Quantitative proteomics analysis reveals possible anticancer mechanisms of 5’-deoxy-5’-methylthioadenosine in cholangiocarcinoma cells

Kankamol Kerdkumthong; Sutthipong Nanarong; Sittiruk Roytrakul; Thanawat Pitakpornpreecha; Phonprapavee Tantimetta; Phanthipha Runsaeng; Sumalee Obchoei

doi:10.1371/journal.pone.0306060

. 2024 Jun 26;19(6):e0306060. doi: 10.1371/journal.pone.0306060

Quantitative proteomics analysis reveals possible anticancer mechanisms of 5’-deoxy-5’-methylthioadenosine in cholangiocarcinoma cells

Kankamol Kerdkumthong ^1,^#, Sutthipong Nanarong ^1,^2,^#, Sittiruk Roytrakul ³, Thanawat Pitakpornpreecha ^1,⁴, Phonprapavee Tantimetta ¹, Phanthipha Runsaeng ^1,⁴, Sumalee Obchoei ^1,^4,^*

Editor: Matias A Avila⁵

PMCID: PMC11206958 PMID: 38923999

Abstract

Cholangiocarcinoma (CCA) is an aggressive cancer originating from bile duct epithelium, particularly prevalent in Asian countries with liver fluke infections. Current chemotherapy for CCA often fails due to drug resistance, necessitating novel anticancer agents. This study investigates the potential of 5’-deoxy-5’-methylthioadenosine (MTA), a naturally occurring nucleoside, against CCA. While MTA has shown promise against various cancers, its effects on CCA remain unexplored. We evaluated MTA’s anticancer activity in CCA cell lines and drug-resistant sub-lines, assessing cell viability, migration, invasion, and apoptosis. The potential anticancer mechanisms of MTA were explored through proteomic analysis using LC-MS/MS and bioinformatic analysis. The results show a dose-dependent reduction in CCA cell viability, with enhanced effects on cancer cells compared to normal cells. Moreover, MTA inhibits growth, induces apoptosis, and suppresses cell migration and invasion. Additionally, MTA enhanced the anticancer effects of gemcitabine on drug-resistant CCA cells. Proteomics revealed the down-regulation of multiple proteins by MTA, affecting various molecular functions, biological processes, and cellular components. Network analysis highlighted MTA’s role in inhibiting proteins related to mitochondrial function and energy derivation, crucial for cell growth and survival. Additionally, MTA suppressed proteins involved in cell morphology and cytoskeleton organization, important for cancer cell motility and metastasis. Six candidate genes, including ZNF860, KLC1, GRAMD1C, MAMSTR, TANC1, and TTC13, were selected from the top 10 most down-regulated proteins identified in the proteomics results and were subsequently verified through RT-qPCR. Further, KLC1 protein suppression by MTA treatment was confirmed through Western blotting. Additionally, based on TCGA data, KLC1 mRNA was found to be upregulated in the tissue of CCA patients compared to that of normal adjacent tissues. In summary, MTA shows promising anticancer potential against CCA by inhibiting growth, inducing apoptosis, and suppressing migration and invasion, while enhancing gemcitabine’s effects. Proteomic analysis elucidates possible molecular mechanisms underlying MTA’s anticancer activity, laying the groundwork for future research and development of MTA as a treatment for advanced CCA.

Introduction

Cholangiocarcinoma (CCA) is an aggressive cancer that originates from the bile duct epithelium [1]. While it is considered rare globally, it is more prevalent in certain Asian countries, with the highest incidence in Thailand, where there is a high prevalence of the causative liver fluke infection [2]. Over the past few decades, both the incidence and mortality rates of CCA have significantly increased worldwide [3–5]. CCA tends to develop silently but exhibits a high level of invasiveness [6]. Consequently, it often remains asymptomatic in its early stages and is diagnosed at an advanced stage. Patients with metastatic CCA are poor candidates for surgery, and as a result, the common treatment for these patients is chemotherapy. Unfortunately, CCA shows a high resistance to chemotherapeutic drugs, leading to ineffective treatments and poor overall survival rates [7]. Even when a combination of chemotherapeutic drugs is used, the survival of patients with CCA remains poor. Therefore, there is an urgent to pursue new anticancer agents that are effective with minimal side effects.

5′-deoxy-5′-methylthioadenosine (MTA) is a naturally occurring sulfur-containing nucleoside (Fig 1A). It is found in low concentrations in prokaryotes, yeasts, plants, and eukaryotes. In mammals, including humans, MTA is a by-product of polyamine biosynthesis and plays a crucial role in various metabolic pathways, particularly the salvage pathways of methionine and purine [8,9]. Numerous reports have highlighted the physiological and pharmacological roles of MTA, including anticancer activities, such as its ability to inhibit cell proliferation and invasion in multiple cancer types. For instance, studies have demonstrated that MTA can hinder the growth of cervical cancer, lymphoma, erythroleukemia, and promyelocytic cells [9,10]. Moreover, MTA has been shown to suppress the migration and invasion of colorectal cancer, liver cancer, and HT1080 fibrosarcoma cells [10,11]. Numerous studies have demonstrated that MTA’s impact on cancer cells is notably more pronounced than on normal cells. This disparity arises due to the absence of 5-methylthioadenosine phosphorylase (MTAP), a crucial enzyme in the methionine salvage pathway, within cancer cells [10,12–14]. This deficiency disrupts the adenine salvage pathway, leading to the buildup of unmetabolized MTA and subsequent cellular toxicity. Despite extensive research on MTA’s targets and mechanisms of action in various cancers, its effects on CCA remain unexplored. In this study, we investigated the impact of MTA on CCA cell lines, including those resistant to chemotherapeutic drug, gemcitabine and evaluated its toxicity on normal bile duct cell line. Additionally, we studied the effect of combination treatment of gemcitabine and MTA on CCA cell lines. Finally, we explored the possible anticancer mechanisms of MTA through quantitative proteomics and bioinformatics analyses.

Materials & methods

Chemicals and reagents

5´-deoxy-5´-methylthioadenosine (MTA), gemcitabine, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagents were purchased from Sigma (Sigma—Aldrich, St. Louis, MO, USA). Matrigel^™ was purchased from BD Bioscience (BD Bioscience, Bedford, MA, USA).

Cell culture

Two human CCA cell lines, KKU-213A and KKU-213B, were established from tissues of Thai CCA patients [15]. An immortalized human cholangiocyte cell line (MMNK-1) was established as previously described [16]. These cell lines were obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (Osaka, Japan). The gemcitabine-resistant cells, KKU-213A-GR and KKU-213B-GR, were established from the CCA parental cell lines, KKU-213A and KKU-213B, respectively, as previously described [17]. All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, NY, USA) and 1% antibiotics/antimycotics (Capricorn Scientific), in a humidified atmosphere of 5% CO₂ at 37°C.

Cell viability assay

Cell viability was determined using the MTT assay. Briefly, 3×10³ cells per well (for 72-hour treatment) and 1×10³ cells per well (for 7-day treatment) were seeded in a 96-wells plate and incubated overnight. The following day, the cells were exposed to various concentrations of MTA. After the specified incubation time, cell viability was determined using MTT assay. The percentage of cell viability and the half-maximal inhibitory concentration (IC₅₀) were then calculated and compared. To determine the effect of MTA combined with gemcitabine, the parental and gemcitabine resistant cells, which had been grown overnight, were treated with 6.25 and 12.5 μg/mL of MTA as a single agent or in combination with 3 μM gemcitabine for 72 hours. Cell viability was assessed using the MTT assay, as described above.

Cell growth assay

The effect of MTA on cell growth was measured using MTT assay. KKU-213A and KKU-213B cells, at a density of 1.5×10³ cells per well, were seeded in a 96-well plate, treated with 6.25, 12.5, and 25 μg/mL of MTA, and subjected to MTT assays on day 0, 2, 4, 6, and 8. The cell growth rate was calculated as a fold change compared to day 0.

Apoptotic nuclear staining assay

Apoptotic cells were visualized under a microscope following a double staining procedure using two fluorescence DNA staining dyes, Hoechst 33342 and propidium iodide. Hoechst 33342 can permeate both live and dead cell membranes to stain DNA, while propidium iodide can only penetrate the membranes of dead cells. Nuclei that appear condensed and were stained with both dyes were counted as apoptotic nuclei. KKU-213A and KKU-213B cells (2×10⁵ cells/well) were seeded in a 6-well plate, incubated overnight, and then treated with 0, 12.5, and 25 μg/mL of MTA for 72 hours. The culture medium was replaced with a solution of Hoechst 33342 (5 μg/mL) and propidium iodide (10 μg/mL) for 5 minutes, while protected from light. Apoptotic cells were observed and counted under a fluorescence microscope (cellSens Standard software, Olympus IX73 inverted microscope, EVIDENT, Japan).

Scratch assay

CCA cells (2×10⁵ cells/well) were seeded into a 12-well plate and cultured in complete medium overnight. When the cell monolayer reached approximately 90–100% confluence, wounds were created using a sterile pipette tip. Subsequently, the old medium and cell debris were removed, and the cells were incubated with 0, 12.5, and 25 μg/mL of MTA for 48 hours. Wound images were captured at 12, 24, 36, and 48-hour time points. The percentage of wound closure was measured using ImageJ software (version 1.53e, National Institute of Health, Bethesda, MD, USA).

Cell migration and invasion assay

Cell migration and invasion assays were conducted using a modified Boyden chamber method with Transwell^® inserts featuring 8.0 μm pore size (Corning, NY, USA). KKU-213A and KKU-213B cells (2×10⁴ cells) were seeded into the upper compartment of the Transwell^® inserts, either in serum-free medium with or without MTA (12.5 and 25 μg/mL). For the invasion assay, the Transwell^® inserts were pre-coated with 0.5 mg/mL Matrigel^™ before use. In the lower chamber, complete medium was added to serve as a chemoattractant for cell migration and invasion. After 12 hours of incubation, non-migrated/non-invaded cells in the upper chamber were removed. The migrated and invaded cells were fixed with 4% paraformaldehyde, stained with 0.4% sulforhodamine B (SRB), and images were captured using a microscope. The numbers of migrated and invaded cells from 6 random low-power fields were counted and compared.

Sample preparation for proteomics analysis

MTA-treated KKU-213A cells and untreated control cells were harvested via trypsinization and washed twice with 1x phosphate buffered saline (PBS). The cell pellets were lysed with 0.5% SDS and then centrifuged at 10,000xg for 15 minutes. The resulting supernatant was transferred to a new tube, mixed with two volumes of cold acetone, and incubated overnight at -20 ºC. The mixture was then thawed and centrifuged at 10,000xg for 15 minutes. After discarding the supernatant, the pellet was dried and stored at -80°C until use.

Liquid chromatography and tandem mass spectrometry

To identify the proteins affected by MTA treatment, we conducted proteomic analysis using liquid chromatography with tandem mass spectrometry (LC-MS/MS). The protein concentration of all samples was determined by the Lowry assay using BSA as the standard protein. To reduce disulfide bonds, we added 10 mM dithiothreitol in 10 mM ammonium bicarbonate to the protein solution, and the reformation of disulfide bonds in the proteins was blocked by alkylation with 30 mM iodoacetamide in 10 mM ammonium bicarbonate. Protein samples were prepared and digested with sequencing-grade porcine trypsin (at a ratio of 1:20) for 16 hours at 37°C. Subsequently, they were injected into an Ultimate3000 Nano/Capillary LC System (Thermo Scientific, UK) coupled with an HCTUltra LC-MS system (Bruker Daltonics Ltd, Hamburg, Germany), equipped with a Nano-captive spray ion source. Briefly, 5 μL of peptide digests were enriched on a μ-Precolumn 300 μm I.D. x 5 mm C18 Pepmap 100, 5 μm, 100 Å (Thermo Scientific, UK), separated on a 75 μm I.D. x 15 cm and packed with Acclaim PepMap RSLC C18, 2 μm, 100 Å, nanoViper (Thermo Scientific, UK). The C18 column was enclosed in a thermostatted column oven set to 60°C. Solvent A and B containing 0.1% formic acid in water and 0.1% formic acid in 80% acetonitrile, respectively, were supplied on the analytical column. A gradient of 5–55% solvent B was used to elute the peptides at a constant flow rate of 0.30 μL/min for 30 minutes. Electrospray ionization was carried out at 1.6 kV using the CaptiveSpray. Nitrogen was used as a drying gas (flow rate about 50 L/h). Collision-induced-dissociation (CID) product ion mass spectra were obtained using nitrogen gas as the collision gas. Mass spectra (MS) and MS/MS spectra were obtained in the positive-ion mode at 2 Hz over the range (m/z) 150–2200. The collision energy was adjusted to 10 eV as a function of the m/z value. The LC-MS analysis of each sample (100 ng/mL) was done in triplicate. The MS proteomics data from this research have been deposited in the ProteomeXchange Consortium (http://www.proteomexchange.org/) through the jPOSTrepo partner (https://repository.jpostdb.org/entry/JPST002497), with dataset identifier PXD049119.

Protein identification and quantification

The LC-MS data were processed using DecyderMS [18,19] and searched against all nonredundant protein sequences from the UniProt database, which includes entries for Homo sapiens proteins, comprising 20,386 entries from Swiss-Prot and 181,774 entries from TrEMBL. Proteins affected by MTA treatment, exhibiting a decrease or increase in expression by at least 2-fold, with a false discovery rate (FDR) of less than 0.05, were identified as differentially expressed proteins (DEPs). In this study, the down-regulated proteins were further analyzed. The heatmap displaying the down-regulated proteins in MTA-treated KKU-213A cells compared to the untreated control cells was generated using MultiExperiment Viewer (MeV) software, following the method described by Howe and colleagues [20]. It was based on the Log2 values of protein expression in KKU-213A cells with or without MTA treatment.

Protein function enrichment and cluster analysis

The PANTHER classification system (version 18.0, http://www.pantherdb.org) was employed for protein identification and classification across molecular function, biological process, cellular component, protein class, and signaling pathway [21]. To accomplish this, protein IDs (UniProtKB) of the down-regulated proteins in MTA-treated KKU-213A cells were submitted to PANTHER, with Homo sapiens selected as the organism. Gene Ontology (GO) enrichment analysis on the down-regulated proteins was conducted using the ShinyGo web server [22], version 0.741, utilizing the Homo sapiens proteome as a reference for analysis. The down-regulated proteins were then categorized according to the GO biological process and GO cellular component collections. An FDR of less than 0.05 was considered significant. In the network analysis, each node represented an enriched GO term, with connected GO terms linked by lines. The thickness of each line indicated the percentage of overlapping genes, while the size of the node was proportional to the number of genes it represented.

RT-qPCR

Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used to measure mRNA expression of genes of interest. After appropriate cell culture conditions or treatments, total RNA was extracted from cells using TRIzol^™ reagent (Thermo Fisher Scientific, USA). Then, 2 μg total RNA of each sample was converted into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Vilnius, Lithuania). The obtained cDNA was then amplified using gene-specific primers (Table 1) and Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Vilnius, Lithuania), following the manufacturer’s protocol. The relative mRNA expression was normalized using the internal control gene (ACTB) and calculated using the 2^–ΔΔCt equation.

Table 1. Lists of gene specific primers for qPCR.

Gene	Sequence (5′to3′)
ACTB	For:	`GGATTCCTATGTGGGCGACG`
ACTB	Rev:	`TTGTAGAAGGTGTGGTGCCAG`
MTAP	For:	`AGCACACCATCATGCCTTCA`
MTAP	Rev:	`AATGACAATATCGCCGGGCT`
ZNF860	For:	`ACACTCCCTCTCTCGGTCTTC`
ZNF860	Rev:	`CCTCCCTGAGCTGTGACTTTG`
KLC1	For:	`TGAGGTCTCGTAAACAGGGT`
KLC1	Rev:	`AAGATCAGTGCCATCTTCCTCC`
GRAMD1C	For:	`ACTGTCCGTCAGGTGATGAAT`
GRAMD1C	Rev:	`AAAGCTCCAGTCACCACTCC`
MAMSTR	For:	`GTCTCCGATCCTGTGTCTGC`
MAMSTR	Rev:	`CTGCTGGAGGATCCATGGTG`
TANC1	For:	`GTGTGTCTGCTGACCAAGAAGG`
TANC1	Rev:	`GACCACTCACAAGTCAGCAGGT`
TTC13	For:	`CATGACTCAGACTGCGAACC`
TTC13	Rev:	`ATCAGTGGCAAACGGGAATC`

Open in a new tab

Western blotting

Following treatment with MTA at 0, 25, and 50 μg/mL for 48 hours, total protein was extracted from KKU-213A and KKU-213B cells using RIPA lysis buffer (Visual Protein, Taiwan) containing a protease inhibitor cocktail (Merck KGaA, Germany). The protein concentration was determined using a bicinchoninic acid protein concentration assay kit (Bio Basic, USA). Then, 30 μg of protein from each sample was separated using SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membrane was incubated at 4°C overnight with primary antibodies against KLC1 (1:1,000 dilution, Abcam, Cambridge, UK) or β-actin (1:10,000 dilution, Sigma-Aldrich, Darmstadt, Germany), followed by incubation with HRP-conjugated secondary antibodies (1:10,000 dilution, Sigma-Aldrich, Darmstadt, Germany) for 1 hour. Immunoreactive signals were developed via ECL prime reagent (Thermo Fisher Scientific, USA) and captured with an Alliance^®Q9-ATOM Chemiluminescence Imager (Uvitec, Cambridge, UK).

Analysis of KLC1 mRNA expression in CCA patients’ tissue

The expression level of KLC1 in CCA patient tissues was analyzed using the online analysis platform The Gene Expression Profiling Interactive Analysis 2 (GEPIA2) (http://gepia2.cancer-pku.cn/#analysis) based on The Cancer Genome Atlas Program (TCGA) data to compare its mRNA expression between CCA tissues and normal adjacent tissues.

Statistical analysis

The results are presented as the mean ± SD from at least three replicates. Statistical significance was determined using Student’s t-test, with p < 0.05 considered statistically significant.

Results

MTAP deficiency in CCA cell lines

The RT-qPCR analysis was conducted to examine the mRNA levels of MTAP in CCA cell lines and normal cell line. The results indicated a significant downregulation of MTAP expression in both CCA cell lines (KKU-213A and KKU-213B) when compared to the normal cell line (MMNK-1) (Fig 1B).

MTA attenuates growth of CCA cells and enhances the effect of gemcitabine in vitro

To assess the cytotoxic effect of MTA on CCA cell lines and a normal cell line, KKU-213A, KKU-213B, and MMNK-1 were exposed to various concentrations of MTA, and cell viability was determined using the MTT assay. The results indicated that MTA reduced cell viability in a dose-dependent manner both at 72 hours (Fig 2A) and 7 days (Fig 2B) after treatment. Furthermore, MTA at concentrations of 12.5, 25, 50, and 100 μg/mL had a less pronounced effect on the viability of normal cells compared to cancer cell lines (Fig 2A and 2B). The half-maximal inhibitory concentration (IC₅₀) values of MTA in both CCA cell lines and the normal cell line are provided in Table 2. Additionally, a cell growth assay was performed using relatively low concentrations of MTA. The results demonstrated that MTA at a concentration of 25 μg/mL significantly inhibited the growth of both KKU-213A (Fig 2C) and KKU-213B (Fig 2D) on day 4, 6, and 8 compared to the untreated control. Meanwhile, MTA at 6.25 and 12.5 μg/mL inhibited the growth of KKU-213A (Fig 2C) and KKU-213B (Fig 2D) on day 6 and 8. Moreover, the antiproliferative effect of MTA on the gemcitabine-resistant CCA cell lines, KKU-213A-GR and KKU-213B-GR, was investigated. The results revealed that the combination of gemcitabine and MTA at concentrations of 6.25 and 12.5 μg/mL significantly reduced cell viability in both KKU-213A-GR and KKU-213B-GR, as well as in their parental counterparts. Notably, treatment with MTA alone had a stronger effect on the gemcitabine-resistant CCA cell lines than on the parental cell lines (Fig 2E and 2F).

Fig 2 — Cell cytotoxicity assay were performed on MMNK-1, KKU-213A and KKU-213B cells after treatment with various concentrations of MTA for 72 hours (A) and 7 days (B). Significance differences are indicated by ’a’ for treatment vs. control and ’b’ for CCA cell lines vs. the normal cell line. Cell growth assays were conducted on KKU-213A (C) and KKU-213B (D) cells treated with 0, 6.25, 12.5 and 25 μg/mL MTA, with MTT assays performed at day 0, 2, 4, 6, and 8. Statistical significance is denoted as *p<0.05, **p<0.01, ***p<0.001 when comparing MTA treatment vs. untreated control at each time point. The effects of MTA in combination with gemcitabine on parental cells and their drug-resistant counterparts were evaluated, with (E) showing the percentage of cell viability for KKU-213A and KKU-213A-GR treated with MTA alone and in combination with gemcitabine, and (F) displaying the percentage of cell viability for KKU-213B and KKU-213B-GR under the same conditions. The data are presented as the mean ± SD of three replicates. Significance differences are indicated by ’a’ for treatment vs. control, ’b’ for parental cells vs. drug-resistant cells, ’c’ for MTA alone vs. MTA + gemcitabine, and ’d’ for gemcitabine alone vs. MTA + gemcitabine.

Table 2. The half-maximal inhibitory concentrations (IC₅₀) of MTA on MMNK-1, KKU-213A and KKU-213B at 72 hours and 7 days.

Cell line	IC₅₀ (μg/mL) of MTA
Cell line	72 hours	7 days
MMNK-1	234.70 ± 12.60	18.30 ± 4.80
KKU-213A	25.88 ± 3.07	8.79 ± 0.34
KKU-213B	77.56 ± 13.92	11.33 ± 0.50

Open in a new tab

MTA induces apoptosis of CCA cells

To determine whether MTA could induce apoptotic cell death, CCA cell lines were treated with 12.5 and 25 μg/mL of MTA for 72 hours and double-stained with Hoechst and propidium iodide. The cells were observed and photographed under a fluorescence microscope (Fig 3A and 3C). Apoptotic nuclei and total nuclei in each treatment group were counted from six randomly selected low-power fields, and the percentage of apoptotic nuclei was calculated. The results showed that MTA-treated cells had a higher percentage of apoptotic nuclei than the control in both KKU-213A (Fig 3B) and KKU-213B cells (Fig 3D).

Fig 3 — The cell apoptosis-inducing effects of MTA were examined by using Hoechst/propidium iodide double staining to visualize apoptotic cells. KKU-213A and KKU-213B cell lines were treated with 12.5 and 25 μg/mL MTA for 72 hours. Representative images (A) show stained KKU-213A cells, and the chart (B) illustrates the percentage of apoptotic cells in each group. Representative images (C) depict stained KKU-213B cells, and the chart (D) presents the percentage of apoptotic cells in each group. The data represents means ± SD from six random low-power fields from triplicate wells. Significant differences between treated and untreated controls are indicated by *p< 0.05, **p < 0.01, and ***p<0.001.

MTA suppresses migration and invasion capability of CCA cells

The effect of MTA on cell migration and invasion was investigated using concentrations of 12.5 and 25 μg/mL. The scratch assay was utilized to assess cell migration in two dimensions, while the modified Boyden chamber assay was used to determine both cell migration and invasion capability. The results from the scratch assay showed that the wound closure rate was significantly slower in MTA-treated cells in both KKU-213A (Fig 4A) and KKU-213B (Fig 4B). Additionally, the modified Boyden chamber assay demonstrated that the number of migrated (Fig 4C and 4D) and invaded (Fig 4E and 4F) cells was significantly reduced in the MTA-treated groups for both KKU-213A and KKU-213B cells.

Fig 4 — Scratch assays were conducted with KKU-213A (A) and KKU-213B (B). Confluent cell monolayers were scratched and then treated with MTA, with representative images taken every 12 hours. The percentage of wound closure was calculated by comparing with 0 hour. The cell migration and invasion assays used a modified Boyden chamber, measuring cell migration in KKU-213A (C) and KKU-213B (D) and cell invasion in KKU-213A (E) and KKU-213B (F). The CCA cells were seeded and allowed to migrate or invade through the porous membrane of the Transwells^® for 12 hours. The migrated or invaded cells were stained and observed under a microscope, and the cells in six random low-power fields were counted and compared. The data are presented as mean ± SD from three replicates. Significant differences between treated and untreated controls are indicated by *p< 0.05, **p < 0.01, and ***p<0.001.

Identification of differentially expressed proteins in MTA-treated cells using proteomic analysis

To further investigate the possible anticancer mechanisms of MTA, we conducted LC-MS/MS and bioinformatic analysis to identify differentially expressed proteins in MTA-treated samples. The summary workflow of the proteomic and data analysis is shown in Fig 5A. We identified unique, non-redundant proteins in both untreated control and MTA-treated cells across all biological triplicate samples. The results showed that 9 proteins were exclusively found in untreated control samples, 30 proteins were unique to MTA-treated KKU-213A samples, while 4,077 proteins were expressed in both treated and untreated samples (Fig 5B). Proteins with expression levels decreased or increased in MTA-treated cells by at least 2-fold and FDR < 0.05 were categorized as differentially expressed proteins (DEPs). Using these criteria, we identified 233 down-regulated and 38 upregulated proteins in MTA-treated KKU-213A cells when compared to the untreated controls (Fig 6A and S1 Table). In this study, we focused on the down-regulated protein populations because we aimed to identify the cancer-related pathways and potential target proteins that are inhibited by MTA treatment. Therefore, 233 down-regulated proteins were further analyzed.

Fig 5 — (A) An illustration of the proteomic experimental workflow. (B) A Venn diagram showing the proteins identified in KKU-213A control and MTA treatment.

Fig 6 — (A) Heatmap depicting proteins downregulated by at least 2-fold after MTA treatment. (B) Downregulated proteins after MTA treatment in KKU-213A categorized by Gene Ontology in terms of Molecular Function, (C) Biological Processes, (D) Cellular Component, and (E) Protein Class.

Network analysis and functional enrichment analysis of down-regulated proteins

In our pursuit of a comprehensive understanding of proteomic changes induced by MTA treatment, we subjected the list of down-regulated proteins obtained from proteomic data to Gene Ontology (GO) analysis using the PANTHER (Protein Analysis Through Evolutionary Relationships) web portal. This allowed us to categorize the proteins based on their molecular function, biological process, cellular component, protein class, and pathway. The molecular function ontology highlighted primary protein functions, such as binding and transcription regulator activities, followed by additional functions, including transporter, molecular transducer, and molecular function regulator activity (Fig 6B). Among the down-regulated proteins, when categorized under biological processes, the largest fraction belonged to cellular processes, with other significant groups including biological regulation and metabolic processes (Fig 6C). Regarding cellular components, the down-regulated proteins were categorized into two main groups: cellular anatomical entities and protein-containing complexes (Fig 6D). The protein class ontology indicated that the majority of proteins belonged to the protein modifying enzyme class, followed by scaffold/adaptor proteins and gene-specific transcriptional regulator proteins (Fig 6E).

Next, we conducted further analysis of the down-regulated proteins to unveil protein networks. We identified four main interaction networks that visually represent the correlations between enriched pathways. Connections between two nodes were established when they share a minimum of 20% of gene numbers. Nodes with a darker shade indicate more significantly enriched gene sets, while larger nodes represent larger gene sets. Thicker lines signify a higher number of overlapping genes. In our network analysis of cellular components, we found that MTA treatment had a notable impact on proteins involved in the mitochondrial membrane (Fig 7A). Additionally, we identified three major networks related to cellular processes. These networks encompassed proteins associated with energy derivation, such as those involved in the electron transport chain, oxidative phosphorylation, ATP synthesis coupled electron transport, and the generation of precursor metabolites and energy, all of which were reduced after MTA treatment (Fig 7B). Furthermore, MTA treatment affected the protein trafficking network (Fig 7C), including processes such as vesicle-mediated transport, macromolecule localization, and lipid transport. Finally, proteins associated with changes in cell morphology were down-regulated, including those involved in cytoskeleton organization, cellular component morphogenesis, and cell projection organization (Fig 7D).

Fig 7 — Four protein networks of downregulated proteins were identified. The largest component of downregulated proteins was identified in the mitochondrial membrane (A). The major networks of cellular processes involved in energy derivation of the cell (B), protein trafficking (C), and cell morphology change (D).

mRNA expression of six candidate genes identified in proteomics study

Based on the proteomics analysis, a set of candidate proteins were selected from the top 10 most down-regulated protein after MTA treatment. To validate these findings, we conducted RT-qPCR analysis and confirmed the decreased expression of 6 genes including ZNF860, KLC1, GRAMD1C, MAMSTR, TANC1, and TTC13. Remarkably, these genes displayed significantly reduced mRNA levels upon treatment with MTA (25 ug/mL) in both KKU-213A and KKU-213B cell lines (Fig 8A and 8B).

Fig 8 — mRNA expression of six candidate genes was verified through RT-qPCR comparing between control and MTA-treated cells in KKU-213A (A) and KKU-213B (B). Significant differences between treated and untreated controls are indicated by *p< 0.05, **p < 0.01, and ***p<0.001. (C) KLC1 protein expression was verified in MTA-treated and untreated KKU-213A and KKU-213B cell lines. (D) KLC1 mRNA expression in CCA patients’ samples comparing between tumor and normal adjacent tissues, analyzed via the GEPIA2 web portal based on TCGA data.

KLC1 protein expression in MTA-treated cells and its mRNA expression in CCA patients’ tissue

Further analysis was conducted to validate the expression of KLC1 at the protein level in MTA-treated cells and its mRNA expression in patients’ tissues based on TCGA data. Western blot results confirmed that KLC1 protein was indeed down-regulated in both CCA cell lines (KKU-213A and KKU-213B) following treatment with MTA compared to the untreated control (Fig 8C). Additionally, analyzing KLC1 mRNA expression in CCA patients’ samples on the GEPIA2 web portal, the results showed that KLC1 was highly expressed in CCA tissues while expressed at a low level in normal bile duct tissues (Fig 8D).

Discussion

In our current study, we assessed the effect of MTA on KKU-213A, KKU-213B, and their respective drug-resistant cell lines. Our data demonstrated that MTA treatment exerts a significant anticancer effect by inhibiting cell proliferation, migration, invasion, and inducing apoptosis in CCA cells. Notably, MTA treatment also augmented the anticancer efficacy of gemcitabine in drug-resistant cells. The results from proteomics analysis revealed that MTA effectively inhibited various proteins that have oncogenic properties, corroborating earlier findings.

Gemcitabine is one of the first-line treatments for advanced CCA; however, clinical studies have shown that the overall survival and progression-free survival of patients receiving gemcitabine are still low [23]. Furthermore, a large number of patients experience relapse after receiving first-line chemotherapy, and the formidable side effects associated with these treatments contribute to suboptimal outcomes [24]. Consequently, we have been exploring naturally occurring agents with low toxicity toward normal cells, either for use as a single agent or combined with chemotherapeutic drugs to reduce the required chemotherapy dosage.

MTA, a compound known for some time, has recently garnered significant attention in the field of cancer research [25–27]. A number of studies have reported the effect of MTA on cancer cell viability, spanning various cancer types, such as melanoma, colorectal cancer, lymphoma, and erythroleukemia [11,28–31]. Notably, Tomasi and colleagues have identified MTA as a potential therapeutic agent against colorectal cancer, with minimal observed effects on normal cells [11]. Concomitantly, we found that MTA had a more profound effect on KKU-213A and KKU-213B in comparison to MMNK-1. The stronger impact on cancer cells may be attributed to the deficiency of 5-methylthioadenosine phosphorylase (MTAP), a key enzyme in the methionine salvage pathway (Fig 1B), which is also notably absent in most cancers [10,12–14,32]. This deficiency leads to an abnormal adenine salvage pathway and the accumulation of unmetabolized MTA, resulting in cellular toxicity [9,33]. Interestingly, MTA also suppress cell viability in both gemcitabine resistant cell lines, KKU-213A-GR and KKU-213B-GR. The result show that when treated with MTA alone these cells were more sensitive to MTA than the parental cells (Fig 2E and 2F). Moreover, the combination of MTA and gemcitabine exhibited a more pronounced inhibitory effect on KKU-213A-GR and KKU-213B-GR than either agent alone (Fig 2E and 2F), suggesting that these two agents may have distinct downstream targets that complement each other in terms of cancer cell suppression. The previous research has studied the effect of MTA in combination with purine analogues such as 2’-fluoroadenine (2FA) in MTAP-deficient cancers. the result revealed that MTA combined with 2FA is more effective than 2FA alone [34]. In addition, another study showed that MTA used in combination with 5-FU enhances the anticancer activity of 5-FU [12]. This study is the first to present the impact of MTA on gemcitabine-resistant CCA cells when use singly or in combination with gemcitabine. Accordingly, MTA could potentially serve as a therapeutic solution against drug-resistant CCA in the future.

A primary goal of cancer treatment is to reduce the tumor burden and prevent the metastasis of cancer cells to distant organs, thereby prolonging patient survival. The treatment of late-stage tumors has traditionally relied on conventional chemotherapy and radiotherapy, which are known to be accompanied by significant and often debilitating side effects. Consequently, there has been a growing demand for novel therapeutic strategies capable of suppressing tumor metastasis with minimal side effects. Our study has revealed that MTA not only curtails the growth and induces apoptosis of CCA cells but, notably, it can also inhibit the invasion and migration of CCA cells at relatively lower concentrations. These findings are consistent with similar results observed in melanoma and hepatocellular carcinoma [29,35]. Furthermore, our proteomic analysis substantiates MTA’s anticancer activity. Protein network analysis results suggest that MTA treatment leads to the reduction of proteins associated with changes in cell morphology, specifically those involved in cytoskeleton organization and the regulation of microtubule organization (Fig 7C). These morphological changes play a pivotal role in cancer cell migration and metastasis [36]. Collectively, our findings support the notion that MTA possesses the potential to suppress the invasion and migration capabilities of CCA cell lines.

Apoptosis, a self-regulated programmed cell death process, hinges on the activation, expression, and regulation of a multitude of proteins. Clinically, inducing cellular apoptosis represents a critical mechanism by which chemotherapeutic drugs control tumor progression [37]. Prior research has reported MTA’s ability to induce apoptosis in various cancer cell lines, including HepG2, RKO, SW620, and U937 [11,38–40]. In our study, we further revealed that MTA could induce apoptosis of KKU-213A and KKU-213B in a dose-dependent fashion (Fig 3). Several pivotal events in the process of programmed cell death revolve around the mitochondria, encompassing the release of caspase activators [41], modifications in electron transport [42], loss of mitochondrial transmembrane potential [43], alterations in cellular oxidation-reduction processes [44], and the involvement of pro- and anti-apoptotic proteins [45]. Additionally, our network analysis, focusing on cellular components and biological processes, illustrates that down-regulated proteins are primarily implicated in mitochondrial function, encompassing the mitochondrial envelope, respiratory chain complex, inner mitochondrial membrane complex, respiratory electron transport chain, and also oxidative phosphorylation (Fig 7A and 7B).

Kinesin Light Chain 1 (KLC1) was initially identified as down-regulated in proteomics analysis and subsequently confirmed to be suppressed at both mRNA and protein levels following MTA treatments (Fig 8A–8C). Additionally, in the protein network analysis, KLC1 was found to be involved in cell morphology changes (Fig 7D). Furthermore, it exhibited elevated expression levels in tumor tissues compared to normal tissues in CCA patients (Fig 8D). Conventionally, kinesin comprises two heavy chains and two light chains, forming a tetrameric structure. It facilitates the transport of various cargos towards the plus ends of microtubules, with the heavy chains providing motor activity and the light chains binding to different cargos, thus functioning as adapter molecules. KLC1 has been implicated in various cancer types by interacting with other proteins. For instance, ALK-KLC1 binding is associated with the metastasis and drug resistance of lung cancer [46–49]. In glioma, the fusion of KLC1 with ROS1 activates the JAK-STAT pathway [50,51]. KLC1 has also been found to interact with KIF5B, regulating cell-cell adhesion [52], and epithelial-mesenchymal plasticity in breast cancer [53]. Furthermore, KLC1 plays a role in the MAPK kinase pathway. However, the expression of KLC1 and its associated cargo in CCA has not yet been studied. This discovery suggests that MTA treatment suppresses KLC1 expression in CCA. Further detailed studies are encouraged to fully understand the implications of MTA and the role of KLC1 as a potential therapeutic target in CCA.

In conclusion, our findings strongly support the utility of MTA as an effective treatment option for advanced CCA. This is underscored by its ability to suppress the growth of CCA cells, curtail migration and invasion, and induce apoptosis, all while minimizing harm to normal cells. Additionally, MTA’s synergistic impact with gemcitabine on drug-resistant cells further accentuates its therapeutic potential. Our proteomic analysis delves into the underlying mechanisms governing MTA’s anticancer activity, with a particular emphasis on its ability to influence oncogenic proteins and modulate cellular morphology, and induce apoptosis through mitochondrial pathways. Collectively, our results endorse MTA as a promising strategy for advanced CCA treatment, effectively addressing concerns surrounding chemotherapy-induced side effects and potentially leading to improved patient outcomes.

Supporting information

S1 Table. Differentially expressed proteins in KKU-213A after MTA treatment.

(DOCX)

pone.0306060.s001.docx^{(86.2KB, docx)}

S1 Raw data. Raw data of cell viability, cell growth, drug-sensitivity assay, apoptosis assay, scratch assay, migration and invasion assays, RT-qPCR of MTAP and six candidate genes.

(XLSX)

pone.0306060.s002.xlsx^{(70.7KB, xlsx)}

S1 Raw images. Original blot images used for the generation of Fig 8C.

MS proteomics data. https://repository.jpostdb.org/entry/JPST002497; (PXID: PXD049119).

(PDF)

pone.0306060.s003.pdf^{(877.8KB, pdf)}

Acknowledgments

The authors acknowledge the resources provided by the Central Equipment Center, Faculty of Science, Prince of Songkla University, specifically for the fluorescence microscope (cellSens Standard software, Olympus IX73 inverted microscope). The authors would also like to express gratitude to Miss Kawinnath Songsurin for her contribution to establishing the gemcitabine-resistant cell lines, KKU-213A-GR, and KKU-213B-GR.

Data Availability

All relevant data are within the paper and its Supporting information files. The MS proteomics data from this research have been deposited in the ProteomeXchange Consortium (http://www.proteomexchange.org/) through the jPOSTrepo partner (https://repository.jpostdb.org/entry/JPST002497), with dataset identifier PXD049119.

Funding Statement

This research was supported by the National Science, Research and Innovation Fund (NSRF) and Prince of Songkla University (Ref. No. SCI6701024S) to Sumalee Obchoei. Kankamol Kerdkumthong was supported by a Prince of Songkla University-Ph.D. Scholarship (PSU_PHD2561-001). Phonprapavee Tantimetta was supported by a Prince of Songkla University-Ph.D. Scholarship (PSU_PHD2565-002). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Khan SA, Thomas HC, Davidson BR, Taylor-Robinson SD. Cholangiocarcinoma. The Lancet. 2005;366(9493):1303–14. [DOI] [PubMed] [Google Scholar]
2.Banales JM, Marin JJ, Lamarca A, Rodrigues PM, Khan SA, Roberts LR, et al. Cholangiocarcinoma 2020: the next horizon in mechanisms and management. Nat Rev Gastroenterol Hepatol. 2020;17(9):557–88. doi: 10.1038/s41575-020-0310-z [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Beghdadi N, Lim C, Aron-Wisnewsky J, Torcivia A, Goumard C, Turco C, et al. Cholangiocarcinoma Following Bariatric Surgery: a Prospective Follow-Up Single-Center Audit. Obes Surg. 2020;30(9):3590–4. [DOI] [PubMed] [Google Scholar]
4.Massarweh NN, El-Serag HB. Epidemiology of hepatocellular carcinoma and intrahepatic cholangiocarcinoma. Cancer Control. 2017;24(3):1073274817729245. doi: 10.1177/1073274817729245 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Saha SK, Zhu AX, Fuchs CS, Brooks GA. Forty-year trends in cholangiocarcinoma incidence in the US: intrahepatic disease on the rise. Oncologist. 2016;21(5):594–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Braconi C, Patel T. Cholangiocarcinoma: new insights into disease pathogenesis and biology. Infect Dis Clin North Am. 2010;24(4):871–84. doi: 10.1016/j.idc.2010.07.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Isa T, Kusano T, Shimoji H, Takeshima Y, Muto Y, Furukawa M. Predictive factors for long-term survival in patients with intrahepatic cholangiocarcinoma. Am J Surg. 2001;181(6):507–11. doi: 10.1016/s0002-9610(01)00628-6 [DOI] [PubMed] [Google Scholar]
8.Pegg AE, Jones DB, Secrist JA III. Effect of inhibitors of S-adenosylmethionine decarboxylase on polyamine content and growth of L1210 cells. Biochemistry. 1988;27(5):1408–15. doi: 10.1021/bi00405a003 [DOI] [PubMed] [Google Scholar]
9.Williams-Ashman HG, Seidenfeld J, Galletti P. Trends in the biochemical pharmacology of 5’-deoxy-5’-methylthioadenosine. Biochem Pharmacol. 1982;31(3):277–88. doi: 10.1016/0006-2952(82)90171-x [DOI] [PubMed] [Google Scholar]
10.Tang B, Kadariya Y, Chen Y, Slifker M, Kruger WD. Expression of MTAP inhibits tumor-related phenotypes in HT1080 cells via a mechanism unrelated to its enzymatic function. G3-genes genom genet. 2015;5(1):35–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Tomasi ML, Cossu C, Spissu Y, Floris A, Ryoo M, Iglesias-Ara A, et al. S-adenosylmethionine and methylthioadenosine inhibit cancer metastasis by targeting microRNA 34a/b-methionine adenosyltransferase 2A/2B axis. Oncotarget. 2017;8(45):78851–69. doi: 10.18632/oncotarget.20234 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Bertino JR, Waud WR, Parker WB, Lubin M. Targeting tumors that lack methylthioadenosine phosphorylase (MTAP) activity: current strategies. Cancer Biol Ther. 2011;11(7):627–32. doi: 10.4161/cbt.11.7.14948 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Alhalabi O, Chen J, Zhang Y, Lu Y, Wang Q, Ramachandran S, et al. MTAP deficiency creates an exploitable target for antifolate therapy in 9p21-loss cancers. Nat Commun. 2022;13(1):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Alhalabi O, Zhu Y, Hamza A, Qiao W, Lin Y, Wang RM, et al. Integrative clinical and genomic characterization of MTAP-deficient metastatic urothelial cancer. Eur Urol Oncol. 2023;6(2):228–32. doi: 10.1016/j.euo.2021.10.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Sripa B, Seubwai W, Vaeteewoottacharn K, Sawanyawisuth K, Silsirivanit A, Kaewkong W, et al. Functional and genetic characterization of three cell lines derived from a single tumor of an Opisthorchis viverrini-associated cholangiocarcinoma patient. Human cell. 2020;33:695–708. doi: 10.1007/s13577-020-00334-w [DOI] [PubMed] [Google Scholar]
16.Maruyama M, Kobayashi N, Westerman KA, Sakaguchi M, Allain JE, Totsugawa T, et al. Establishment of a highly differentiated immortalized human cholangiocyte cell line with SV40T and hTERT. Transplantation. 2004;77(3):446–51. doi: 10.1097/01.TP.0000110292.73873.25 [DOI] [PubMed] [Google Scholar]
17.Kerdkumthong K, Chanket W, Runsaeng P, Nanarong S, Songsurin K, Tantimetta P, et al. Two Recombinant Bacteriocins, Rhamnosin and Lysostaphin, Show Synergistic Anticancer Activity Against Gemcitabine-Resistant Cholangiocarcinoma Cell Lines. Probiotics Antimicro. 2023:1–13. doi: 10.1007/s12602-023-10096-0 [DOI] [PubMed] [Google Scholar]
18.Johansson C, Samskog J, Sundström L, Wadensten H, Björkesten L, Flensburg J. Differential expression analysis of Escherichia coli proteins using a novel software for relative quantitation of LC‐MS/MS data. Proteomics. 2006;6(16):4475–85. doi: 10.1002/pmic.200500921 [DOI] [PubMed] [Google Scholar]
19.Thorsell A, Portelius E, Blennow K, Westman‐Brinkmalm A. Evaluation of sample fractionation using micro‐scale liquid‐phase isoelectric focusing on mass spectrometric identification and quantitation of proteins in a SILAC experiment. Rapid Commun Spectrom. 2007;21(5):771–8. [DOI] [PubMed] [Google Scholar]
20.Howe EA, Sinha R, Schlauch D, Quackenbush J. RNA-Seq analysis in MeV. Bioinformatics. 2011;27(22):3209–10. doi: 10.1093/bioinformatics/btr490 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Mi H, Muruganujan A, Ebert D, Huang X, Thomas PD. PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res. 2019;47(D1):D419–D26. doi: 10.1093/nar/gky1038 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Ge SX, Jung D, Yao R. ShinyGO: a graphical gene-set enrichment tool for animals and plants. Bioinformatics. 2020;36(8):2628–9. doi: 10.1093/bioinformatics/btz931 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Rogers JE, Law L, Nguyen VD, Qiao W, Javle MM, Kaseb A, et al. Second-line systemic treatment for advanced cholangiocarcinoma. J Gastrointest Oncol. 2014;5(6):408. doi: 10.3978/j.issn.2078-6891.2014.072 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Razumilava N, Gores GJ. Cholangiocarcinoma. The Lancet. 2014;383(9935):2168–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Li Y, Wang Y, Wu P. 5’-Methylthioadenosine and Cancer: old molecules, new understanding. J Cancer. 2019;10(4):927–36. doi: 10.7150/jca.27160 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Stevens AP, Dettmer K, Kirovski G, Samejima K, Hellerbrand C, Bosserhoff AK, et al. Quantification of intermediates of the methionine and polyamine metabolism by liquid chromatography–tandem mass spectrometry in cultured tumor cells and liver biopsies. J Chromatogr A. 2010;1217(19):3282–8. doi: 10.1016/j.chroma.2010.01.025 [DOI] [PubMed] [Google Scholar]
27.Henrich FC, Singer K, Poller K, Bernhardt L, Strobl CD, Limm K, et al. Suppressive effects of tumor cell-derived 5′-deoxy-5′-methylthioadenosine on human T cells. Oncoimmunology. 2016;5(8):e1184802. doi: 10.1080/2162402X.2016.1184802 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.de Ferra F, Baglioni C. Correlation between growth inhibition and presence of 5’-methylthioadenosine in cells treated with interferon. Cancer Res. 1984;44(6):2297–301. [PubMed] [Google Scholar]
29.Shafman TD, Sherman ML, Kufe DW. Effect of 5’-methylthioadenosine on induction of murine erythroleukemia cell differentiation. Biochem Biophys Res Commun. 1984;124(1):172–7. doi: 10.1016/0006-291x(84)90932-x [DOI] [PubMed] [Google Scholar]
30.Wolford RW, MacDonald MR, Zehfus B, Rogers TJ, Ferro AJ. Effect of 5’’-methylthioadenosine and its analogs on murine lymphoid cell proliferation. Cancer Res. 1981;41(8):3035–9. [PubMed] [Google Scholar]
31.Andreu-Pérez P, Hernandez-Losa J, Moliné T, Gil R, Grueso J, Pujol A, et al. Methylthioadenosine (MTA) inhibits melanoma cell proliferation and in vivo tumor growth. BMC cancer. 2010;10:1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Collins CC, Volik SV, Lapuk AV, Wang Y, Gout PW, Wu C, et al. Next Generation Sequencing of Prostate Cancer from a Patient Identifies a Deficiency of Methylthioadenosine Phosphorylase, an Exploitable Tumor TargetNGS-Guided Personalized Therapy for MTAP-Deficient PCa. Mol Cancer Ther. 2012;11(3):775–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Nobori T, Takabayashi K, Tran P, Orvis L, Batova A, Yu AL, et al. Genomic cloning of methylthioadenosine phosphorylase: a purine metabolic enzyme deficient in multiple different cancers. Proc Natl Acad Sci USA. 1996;93(12):6203–8. doi: 10.1073/pnas.93.12.6203 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Tang B, Lee H-O, An SS, Cai KQ, Kruger WD. Specific targeting of MTAP-deleted tumors with a combination of 2′-fluoroadenine and 5′-methylthioadenosine. Cancer Res. 2018;78(15):4386–95. doi: 10.1158/0008-5472.CAN-18-0814 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Vandenbark AA, Ferro AJ, Barney CL. Inhibition of lymphocyte transformation by a naturally occurring metabolite: 5’-methylthioadenosine. Cell Immunol. 1980;49(1):26–33. doi: 10.1016/0008-8749(80)90052-0 [DOI] [PubMed] [Google Scholar]
36.Conner SJ, Guarin JR, Le TT, Fatherree JP, Kelley CA, Payne SL, et al. Cell morphology best predicts tumorigenicity and metastasis in vivo across multiple TNBC cell lines of different metastatic potential. BioRxiv. 2023:2023.06. 14.544969. doi: 10.1101/2023.06.14.544969 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Fuchs Y, Steller H. Live to die another way: modes of programmed cell death and the signals emanating from dying cells. Nat Rev Mol Cell Biol. 2015;16(6):329–44. doi: 10.1038/nrm3999 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Lee SH, Cho YD. Induction of apoptosis in leukemia U937 cells by 5’-deoxy-5’-methylthioadenosine, a potent inhibitor of protein carboxylmethyltransferase. Exp Cell Res. 1998;240(2):282–92. doi: 10.1006/excr.1998.4000 [DOI] [PubMed] [Google Scholar]
39.Li TW, Zhang Q, Oh P, Xia M, Chen H, Bemanian S, et al. S-Adenosylmethionine and methylthioadenosine inhibit cellular FLICE inhibitory protein expression and induce apoptosis in colon cancer cells. Mol Pharmacol. 2009;76(1):192–200. doi: 10.1124/mol.108.054411 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Yang H, Sadda MR, Li M, Zeng Y, Chen L, Bae W, et al. S-adenosylmethionine and its metabolite induce apoptosis in HepG2 cells: Role of protein phosphatase 1 and Bcl-x(S). Hepatol. 2004;40(1):221–31. doi: 10.1002/hep.20274 [DOI] [PubMed] [Google Scholar]
41.Sahoo G, Samal D, Khandayataray P, Murthy MK. A Review on Caspases: Key Regulators of Biological Activities and Apoptosis. Mol Neurobiol. 2023:1–33. doi: 10.1007/s12035-023-03433-5 [DOI] [PubMed] [Google Scholar]
42.Kalpage HA, Bazylianska V, Recanati MA, Fite A, Liu J, Wan J, et al. Tissue-specific regulation of cytochrome c by post-translational modifications: respiration, the mitochondrial membrane potential, ROS, and apoptosis. The FASEB J. 2019;33(2):1540. doi: 10.1096/fj.201801417R [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Ly JD, Grubb DR, Lawen A. The mitochondrial membrane potential (Δψ m) in apoptosis; an update. Apoptosis. 2003;8:115–28. [DOI] [PubMed] [Google Scholar]
44.Jones DP. Redox sensing: orthogonal control in cell cycle and apoptosis signalling. J Intern Med. 2010;268(5):432–48. doi: 10.1111/j.1365-2796.2010.02268.x [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Czabotar PE, Lessene G, Strasser A, Adams JM. Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy. Nat Rev Mol Cell biol. 2014;15(1):49–63. doi: 10.1038/nrm3722 [DOI] [PubMed] [Google Scholar]
46.Du X, Shao Y, Qin HF, Tai YH, Gao HJ. ALK‐rearrangement in non‐small‐cell lung cancer (NSCLC). Thorac. Cancer. 2018;9(4):423–30. doi: 10.1111/1759-7714.12613 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Togashi Y, Soda M, Sakata S, Sugawara E, Hatano S, Asaka R, et al. KLC1-ALK: a novel fusion in lung cancer identified using a formalin-fixed paraffin-embedded tissue only. PloS one. 2012;7(2):e31323. doi: 10.1371/journal.pone.0031323 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Wang P, Xiao P, Ye Y, Liu P, Han L, Dong L, et al. Rapid response of brain metastasis to crizotinib in a patient with KLC1-ALK fusion and MET gene amplification positive non-small cell lung cancer: a case report. Mol. Cancer Biol. 2017;14(2):183. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Dietz S, Christopoulos P, Gu L, Volckmar A-L, Endris V, Yuan Z, et al. Serial liquid biopsies for detection of treatment failure and profiling of resistance mechanisms in KLC1–ALK-rearranged lung cancer. Mol. Case Stud. 2019;5(6):a004630. doi: 10.1101/mcs.a004630 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Fujii T, Nakano Y, Hagita D, Onishi N, Endo A, Nakagawa M, et al. KLC1-ROS1 Fusion Exerts Oncogenic Properties of Glioma Cells via Specific Activation of JAK-STAT Pathway. Cancers. 2023;16(1):9. doi: 10.3390/cancers16010009 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Nakano Y, Tomiyama A, Kohno T, Yoshida A, Yamasaki K, Ozawa T, et al. Identification of a novel KLC1–ROS1 fusion in a case of pediatric low-grade localized glioma. Brain Tumor Pathol. 2019;36:14–9. doi: 10.1007/s10014-018-0330-3 [DOI] [PubMed] [Google Scholar]
52.Sehgal L, Mukhopadhyay A, Rajan A, Khapare N, Sawant M, Vishal SS, et al. 14-3-3γ-Mediated transport of plakoglobin to the cell border is required for the initiation of desmosome assembly in vitro and in vivo. J Cell Sci. 2014;127(10):2174–88. [DOI] [PubMed] [Google Scholar]
53.Moamer A, Hachim IY, Binothman N, Wang N, Lebrun J-J, Ali S. A role for kinesin-1 subunits KIF5B/KLC1 in regulating epithelial mesenchymal plasticity in breast tumorigenesis. EBioMedicine. 2019;45:92–107. doi: 10.1016/j.ebiom.2019.06.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0306060.r001

Decision Letter 0

Matias A Avila

27 Mar 2024

PONE-D-24-06933Quantitative proteomics analysis reveals possible anticancer mechanisms of 5'-deoxy-5'-methylthioadenosine in cholangiocarcinoma cellsPLOS ONE

Dear Dr. Obchoei,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that fully addresses the points raised by the reviewer.

Please submit your revised manuscript by May 11 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Matias A Avila, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure:

"This research was supported by the National Science, Research and Innovation Fund (NSRF) and Prince of Songkla University (Ref. No. SCI6701024S) to Sumalee Obchoei. Kankamol Kerdkumthong was supported by a Prince of Songkla University-Ph.D. Scholarship (PSU_PHD2561-001). Phonprapavee Tantimetta was supported by a Prince of Songkla University-Ph.D. Scholarship (PSU_PHD2565-002)."

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"The authors acknowledge the resources and support provided by the Central Equipment Center, Faculty of Science, Prince of Songkla University, specifically for the fluorescence microscope (cellSens Standard software, Olympus IX73 inverted microscope). The authors would also like to express gratitude to Miss Kawinnath Songsurin for her contribution to establishing the gemcitabine-resistant cell lines, KKU-213A-GR, and KKU-213B-GR."

Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript.

4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: I have carefully reviewed your manuscript on the anticancer activity of 5'-deoxy-5'-methylthioadenosine (MTA) in cholangiocarcinoma cell lines, focusing on the proteomic insights provided. Strengths of your paper include the thorough exploration of MTA's impact on cell viability, apoptosis, migration, and invasion in cholangiocarcinoma cell lines. To further enhance the robustness and impact of your study, I recommend considering the following points:

1.The expression of MTAP in MMNK and KKU-213A-B cell lines should be evaluated, as never has been published before. Regarding to this point, the reference you cite about the establishment of these cell lines is wrong (number #12). The correct one is the following: PMID: 32207095

2. You need to validate by western blot analysis the most representative genes associated with the pathways and processes identified in the proteomic study particularly concerning the biological effects of MTA on apoptosis, growth, viability, invasion, and migration of the cells you show. This validation approach will not only strengthen the findings of the study but also offer a deeper understanding of how these genes contribute to the cellular responses induced by MTA treatment.

3. Why did you choose KKU-213A for proteomic analysis? Which are the main differences between KKU-213A and KKU-213B cell lines?

4. The results in gemcitabine-resistant cell line experiments do not add any value to the work if they are not properly validated or discussed, so they need to be better discussed or otherwise removed from the manuscript.

Minor concerns:

1. Legend of figure 2: *p<0.05…etc statistical significances is it supposed to be between MTA and control-treated cells at every time-points? Please, write it properly.

2. The reference about gemcitabine resistant cells (Kerdkumthong et al, 2023) is not listed in the Bibliography section. Please, include it.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Jun 26;19(6):e0306060. doi: 10.1371/journal.pone.0306060.r002

Author response to Decision Letter 0

16 May 2024

PONE-D-24-06933

Quantitative proteomics analysis reveals possible anticancer mechanisms of 5'-deoxy-5'-methylthioadenosine in cholangiocarcinoma cells

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at…

Response: Thank you for providing us with the additional requirements for the revision of our manuscript. We have carefully reviewed your instructions and will ensure that all necessary adjustments are made to meet PLOS ONE's style and submission guidelines.

We will format our manuscript according to PLOS ONE's style requirements, including those for file naming. We have downloaded the PLOS ONE style templates from the provided links and will use them to format our manuscript appropriately.

2. Thank you for stating the following financial disclosure:

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

Response: Thank you for your suggestion. In this study, the funders had none of the mentioned roles, and we have stated this in the financial disclosure and included it in the cover letter. We thank you in advance for the changes you will make in the online submission form on our behalf.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

Please remove any funding-related text from the manuscript.

Response: We have removed funding-related text from the Acknowledgments section of our manuscript as per your guidelines. We will only include acknowledgments for resources provided by the Central Equipment Center, Faculty of Science, Prince of Songkla University, and the contribution of Miss Kawinnath Songsurin in establishing the gemcitabine-resistant cell lines, KKU-213A-GR, and KKU-213B-GR.

Response: Captions for our Supporting Information files have been included at the end of our manuscript, and we have updated in-text citations to match accordingly. We adhered to PLOS ONE's Supporting Information guidelines to ensure proper formatting and presentation.

We appreciate your guidance in ensuring that our manuscript meets the journal's requirements. If you require any further clarification or have additional instructions, please do not hesitate to let us know.

Review Comments to the Author

Response: We thank the reviewer for your thorough review of our manuscript. We truly appreciate your constructive feedback and have carefully considered each of your points.

Response: We apologize for the incorrect reference citation. We have replaced the correct reference (PMID: 32207095) in our manuscript (ref no. 15, page 5, line 96 and bibliography no. 15, page 27, line 566-571). As per the reviewer’s advice, we acknowledge the importance of evaluating MTAP expression in these cell lines. We have measured the expression of MTAP in MMNK-1, KKU-213A, and KKU-213B cell lines as shown in Fig. 1B (page 4, line 85-86) and explained in the text in the Results section, pages 12-13, lines 253-257. The MTAP primer and internal control gene primer sequences are listed in table 1 (page 11, line 227). The RT-qPCR protocol was added in Material and method under the ‘RT-qPCR’ subsection (page 10-11, lines 216-225).

Response: We agree with the reviewer that validating proteomic findings is essential for strengthening the robustness of our study. Firstly, we selected a set of genes (6 genes) from the top 10 most down-regulated proteins from proteomics results, then verified them by RT-qPCR. The results are shown in Figs 8A and 8B (page 20, lines 423-425). In addition, we selected KLC1 for further verification via Western blot analysis for three reasons: 1. KLC1 mRNA was strongly down-regulated in both KKU-213A and KKU-213B after MTA treatment, 2. KLC1 mRNA was upregulated in CCA patients’ tissues compared with normal adjacent tissues based on TCGA data, suggesting its possible significant role in CCA, and 3. The verified antibody against KLC1 is available in the market. The Western blot results of the protein expression of KLC1 in MTA treated cells compared to the control are shown in Fig. 8C (page 20, lines 426-427). The protocol and antibodies used were stated in Material and method under the ‘Western blotting’ subsection (page 11-12, lines 229-240).

3. Why did you choose KKU-213A for proteomic analysis? Which are the main differences between KKU-213A and KKU-213B cell lines?

Response: Thank you for the question. KKU-213A and KKU-213B are both established from the tissue of the same patient (a Thai patient with intrahepatic cholangiocarcinoma), and these cell lines are widely used in the CCA research community. The tumor of origin of these cell lines was adenosquamous carcinoma. The major differences between these cell lines are distinct cell morphology, cytogenetic characteristics, and progressive phenotypes. In addition, when injected into the mice, KKU-213A formed poorly differentiated squamous cell carcinomas, while KKU-213B formed well-differentiated squamous cell carcinomas. We chose KKU-213A for proteomics analysis because the observed MTA effect on cell growth and apoptosis was stronger in KKU-213A compared to KKU-213B. However, the later verification of candidate gene expression was done in both cell lines.

Response: We thank the reviewer for the valuable comment. We understand your concern regarding the gemcitabine-resistant cell line experiments and agree that they need to be better validated or discussed to add value to the manuscript. The reason we investigated the effect of MTA on gemcitabine-resistant CCA cell lines was because drug resistance is one of the major challenges for CCA treatment. We also would like to emphasize that, in the future, MTA may be developed as a treatment option to combat drug-resistant CCA. As per the reviewer's advice, we have discussed this matter in the Discussion section (page 22, lines 455-467).

Minor concerns:

1. Legend of figure 2: *p<0.05…etc statistical significances is it supposed to be between MTA and control-treated cells at every time-points? Please, write it properly.

2. The reference about gemcitabine resistant cells (Kerdkumthong et al, 2023) is not listed in the Bibliography section. Please, include it.

Response: 1. Thank you for your comment. As per the reviewer's suggestion, we have fixed the legend of Figure 2 for clarification (page 14, lines 267-287).

Response: 2. Thank you for your comment. We apologize for the oversight, and we have included the reference (Kerdkumthong et al, 2023) in the Bibliography section of our manuscript (ref no. 17, page 5, line 100 and bibliography no. 17, page 27, lines 572-575).

Once again, we sincerely appreciate your valuable feedback, which will undoubtedly improve the quality and impact of our study.

Attachment

Submitted filename: Response to Reviewers.docx

pone.0306060.s004.docx^{(20.7KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0306060.r003

Decision Letter 1

Matias A Avila

11 Jun 2024

Quantitative proteomics analysis reveals possible anticancer mechanisms of 5'-deoxy-5'-methylthioadenosine in cholangiocarcinoma cells

PONE-D-24-06933R1

Dear Dr. Obchoei,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Matias A Avila, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: I am pleased to inform you that your manuscript has met all the requirements and addressed the reviewers' comments satisfactorily.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

**********

PLoS One. doi: 10.1371/journal.pone.0306060.r004

Acceptance letter

Matias A Avila

18 Jun 2024

PONE-D-24-06933R1

PLOS ONE

Dear Dr. Obchoei,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Matias A Avila

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Differentially expressed proteins in KKU-213A after MTA treatment.

(DOCX)

pone.0306060.s001.docx^{(86.2KB, docx)}

S1 Raw data. Raw data of cell viability, cell growth, drug-sensitivity assay, apoptosis assay, scratch assay, migration and invasion assays, RT-qPCR of MTAP and six candidate genes.

(XLSX)

pone.0306060.s002.xlsx^{(70.7KB, xlsx)}

S1 Raw images. Original blot images used for the generation of Fig 8C.

MS proteomics data. https://repository.jpostdb.org/entry/JPST002497; (PXID: PXD049119).

(PDF)

pone.0306060.s003.pdf^{(877.8KB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0306060.s004.docx^{(20.7KB, docx)}

Data Availability Statement

[pone.0306060.ref001] 1.Khan SA, Thomas HC, Davidson BR, Taylor-Robinson SD. Cholangiocarcinoma. The Lancet. 2005;366(9493):1303–14. [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref002] 2.Banales JM, Marin JJ, Lamarca A, Rodrigues PM, Khan SA, Roberts LR, et al. Cholangiocarcinoma 2020: the next horizon in mechanisms and management. Nat Rev Gastroenterol Hepatol. 2020;17(9):557–88. doi: 10.1038/s41575-020-0310-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref003] 3.Beghdadi N, Lim C, Aron-Wisnewsky J, Torcivia A, Goumard C, Turco C, et al. Cholangiocarcinoma Following Bariatric Surgery: a Prospective Follow-Up Single-Center Audit. Obes Surg. 2020;30(9):3590–4. [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref004] 4.Massarweh NN, El-Serag HB. Epidemiology of hepatocellular carcinoma and intrahepatic cholangiocarcinoma. Cancer Control. 2017;24(3):1073274817729245. doi: 10.1177/1073274817729245 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref005] 5.Saha SK, Zhu AX, Fuchs CS, Brooks GA. Forty-year trends in cholangiocarcinoma incidence in the US: intrahepatic disease on the rise. Oncologist. 2016;21(5):594–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref006] 6.Braconi C, Patel T. Cholangiocarcinoma: new insights into disease pathogenesis and biology. Infect Dis Clin North Am. 2010;24(4):871–84. doi: 10.1016/j.idc.2010.07.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref007] 7.Isa T, Kusano T, Shimoji H, Takeshima Y, Muto Y, Furukawa M. Predictive factors for long-term survival in patients with intrahepatic cholangiocarcinoma. Am J Surg. 2001;181(6):507–11. doi: 10.1016/s0002-9610(01)00628-6 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref008] 8.Pegg AE, Jones DB, Secrist JA III. Effect of inhibitors of S-adenosylmethionine decarboxylase on polyamine content and growth of L1210 cells. Biochemistry. 1988;27(5):1408–15. doi: 10.1021/bi00405a003 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref009] 9.Williams-Ashman HG, Seidenfeld J, Galletti P. Trends in the biochemical pharmacology of 5’-deoxy-5’-methylthioadenosine. Biochem Pharmacol. 1982;31(3):277–88. doi: 10.1016/0006-2952(82)90171-x [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref010] 10.Tang B, Kadariya Y, Chen Y, Slifker M, Kruger WD. Expression of MTAP inhibits tumor-related phenotypes in HT1080 cells via a mechanism unrelated to its enzymatic function. G3-genes genom genet. 2015;5(1):35–44. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref011] 11.Tomasi ML, Cossu C, Spissu Y, Floris A, Ryoo M, Iglesias-Ara A, et al. S-adenosylmethionine and methylthioadenosine inhibit cancer metastasis by targeting microRNA 34a/b-methionine adenosyltransferase 2A/2B axis. Oncotarget. 2017;8(45):78851–69. doi: 10.18632/oncotarget.20234 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref012] 12.Bertino JR, Waud WR, Parker WB, Lubin M. Targeting tumors that lack methylthioadenosine phosphorylase (MTAP) activity: current strategies. Cancer Biol Ther. 2011;11(7):627–32. doi: 10.4161/cbt.11.7.14948 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref013] 13.Alhalabi O, Chen J, Zhang Y, Lu Y, Wang Q, Ramachandran S, et al. MTAP deficiency creates an exploitable target for antifolate therapy in 9p21-loss cancers. Nat Commun. 2022;13(1):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref014] 14.Alhalabi O, Zhu Y, Hamza A, Qiao W, Lin Y, Wang RM, et al. Integrative clinical and genomic characterization of MTAP-deficient metastatic urothelial cancer. Eur Urol Oncol. 2023;6(2):228–32. doi: 10.1016/j.euo.2021.10.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref015] 15.Sripa B, Seubwai W, Vaeteewoottacharn K, Sawanyawisuth K, Silsirivanit A, Kaewkong W, et al. Functional and genetic characterization of three cell lines derived from a single tumor of an Opisthorchis viverrini-associated cholangiocarcinoma patient. Human cell. 2020;33:695–708. doi: 10.1007/s13577-020-00334-w [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref016] 16.Maruyama M, Kobayashi N, Westerman KA, Sakaguchi M, Allain JE, Totsugawa T, et al. Establishment of a highly differentiated immortalized human cholangiocyte cell line with SV40T and hTERT. Transplantation. 2004;77(3):446–51. doi: 10.1097/01.TP.0000110292.73873.25 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref017] 17.Kerdkumthong K, Chanket W, Runsaeng P, Nanarong S, Songsurin K, Tantimetta P, et al. Two Recombinant Bacteriocins, Rhamnosin and Lysostaphin, Show Synergistic Anticancer Activity Against Gemcitabine-Resistant Cholangiocarcinoma Cell Lines. Probiotics Antimicro. 2023:1–13. doi: 10.1007/s12602-023-10096-0 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref018] 18.Johansson C, Samskog J, Sundström L, Wadensten H, Björkesten L, Flensburg J. Differential expression analysis of Escherichia coli proteins using a novel software for relative quantitation of LC‐MS/MS data. Proteomics. 2006;6(16):4475–85. doi: 10.1002/pmic.200500921 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref019] 19.Thorsell A, Portelius E, Blennow K, Westman‐Brinkmalm A. Evaluation of sample fractionation using micro‐scale liquid‐phase isoelectric focusing on mass spectrometric identification and quantitation of proteins in a SILAC experiment. Rapid Commun Spectrom. 2007;21(5):771–8. [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref020] 20.Howe EA, Sinha R, Schlauch D, Quackenbush J. RNA-Seq analysis in MeV. Bioinformatics. 2011;27(22):3209–10. doi: 10.1093/bioinformatics/btr490 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref021] 21.Mi H, Muruganujan A, Ebert D, Huang X, Thomas PD. PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res. 2019;47(D1):D419–D26. doi: 10.1093/nar/gky1038 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref022] 22.Ge SX, Jung D, Yao R. ShinyGO: a graphical gene-set enrichment tool for animals and plants. Bioinformatics. 2020;36(8):2628–9. doi: 10.1093/bioinformatics/btz931 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref023] 23.Rogers JE, Law L, Nguyen VD, Qiao W, Javle MM, Kaseb A, et al. Second-line systemic treatment for advanced cholangiocarcinoma. J Gastrointest Oncol. 2014;5(6):408. doi: 10.3978/j.issn.2078-6891.2014.072 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref024] 24.Razumilava N, Gores GJ. Cholangiocarcinoma. The Lancet. 2014;383(9935):2168–79. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref025] 25.Li Y, Wang Y, Wu P. 5’-Methylthioadenosine and Cancer: old molecules, new understanding. J Cancer. 2019;10(4):927–36. doi: 10.7150/jca.27160 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref026] 26.Stevens AP, Dettmer K, Kirovski G, Samejima K, Hellerbrand C, Bosserhoff AK, et al. Quantification of intermediates of the methionine and polyamine metabolism by liquid chromatography–tandem mass spectrometry in cultured tumor cells and liver biopsies. J Chromatogr A. 2010;1217(19):3282–8. doi: 10.1016/j.chroma.2010.01.025 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref027] 27.Henrich FC, Singer K, Poller K, Bernhardt L, Strobl CD, Limm K, et al. Suppressive effects of tumor cell-derived 5′-deoxy-5′-methylthioadenosine on human T cells. Oncoimmunology. 2016;5(8):e1184802. doi: 10.1080/2162402X.2016.1184802 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref028] 28.de Ferra F, Baglioni C. Correlation between growth inhibition and presence of 5’-methylthioadenosine in cells treated with interferon. Cancer Res. 1984;44(6):2297–301. [PubMed] [Google Scholar]

[pone.0306060.ref029] 29.Shafman TD, Sherman ML, Kufe DW. Effect of 5’-methylthioadenosine on induction of murine erythroleukemia cell differentiation. Biochem Biophys Res Commun. 1984;124(1):172–7. doi: 10.1016/0006-291x(84)90932-x [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref030] 30.Wolford RW, MacDonald MR, Zehfus B, Rogers TJ, Ferro AJ. Effect of 5’’-methylthioadenosine and its analogs on murine lymphoid cell proliferation. Cancer Res. 1981;41(8):3035–9. [PubMed] [Google Scholar]

[pone.0306060.ref031] 31.Andreu-Pérez P, Hernandez-Losa J, Moliné T, Gil R, Grueso J, Pujol A, et al. Methylthioadenosine (MTA) inhibits melanoma cell proliferation and in vivo tumor growth. BMC cancer. 2010;10:1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref032] 32.Collins CC, Volik SV, Lapuk AV, Wang Y, Gout PW, Wu C, et al. Next Generation Sequencing of Prostate Cancer from a Patient Identifies a Deficiency of Methylthioadenosine Phosphorylase, an Exploitable Tumor TargetNGS-Guided Personalized Therapy for MTAP-Deficient PCa. Mol Cancer Ther. 2012;11(3):775–83. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref033] 33.Nobori T, Takabayashi K, Tran P, Orvis L, Batova A, Yu AL, et al. Genomic cloning of methylthioadenosine phosphorylase: a purine metabolic enzyme deficient in multiple different cancers. Proc Natl Acad Sci USA. 1996;93(12):6203–8. doi: 10.1073/pnas.93.12.6203 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref034] 34.Tang B, Lee H-O, An SS, Cai KQ, Kruger WD. Specific targeting of MTAP-deleted tumors with a combination of 2′-fluoroadenine and 5′-methylthioadenosine. Cancer Res. 2018;78(15):4386–95. doi: 10.1158/0008-5472.CAN-18-0814 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref035] 35.Vandenbark AA, Ferro AJ, Barney CL. Inhibition of lymphocyte transformation by a naturally occurring metabolite: 5’-methylthioadenosine. Cell Immunol. 1980;49(1):26–33. doi: 10.1016/0008-8749(80)90052-0 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref036] 36.Conner SJ, Guarin JR, Le TT, Fatherree JP, Kelley CA, Payne SL, et al. Cell morphology best predicts tumorigenicity and metastasis in vivo across multiple TNBC cell lines of different metastatic potential. BioRxiv. 2023:2023.06. 14.544969. doi: 10.1101/2023.06.14.544969 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref037] 37.Fuchs Y, Steller H. Live to die another way: modes of programmed cell death and the signals emanating from dying cells. Nat Rev Mol Cell Biol. 2015;16(6):329–44. doi: 10.1038/nrm3999 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref038] 38.Lee SH, Cho YD. Induction of apoptosis in leukemia U937 cells by 5’-deoxy-5’-methylthioadenosine, a potent inhibitor of protein carboxylmethyltransferase. Exp Cell Res. 1998;240(2):282–92. doi: 10.1006/excr.1998.4000 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref039] 39.Li TW, Zhang Q, Oh P, Xia M, Chen H, Bemanian S, et al. S-Adenosylmethionine and methylthioadenosine inhibit cellular FLICE inhibitory protein expression and induce apoptosis in colon cancer cells. Mol Pharmacol. 2009;76(1):192–200. doi: 10.1124/mol.108.054411 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref040] 40.Yang H, Sadda MR, Li M, Zeng Y, Chen L, Bae W, et al. S-adenosylmethionine and its metabolite induce apoptosis in HepG2 cells: Role of protein phosphatase 1 and Bcl-x(S). Hepatol. 2004;40(1):221–31. doi: 10.1002/hep.20274 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref041] 41.Sahoo G, Samal D, Khandayataray P, Murthy MK. A Review on Caspases: Key Regulators of Biological Activities and Apoptosis. Mol Neurobiol. 2023:1–33. doi: 10.1007/s12035-023-03433-5 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref042] 42.Kalpage HA, Bazylianska V, Recanati MA, Fite A, Liu J, Wan J, et al. Tissue-specific regulation of cytochrome c by post-translational modifications: respiration, the mitochondrial membrane potential, ROS, and apoptosis. The FASEB J. 2019;33(2):1540. doi: 10.1096/fj.201801417R [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref043] 43.Ly JD, Grubb DR, Lawen A. The mitochondrial membrane potential (Δψ m) in apoptosis; an update. Apoptosis. 2003;8:115–28. [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref044] 44.Jones DP. Redox sensing: orthogonal control in cell cycle and apoptosis signalling. J Intern Med. 2010;268(5):432–48. doi: 10.1111/j.1365-2796.2010.02268.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref045] 45.Czabotar PE, Lessene G, Strasser A, Adams JM. Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy. Nat Rev Mol Cell biol. 2014;15(1):49–63. doi: 10.1038/nrm3722 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref046] 46.Du X, Shao Y, Qin HF, Tai YH, Gao HJ. ALK‐rearrangement in non‐small‐cell lung cancer (NSCLC). Thorac. Cancer. 2018;9(4):423–30. doi: 10.1111/1759-7714.12613 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref047] 47.Togashi Y, Soda M, Sakata S, Sugawara E, Hatano S, Asaka R, et al. KLC1-ALK: a novel fusion in lung cancer identified using a formalin-fixed paraffin-embedded tissue only. PloS one. 2012;7(2):e31323. doi: 10.1371/journal.pone.0031323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref048] 48.Wang P, Xiao P, Ye Y, Liu P, Han L, Dong L, et al. Rapid response of brain metastasis to crizotinib in a patient with KLC1-ALK fusion and MET gene amplification positive non-small cell lung cancer: a case report. Mol. Cancer Biol. 2017;14(2):183. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref049] 49.Dietz S, Christopoulos P, Gu L, Volckmar A-L, Endris V, Yuan Z, et al. Serial liquid biopsies for detection of treatment failure and profiling of resistance mechanisms in KLC1–ALK-rearranged lung cancer. Mol. Case Stud. 2019;5(6):a004630. doi: 10.1101/mcs.a004630 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref050] 50.Fujii T, Nakano Y, Hagita D, Onishi N, Endo A, Nakagawa M, et al. KLC1-ROS1 Fusion Exerts Oncogenic Properties of Glioma Cells via Specific Activation of JAK-STAT Pathway. Cancers. 2023;16(1):9. doi: 10.3390/cancers16010009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0306060.ref051] 51.Nakano Y, Tomiyama A, Kohno T, Yoshida A, Yamasaki K, Ozawa T, et al. Identification of a novel KLC1–ROS1 fusion in a case of pediatric low-grade localized glioma. Brain Tumor Pathol. 2019;36:14–9. doi: 10.1007/s10014-018-0330-3 [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref052] 52.Sehgal L, Mukhopadhyay A, Rajan A, Khapare N, Sawant M, Vishal SS, et al. 14-3-3γ-Mediated transport of plakoglobin to the cell border is required for the initiation of desmosome assembly in vitro and in vivo. J Cell Sci. 2014;127(10):2174–88. [DOI] [PubMed] [Google Scholar]

[pone.0306060.ref053] 53.Moamer A, Hachim IY, Binothman N, Wang N, Lebrun J-J, Ali S. A role for kinesin-1 subunits KIF5B/KLC1 in regulating epithelial mesenchymal plasticity in breast tumorigenesis. EBioMedicine. 2019;45:92–107. doi: 10.1016/j.ebiom.2019.06.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Quantitative proteomics analysis reveals possible anticancer mechanisms of 5’-deoxy-5’-methylthioadenosine in cholangiocarcinoma cells

Kankamol Kerdkumthong

Sutthipong Nanarong

Sittiruk Roytrakul

Thanawat Pitakpornpreecha

Phonprapavee Tantimetta

Phanthipha Runsaeng

Sumalee Obchoei

Roles

Abstract

Introduction

Fig 1. Chemical structure of 5′-deoxy-5′-methylthioadenosine (MTA) and the expression of 5-methylthioadenosine phosphorylase (MTAP) in cell lines.

Materials & methods

Chemicals and reagents

Cell culture

Cell viability assay

Cell growth assay

Apoptotic nuclear staining assay

Scratch assay

Cell migration and invasion assay

Sample preparation for proteomics analysis

Liquid chromatography and tandem mass spectrometry

Protein identification and quantification

Protein function enrichment and cluster analysis

RT-qPCR

Table 1. Lists of gene specific primers for qPCR.

Western blotting

Analysis of KLC1 mRNA expression in CCA patients’ tissue

Statistical analysis

Results

MTAP deficiency in CCA cell lines

MTA attenuates growth of CCA cells and enhances the effect of gemcitabine in vitro

Fig 2. Effect of MTA on cell viability and growth in CCA cell lines.

Table 2. The half-maximal inhibitory concentrations (IC50) of MTA on MMNK-1, KKU-213A and KKU-213B at 72 hours and 7 days.

MTA induces apoptosis of CCA cells

Fig 3. Investigation of the induction effect of MTA on cell apoptosis.

MTA suppresses migration and invasion capability of CCA cells

Fig 4. Effects of MTA on cell migration and invasion.

Identification of differentially expressed proteins in MTA-treated cells using proteomic analysis

Fig 5. Identification of differentially expressed proteins by proteomics analysis.

Fig 6. Visualization and classification of downregulated protein after MTA treatment.

Network analysis and functional enrichment analysis of down-regulated proteins

Fig 7. Network analysis shows the relationship between enriched nodes.

mRNA expression of six candidate genes identified in proteomics study

Fig 8. Validation of candidate genes identified in proteomics analysis.

KLC1 protein expression in MTA-treated cells and its mRNA expression in CCA patients’ tissue

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Matias A Avila

Roles

Author response to Decision Letter 0

Decision Letter 1

Matias A Avila

Roles

Acceptance letter

Matias A Avila

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Table 2. The half-maximal inhibitory concentrations (IC₅₀) of MTA on MMNK-1, KKU-213A and KKU-213B at 72 hours and 7 days.