beau M M, Pitha P, Smith S D, Chilcote R R, Rowley J D. Homozygous deletion of the alpha- and beta 1 interferon genes in human leukemia and derived cell lines. Proc Natl Acad Sci USA. 1988;85:5259–5263. doi: 10.1073/pnas.85.14.5259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Didcock L, Young D F, Goodbourn S, Randall R E. Sendai virus and simian virus 5 block activation of interferon-responsive genes: importance for virus pathogenesis. J Virol. 1999;73:3125–3133. doi: 10.1128/jvi.73.4.3125-3133.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Flood E A, Lyles D S. Assembly of nucleocapsids with cytosolic and membrane-derived matrix proteins of vesicular stomatitis virus. Virology. 1999;261:295–308. doi: 10.1006/viro.1999.9856. [DOI] [PubMed] [Google Scholar]
- 11.Garcin D, Latorre P, Kolakofsky D. Sendai virus C proteins counteract the interferon-mediated induction of an antiviral state. J Virol. 1999;73:6559–6565. doi: 10.1128/jvi.73.8.6559-6565.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gotoh B, Takeuchi K, Komatsu T, Yokoo J, Kimura Y, Kurotani A, Kato A, Nagai Y. Knockout of the Sendai virus C gene eliminates the viral ability to prevent the interferon-α/β-mediated responses. FEBS Lett. 1999;459:205–210. doi: 10.1016/s0014-5793(99)01241-7. [DOI] [PubMed] [Google Scholar]
- 13.Gupta K C, Patwardhan S. ACG, the initiator codon for a Sendai virus protein. J Biol Chem. 1988;263:8553–8556. [PubMed] [Google Scholar]
- 14.Hamaguchi M, Yoshida T, Nishikawa K, Naruse H, Nagai Y. Transcriptive complex of Newcastle disease virus I. Both L and P proteins are required to constitute an active complex. Virology. 1983;128:105–117. doi: 10.1016/0042-6822(83)90322-7. [DOI] [PubMed] [Google Scholar]
- 15.Horikami S M, Hector R E, Smallwood S, Moyer S A. The Sendai virus C protein binds the L polymerase protein to inhibit RNA synthesis. Virology. 1997;235:261–270. doi: 10.1006/viro.1997.8702. [DOI] [PubMed] [Google Scholar]
- 16.Jin H, Leser G P, Zhang J, Lamb R A. Influenza virus hemagglutinin and neuraminidase cytoplasmic tails control particle shape. EMBO J. 1997;16:1236–1247. doi: 10.1093/emboj/16.6.1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kato A, Kiyotani K, Sakai Y, Yoshida T, Nagai Y. The paramyxovirus, Sendai virus, V protein encodes a luxury function required for viral pathogenesis. EMBO J. 1997;16:578–587. doi: 10.1093/emboj/16.3.578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kato A, Kiyotani K, Sakai Y, Yoshida T, Shioda T, Nagai Y. Importance of the cysteine-rich carboxy-terminal half of V protein for Sendai virus pathogenesis. J Virol. 1997;71:7266–7272. doi: 10.1128/jvi.71.10.7266-7272.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kato A, Sakai Y, Shioda T, Kondo T, Nakanishi M, Nagai Y. Initiation of Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense. Genes Cells. 1996;1:569–579. doi: 10.1046/j.1365-2443.1996.d01-261.x. [DOI] [PubMed] [Google Scholar]
- 20.Kiyotani K, Takao S, Sakaguchi T, Yoshida T. Immediate protection of mice from lethal wild type Sendai virus (HVJ) infections by a temperature-sensitive mutant, HVJpi, possessing homologous interfering capacity. Virology. 1990;177:65–74. doi: 10.1016/0042-6822(90)90460-9. [DOI] [PubMed] [Google Scholar]
- 21.Kurotani A, Kiyotani K, Kato A, Shioda T, Sakai Y, Mizumoto K, Yoshida T, Nagai Y. The paramyxovirus, Sendai virus, C proteins are categorically nonessential gene products but silencing their expression severely impairs viral replication and pathogenesis. Genes Cells. 1998;2:111–124. doi: 10.1046/j.1365-2443.1998.00170.x. [DOI] [PubMed] [Google Scholar]
- 22.Lamb R A, Choppin P W. The synthesis of Sendai virus polypeptides in infected cells. II. Intracellular distribution of polypeptides. Virology. 1977;81:371–381. doi: 10.1016/0042-6822(77)90153-2. [DOI] [PubMed] [Google Scholar]
- 23.Lamb R A, Kolakofsky D. Paramyxoviridae: the viruses and their replication. In: Fields B N, Knipe D M, Howley P M, editors. Fields virology. 3rd ed. Philadelphia, Pa: Lippincott-Raven Press; 1996. pp. 1177–1204. [Google Scholar]
- 24.Lamb R A, Paterson R G. The non-structural proteins of paramyxoviruses. In: Kingsbury D W, editor. The paramyxoviruses. New York, N.Y: Plenum Press; 1991. pp. 181–210. [Google Scholar]
- 25.Mebatsion T, Konig M, Conzelmann K K. Budding of rabies virus particles in the absence of the spike glycoprotein. Cell. 1996;84:941–951. doi: 10.1016/s0092-8674(00)81072-7. [DOI] [PubMed] [Google Scholar]
- 26.Nagai Y. Paramyxovirus replication and pathogenesis. Reverse genetics transforms understanding. Rev Med Virol. 1999;9:83–99. doi: 10.1002/(sici)1099-1654(199904/06)9:2<83::aid-rmv244>3.0.co;2-5. [DOI] [PubMed] [Google Scholar]
- 27.Nagai Y, Kato A. Paramyxovirus reverse genetics is coming of age. Microbiol Immunol. 1999;43:613–624. doi: 10.1111/j.1348-0421.1999.tb02448.x. [DOI] [PubMed] [Google Scholar]
- 28.Nagai Y, Klenk H-D, Rott R. Proteolytic cleavage of the viral glycoproteins and its significance for the virulence of Newcastle disease virus. Virology. 1976;72:494–508. doi: 10.1016/0042-6822(76)90178-1. [DOI] [PubMed] [Google Scholar]
- 29.Nagai Y, Ogura H, Klenk H-D. Studies on the assembly of Newcastle disease virus. Virology. 1976;69:523–538. doi: 10.1016/0042-6822(76)90482-7. [DOI] [PubMed] [Google Scholar]
- 30.Nagai Y, Yoshida T, Hamaguchi M, Nagura H, Hasegawa H, Yoshimura S, Watanabe K. Subcellular location of the major protein antigens of paramyxoviruses revealed by immunoperoxidase cytochemistry. Microbiol Immunol. 1983;27:531–545. doi: 10.1111/j.1348-0421.1983.tb00614.x. [DOI] [PubMed] [Google Scholar]
- 31.Peeples M E. Paramyxovirus M proteins: pulling it all together and taking it on the road, 427–456. In: Kingsbury D W, editor. The paramyxoviruses. New York, N.Y: Plenum Press; 1991. [Google Scholar]
- 32.Portner A, Gupta K C, Seyer J M, Beachey E H, Kingsbury D W. Localization and characterization of Sendai virus nonstructural C and C′ proteins by antibodies against synthetic peptides. Virus Res. 1986;6:109–121. doi: 10.1016/0168-1702(86)90043-2. [DOI] [PubMed] [Google Scholar]
- 33.Samuel C. Antiviral actions of interferon: interferon regulated cellular proteins and their surprisingly selective antiviral activities. Virology. 1991;183:1–11. doi: 10.1016/0042-6822(91)90112-o. [DOI] [PubMed] [Google Scholar]
- 34.Sanderson C M, Wu H-H, Nayak D P. Sendai virus M protein binds independently to either the F or the HN glycoprotein in vivo. J Virol. 1994;68:69–76. doi: 10.1128/jvi.68.1.69-76.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sen G C, Ransohoff R M. Interferon induced antiviral actions and their regulation. Adv Virus Res. 1993;43:57–102. doi: 10.1016/s0065-3527(08)60083-4. [DOI] [PubMed] [Google Scholar]
- 36.Shimizu K, Shimizu Y K, Kohama T, Ishida N. Isolation and characterization of two distinct types of HVJ (Sendai virus) spikes. Virology. 1974;62:90–101. doi: 10.1016/0042-6822(74)90305-5. [DOI] [PubMed] [Google Scholar]
- 37.Simons K, Garoff H. The budding mechanisms of enveloped animal viruses. J Gen Virol. 1980;50:1–21. doi: 10.1099/0022-1317-50-1-1. [DOI] [PubMed] [Google Scholar]
- 38.Spiropoulou C F, Nichol S T. A small highly basic protein is encoded in overlapping frame within the P gene of vesicular stomatitis virus. J Virol. 1993;67:3103–3110. doi: 10.1128/jvi.67.6.3103-3110.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Staeheli P. Interferon induced proteins and the antiviral state. Adv Virus Res. 1990;38:147–200. doi: 10.1016/s0065-3527(08)60862-3. [DOI] [PubMed] [Google Scholar]
- 40.Takeda M, Kato A, Kobune F, Sakata H, Ll Y, Shioda T, Sakai Y, Asakawa M, Nagai Y. Measles virus attenuation associated with transcriptional impediment and a few amino acid changes in the polymerase and accessory proteins. J Virol. 1998;72:8690–8696. doi: 10.1128/jvi.72.11.8690-8696.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Tapparel C, Hausmann S, Pelet T, Curran J, Kolakofsky D, Roux L. Inhibition of Sendai virus genome replication due to promoter increased selectivity: a possible role for the accessory C proteins. J Virol. 1997;71:9588–9599. doi: 10.1128/jvi.71.12.9588-9599.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Trono D. HIV accessory proteins: leading roles for the supporting cast. Cell. 1995;82:189–192. doi: 10.1016/0092-8674(95)90306-2. [DOI] [PubMed] [Google Scholar]
- 43.Yamada H, Hayata S, Omata-Yamada T, Taira H, Mizumoto K, Iwasaki K. Association of the Sendai virus C protein with nucleocapsids. Arch Virol. 1990;113:245–253. doi: 10.1007/BF01316677. [DOI] [PubMed] [Google Scholar]
- 44.Yokoo J, Gotoh B, Konmatsu T, Takeuchi K, Miyadai T. Replication-incompetent Sendai virus can suppress the antiviral action of type 1 interferon. Arch Virol. 1999;144:1043–1055. doi: 10.1007/s007050050568. [DOI] [PubMed] [Google Scholar]
- 45.Yoshida T, Nagai Y, Maeno K, Iinuma M, Hamaguchi M, Matsumoto T, Nagayoshi S, Hoshino M. Studies on the role of M protein in virus assembly using a ts mutant of HVJ (Sendai virus) Virology. 1979;92:139–154. doi: 10.1016/0042-6822(79)90220-4. [DOI] [PubMed] [Google Scholar]
- 46.Yoshida T, Nagai Y, Yoshii S, Maeno K, Matsumoto T. Membrane (M) protein of HVJ (Sendai virus): its role in virus assembly. Virology. 1976;71:143–161. doi: 10.1016/0042-6822(76)90101-x. [DOI] [PubMed] [Google Scholar]






