The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB

Dong Yang; Quan Zhang; Haoyong Kuang; Jian Liu; Sen Wu; Li Wei; Wenjian Yao

doi:10.1371/journal.pone.0291531

. 2024 Jun 26;19(6):e0291531. doi: 10.1371/journal.pone.0291531

The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB

Dong Yang ^1,^‡, Quan Zhang ^1,^‡, Haoyong Kuang ², Jian Liu ², Sen Wu ¹, Li Wei ¹, Wenjian Yao ^1,^*

Editor: Arunava Roy³

PMCID: PMC11207133 PMID: 38924029

Abstract

Tangeretin (Tan), a citrus flavonoid, possesses a strong anti-tumor efficacy in various human cancers. However, the precise role of Tan in the development of esophageal squamous cell carcinoma (ESCC) remains unclear. RNA sequencing (RNA-seq) analysis was performed to observe the Tan-related genes in Tan-treated TE-1 cells. The direct relationship between GLI family zinc finger 2 (GLI2) and the promoter of glycoprotein non-metastatic melanoma protein B (GPNMB) was predicted by bioinformatics analysis and validated by luciferase reporter and chromatin immunoprecipitation (ChIP) assays. Cell survival after Tan treatment was assessed by CCK8 assay. Gene expression levels were evaluated by a qRT-PCR, western blot, or immunofluorescence method. Cell migration and invasion were detected by wound-healing and transwell assays. The function of Tan in vivo was examined using xenograft studies. Our data indicated anti-migration and anti-invasion functions of Tan in ESCC cells in vitro. Tan also diminished tumor growth in vivo. Mechanistically, Tan diminished the expression and transcriptional activity of GLI2 in ESCC cells. Silencing of GLI2 resulted in decreased expression of GPNMB by inhibiting GPNMB transcription via the binding site at the GPNMB promoter at position +(1539–1550). Moreover, Tan down-regulated GPNMB expression in ESCC cells, and re-expression of GPNMB reversed anti-migration and anti-invasion functions of Tan in ESCC cells. Our findings uncover anti-migration and anti-invasion effects of Tan in ESCC cells by down-regulating GPNMB by suppressing GLI2-mediated GPNMB transcription, providing new evidence that Tan can function as a therapeutic agent against ESCC.

Introduction

As the most frequent type of esophageal cancer, esophageal squamous cell carcinoma (ESCC) is a deadly and high-mortality malignancy worldwide [1, 2]. Although clinically therapeutic regimens, including surgery and radiochemotherapy, can treat many primary ESCC tumors effectively, these therapies remain restricted in controlling the metastasis of ESCC cells and curbing metastatic or advanced ESCC [3]. Hence, new anti-metastasis and anti-cancer therapeutic approaches are needed in ESCC.

Tangeretin (Tan), a type of bioactive polymethoxylated flavones found in citrus peel, has been unveiled to possess many pharmacological functions, such as anti-inflammatory, anti-oxidant, anti-viral, cardioprotective, neuroprotective, and hepatoprotective properties [4]. Of note, the anti-tumor efficacy of Tan has recently become increasingly clear due to its growth repression, apoptosis induction, anti-angiogenesis, and anti-metastasis effects [5]. Furthermore, Tan enhances the sensitivity of the chemotherapy drugs and reduces chemotherapy-induced toxicity [6, 7]. Functional studies in various cancer cell lines have highlighted the tumor-inhibitory potential of Tan [8–10], but its precise action in ESCC pathogenesis remains unclear.

Transcription factors (TFs) might prove crucial in promoting human carcinogenesis by controlling the transcription of the key genes by binding to their promoters [11]. GLI family zinc finger 2 (GLI2), a key TF that mediates the Sonic Hedgehog signaling, actively participates in human carcinogenesis [12, 13]. The activation and aberrant expression of GLI2 have been reported to induce the malignant phenotypes of multiple cancers, such as castration-resistant prostate cancer, renal cell carcinoma and gallbladder cancer [14–16]. In human esophagus adenocarcinoma, GLI2 is highly expressed and contributes to carcinoma formation [17]. Importantly, long noncoding RNA NR2F1-AS1 contributes to ESCC development by activating the Sonic Hedgehog pathway by elevating GLI2 expression [18], suggesting the oncogenic activity of GLI2 in ESCC. Although several other TFs, such as nuclear liver X receptor α (LXRα) and signal transducer and activator of transcription 3 (STAT3), have been illuminated as the downstream effectors of Tan [19, 20], no reports showed the involvement of GLI2 in the anti-cancer property of Tan in human tumors.

Here, we sought to elucidate the activity and molecular determinant of Tan in ESCC, with the hope that these findings might provide new evidence for developing Tan as a promising anti-tumor agent.

Materials and methods

Cell culture and treatment

Human ESCC cell line TE-1 (Procell, Wuhan, China) was propagated in 10% FBS RPMI-1640 (Servicebio, Wuhan, China), and the KYSE150 cell line (Procell) was cultured in 10% FBS RPMI-1640 containing Ham’s F-12 (Servicebio). The 293T cell line (Procell) used for luciferase reporter assay was grown in complete medium provided by Procell. Human normal esophageal HET-1A cells (Wanwusw, Hefei, China) were cultured in BEGM Kit (Wanwusw). All cells were maintained in a fully humidified incubator in the presence of 5% CO₂ at a temperature of 37°C.

Tan (≥98% purity) was procured from Macklin (Shanghai, China) and dissolved in DMSO for all experiments. For treatment of Tan, TE-1 and KYSE150 cells were incubated with or without Tan for 24 h at a concentration of 20 μg/ml.

Determination of cell survival after Tan treatment

The survival rate of Tan-treated cells was evaluated by CCK8 assay based on the standard protocols [21]. Cells (5.0 × 10³ cells/well) were seeded in regular growth media into 96-well culture dishes. 12 h post-seeding, the cells were challenged with different concentrations of Tan. After incubation of 48 h, 10 μl CCK8 reagent (Beyotime Biotechnology, Shanghai, China) was added to each well. After addition, one-hour incubation was allowed at 37°C. Using a microplate reader (Thermo Fisher Scientific, MA, USA), the absorption was gauged at a wavelength of 450 nm. Surviving fraction (%) in Tan treatment group was estimated relative to that of the untreated counterpart. The IC50 value for Tan was determined from a plot of the percentage of surviving cells (50%) versus Tan concentration.

RNA sequencing

For RNA sequencing (RNA-seq) as described [22], TE-1 cells were treated with 20 μg/ml Tan or DMSO for 24 h. RNA was prepared from the cells using magnetic beads with Oligo (dT) and fragmented. The quality and quantity of extracted RNA were analyzed using Qubit 2.0 fluorimeter (Thermo Fisher Scientific). RNA-seq analysis of high-quantity RNA for the construction of sequencing libraries was conducted by BGI Technology (Shenzhen, China) using the BGISEQ-500 sequencing platform (BGI Technology) following standard protocols. Read alignment mapped to the human genome grch37 was performed using Hisat2 software [23], and the read counts per group were calculated using the Python package HTseq [24]. The tab-delimited text files included FPKM values for each sample. Differentially expressed genes were defined under the conditions: log2|fold-change| > 1 and P < 0.05. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted using the R package “Cluster Profiler”. A loop graph was drawn for the visualization of the enrichment results.

Bioinformatics analysis

The differentially expressed genes (log2|fold-change| > 1 and P < 0.05) in ESCC tissues (n = 77) and normal esophageal tissues (n = 11) were obtained from The Cancer Genome Atlas (TCGA) database (https://www.tcga.org/). All human transcriptional factors (hTFs) were downloaded from AnimalTFDB database (http://bioinfo.life.hust.edu.cn/AnimalTFDB/). The TF binding sites for human were predicted using the Gene Transcription Regulation Database (GTRD) database (http://gtrd20-06.biouml.org/). To obtain the downstream targets of GLI2 TF, we used the database hTF-target at http://bioinfo.life.hust.edu.cn/hTFtarget#!/. To search the binding sites between GLI2 and the promoter of glycoprotein non-metastatic melanoma protein B (GPNMB), we interrogated the JASPAR database (https://jaspar.genereg.net/).

siRNAs, plasmids and cell transfection

Human GLI2-specific siRNA (si-GLI2) and a non-silencing siRNA mock (si-NC) were procured from Wuzhoukangjian Biological Technology Co., LTD (Tianjin, China). The coding sequence of human GPNMB was obtained by PCR amplification and inserted into pECMV-MCS-FLAG expressing plasmid (Miaoling Biotechnology, Wuhan, China). As control, the scrambled sequence was processed in the same way to generate a plasmid control (vec).

TE-1 and KYSE150 cells (5.0 × 10⁵ cells/well) were seeded in 24-well culture dishes 24 h prior to transfection using Lipofectamine 3000 (Thermo Fisher Scientific). The following day, 50 nM of siRNA or/and 500 ng of plasmid was transfected into cells as per the manufacturing recommendations for transfection. Cells were collected 24 h post-transfection and subjected to Tan treatment.

qRT-PCR of mRNA in ESCC cell lines

RNA preparation from TE-1 and KYSE150 cells after Tan treatment or/and transfection was done using RNAeasy™ Animal RNA Isolation Kit with Spin Column based on the recommendations of the manufacturer (Beyotime Biotechnology). For mRNA analysis, cDNA was oligo(dT) primed using SweScript RT II First Strand cDNA Synthesis Kit (Servicebio). Generated cDNA was diluted 10 folds, and qRT-PCR was performed on ABI QuantStudio6 Felx Real-Time System (Thermo Fisher Scientific) using the primers listed in Table 1. mRNA expression data were obtained using the 2^-ΔΔCt method [25] after normalization with reference to expression of β-actin.

Table 1. Primers sequences used for qRT-PCR.

Name		Primers for qRT-PCR (5’-3’)
GLI2	Forward	`TTGACATGCGACACCAGGAA`
GLI2	Reverse	`AGAACGGAGGTAGTGCTCCA`
BARX2	Forward	`CCAAGGAGACCTGCGATTACT`
BARX2	Reverse	`TGTTCCGTCTCTGACTCGCT`
EN1	Forward	`GCAACCCGGCTATCCTACTT`
EN1	Reverse	`TCGTTGAGGCTGAGTTCCTG`
BMP7	Forward	`TGGTCCACTTCATCAACCCG`
BMP7	Reverse	`CCGGACCACCATGTTTCTGT`
GPNMB	Forward	`GCGAGATCACCCAGAACACA`
GPNMB	Reverse	`ACACCAAGAGGGAGATCACAG`
β-actin	Forward	`CTCGCCTTTGCCGATCC`
β-actin	Reverse	`GGGGTACTTCAGGGTGAGGA`
GPNMB promoter +(343–354)	Forward	`CAAGCAATCACGAGCACAGG`
GPNMB promoter +(343–354)	Reverse	`TGTGGTGCCTCCCTCTCTAT`

Open in a new tab

Western blot

Lysates of TE-1 and KYSE150 cells after Tan treatment or siRNA transfection were conducted using RIPA lysis buffer (Beyotime Biotechnology) with protease and phosphatase inhibitor cocktail (Beyotime Biotechnology) for 20–30 min on ice. For western blot [16], approximately 35 μg of protein was loaded per lane and electrophoresed on 5–12% SDS-PAGE gels. After the resulting gels were blotted onto PVDF membranes (Millipore, Bedford, MA, USA), probing was conducted with primary antibodies (rabbit polyclonal) including GLI2 (18989-1-AP, 1:1000, Proteintech, Wuhan, China), GPNMB (GB111475, 1:1000, Servicebio), Vimentin (GB111308, 1:1000, Servicebio), E-Cadherin (E-Cad, GB11082, 1:1000, Servicebio), N-Cadherin (N-Cad, GB111273, 1:1000, Servicebio), β-Tubulin (GB11017, 1:1000, Servicebio), Slug (12129-1-AP, 1:2000, Proteintech), Snail (13099-1-AP, 1:1000, Proteintech), VEGF (19003-1-AP, 1:1500, Proteintech), and Cyclin D1 (26939-1-AP, 1:10000, Proteintech), and β-actin (GB11001, 1:1000, Servicebio) antibodies. Following incubation with secondary HRP-tagged anti-rabbit IgG antibody (GB23303, 1:3000, Servicebio), signals were developed with Ultra sensitive ECL Chemiluminescence Kit as described by the manufacturer (Servicebio).

Luciferase reporter assay

To evaluate the impact of Tan treatment on GLI2 transcriptional activity, 5.0 × 10⁵ TE-1 cells grown in 24-well culture dishes were co-transfected using Lipofectamine 3000 with 100 ng pRL-TK control plasmid, constitutively expressing Renilla luciferase (for normalization, Promega), and 400 ng GLI2-luc luciferase reporter plasmid (Yeasen, Shanghai, China). Cells were subjected to Tan treatment (20 μg/ml, 24 h) at 24 h after transfection and assayed for luciferase activities. Firefly luciferase activity was normalized to that of Renilla luciferase.

To determine the binding site between GLI2 and the GPNMB promoter, the fragments (about 100 bp) of the GPNMB promoter containing the +(343–354) (named BS-1) position sequence or +(1539–1550) (named BS-2) position sequence, synthesized by Qingke Biotechnology (Beijing, China), were subcloned into the 3’UTR of the firefly luciferase coding region into pGL3-basic luciferase plasmid (Miaoling Biotechnology) as described previously [26]. For luciferase assays, 5.0 × 10⁵ 293T cells growth in 24-well culture dishes were co-transfected using Lipofectamine 8000 (Beyotime Biotechnology) with reporter construct, siRNA and pRL-TK control plasmid based on the manufacturer’s suggestion. 48 h post-transfection, cells were lysed for luciferase activities and firefly luciferase activity was normalized to that of Renilla luciferase.

Chromatin immunoprecipitation (ChIP) assay

For ChIP assay [26], the ChIP Kit was applied as recommended by the manufacturer (Beyotime Biotechnology). Briefly, 1.0 × 10⁷ TE-1 cells were fixed with 1% formaldehyde (Macklin) for 10 min, lysed in SDS cell lysis buffer (Beyotime), and sonicated to fragment DNA length into 200–800 bp using the Ultrasonic Cell Disruptor (Lichen, Shanghai, China). IP complexes were immunoprecipitated with anti-GLI2 antibody (ab226390, Abcam, Cambridge, UK) or rabbit IgG control (10284-1-AP, Proteintech) overnight at 4°C. DNA was purified with DNA Product Purification Kit (Solarbio, Beijing, China) and amplified by qRT-PCR using specific primers (Table 1).

Measuring cell migration by wound-healing assay

TE-1 and KYSE150 cells after Tan treatment or/and plasmid transfection were seeded in 6-well culture dishes in 2 ml total volume to yield a monolayer of 80–90% confluence following overnight incubation. A homogeneous wound track was created using the 200 μl of sterile pipette tips. After 24 h culture in regular media at 37°C, images were acquired and analyzed using Image J software (National Institutes of Health, Bethesda, USA). We scored cell migration ability by gauging cell motility distance [27].

Transwell migration and invasion assays

TE-1 and KYSE150 cells after Tan treatment or/and plasmid transfection were resuspended in non-serum medium and placed in 24-transwell inserts (Corning, New York, USA) precoated without (for migration analysis, 4.0 × 10⁵ cells/well) or with (for invasion analysis, 2.0 × 10⁶ cells/well) 1 mg/ml Matrigel (BD Biosciences). Then, the inserts were placed in 24-wells containing 10% FBS growth medium. Following 24-h incubation at 37°C, the cells that passed the membranes to the undersurface were photographed and counted in 10 random microscopic fields as described elsewhere [27].

Xenograft studies

Six-week-old female BALB/c athymic nude mice (n = 10, Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China) were used for evaluation of the tumor-inhibitory effect of Tan. For formation of xenograft tumors [28], KYSE150 cells (5 × 10⁶ cells/mouse) were implanted into the right flanks of nude mice via subcutaneous injection. Five days later, the mice were administrated with Tan (20 mg/kg) or PBS at the same volume by intraperitoneal injection every three days. Each group included five mice. All mice were euthanized at day 35 by a CO₂ overdose method by gradually elevating the concentration of CO₂ in the anesthesia chamber. After the mice stopped breathing and heartbeat completely, the tumors were removed, weighed, and paraffin-embedded. All animal procedures were conducted in accordance with a protocol approved by Animal Care and Use Committee of Henan Provincial People’s Hospital.

Immunofluorescence

For cell immunofluorescence staining [29], TE-1 and KYSE150 cells after Tan treatment or/and plasmid transfection were fixed for 15 min in 4% paraformaldehyde, permeabilized by incubation for 20 min in 0.5% Triton X-100, and blocked for 30 min in 3% BSA at room temperature. For tumor immunofluorescence staining, paraffin-embedded tumors were sectioned at 4 μm thickness, dehydrated, boiled in 10 nM sodium citrate for 30 min, and blocked in 3% BSA for 30 min. PCNA or MMP9 was probed with a rabbit polyclonal antibody (Servicebio, Wuhan, China) to PCNA (GB11010, 1:500) or MMP9 (GB11132, 1:1000), respectively. The Alexa Fluor 488 conjugated goat anti-rabbit IgG (for cell staining, GB25303, 1:500, Servicebio) or Cy3 conjugated goat anti-rabbit IgG (for tumor staining, GB21303, 1:300, Servicebio) was used for visualization. Nuclei were subsequently stained by DAPI (Servicebio). Fluorescent images were obtained under an Olympus fluorescence microscope (BX53, Olympus, Tokyo, Japan) and analyzed using ImageJ software (NIH, Bethesda, MA, USA).

Statistical analysis

Results were compared using ANOVA with Tukey’s post hoc test (for multiple comparisons) or Student’s t-test (two-tailed, for two-group comparison). Data were shown as mean ± SEM of three independent experiments (n ≥ 3) that were done in triplicate. Difference between a single or combination treatment and control was considered significant at a p value less than 0.05.

Results

Tan exerts anti-migration and anti-invasion functions in ESCC cells in vitro

We first evaluated the anti-tumor effects of Tan in TE-1 and KYSE150 ESCC cells in vitro. The cells were exposed to various concentrations of Tan, and cell viability was analyzed at 48 h. We found that exposure of Tan caused a remarkable reduction in cell survival rate, indicating that Tan hindered cell growth with the IC50 being 85.92 μg/ml in TE-1 cells and 94.34 μg/ml in KYSE150 cells (Fig 1A). We then treated cells with 20 μg/ml of Tan and evaluated the effect on cell migration and invasiveness after 24 h. Through wound-healing and transwell assays, we observed that treatment of Tan led to a striking reduction in the migratory abilities of the two ESCC cell lines (Fig 1B and 1C). Furthermore, treatment of Tan diminished cell invasiveness in vitro (Fig 1D). Immunofluorescence results showed that TE-1 and KYSE150 cells treated by Tan exhibited lower levels of proliferating marker PCNA and metastasis-related protein MMP9 compared with controls (Fig 2A and 2B). These results demonstrate that Tan can diminish ESCC cell growth, migration, and invasiveness, thereby exerting anti-ESCC activity.

Fig 1 — (A) TE-1 and KYSE150 cells were exposed to incremental concentrations of Tan for 48 h and checked for cell viability by CCK8 assay. Also shown were the IC50 values in the two cell lines. (B) Cells were treated with 20 μg/ml of Tan for 24 h, and cell migration was quantified as the wound-healed distance. Also shown were the representative pictures. Scale bar: 100 μm. (C and D) Representative images depicting transwell migration and invasion assays performed with control (Con) or Tan-treated cells. Scale bar: 100 μm. *P < 0.05, **P < 0.01, ***P < 0.001.

Fig 2 — (A and B) Immunofluorescence assay showing the fluorescence intensity of PCNA and MMP9 in cells treated with control (Con) or Tan. Scale bars: 100 μm (A) and 50 μm (B). **P < 0.01.

Tan diminishes tumor growth in vivo

To elucidate whether Tan possesses a tumor-inhibitory function, we implanted KYSE150 cells subcutaneously into the right flanks of nude mice, with administration of Tan every three days. As shown in Fig 3A and 3B, images showed a significant reduction in tumor volume as a result of Tan treatment. Moreover, Tan treatment reduced average weight of the xenograft tumors (Fig 3C). This result was also verified by immunofluorescence for cell proliferation using PCNA. Tan treatment suppressed the expression of PCNA in the xenograft tumors (Fig 3D). Additionally, immunofluorescence results revealed that Tan treatment led to a clear down-regulation of MMP9 expression in the tumors (Fig 3E). All these data indicate the tumor-inhibitory effect of Tan in vivo.

Fig 3 — KYSE150 cells (5 × 10⁶) were implanted subcutaneously into right flanks of nude mice, with administration of Tan every three days. 35 days later, the tumors were harvested from the mice. (A) Images of mice with the xenograft tumors. (B) Images of the xenograft tumors. (C) Mean weight of the xenograft tumors. (D and E) Immunofluorescence for PCNA and MMP9 levels in the harvested tumors. Scale bar: 100 μm. *P < 0.05.

Transcriptional profiling of Tan-treated ESCC cells and selection of the regulatory TFs of Tan in ESCC

To find important genes in relation to the anti-ESCC activity of Tan, we performed RNA sequencing (RNA-seq) on Tan-treated TE-1 ESCC cells and control cells. We identified 587 genes with a significant variation following Tan treatment in TE-1 cells, in which 361 genes were down-regulated and 226 genes were up-regulated (S1 Table), and the cluster heat map of differentially expressed genes was shown in Fig 4A. We then performed GO and KEGG enrichment analyses to elucidate the mechanisms of the 587 genes on biological process and KEGG pathway. Results showed that these genes were closely associated with extracellular structure organization (GO: 0043062), collagen-containing extracellular matrix (GO: 0062023), extracellular matrix organization (GO: 0030198), ossification (GO: 0001503), heparin binding (GO: 008201), glycosaminoglycan binding (GO: 00055393), sulfur compound binding (GO: 1901681), extracellular matrix part (0044420), and interstitial matrix (0005614). KEGG pathway enrichment analysis pointed to the hippo signaling pathway (hsa04390), Complement and coagulation cascades (hsa04610), Basal cell carcinoma (hsa05217), wnt signaling pathway, and cholesterol metabolism (Fig 4B). To obtain the TFs that are not only aberrantly expressed in ESCC but also are controlled by Tan treatment in ESCC cells, we combined these genes including the 587 genes altered by Tan treatment in TE-1 ESCC cells (S1 Table), the all 1665 hTFs from AnimalTFDB database (S2 Table), and the differentially expressed genes in ESCC tissues and normal esophageal tissues using the TCGA database (S3 Table). As shown in Fig 4C, Venn diagram revealed a total of 18 TFs that could be regulated by Tan in TE-1 ESCC cells and were deregulated in ESCC. By combining the 18 TFs with the 2684 up-regulated genes in ESCC and the 361 genes down-regulated by Tan in ESCC TE-1 cells, we found a total of 6 TFs (BNC1, GLI2, BARX2, FOXN1, EN1 and NHLH2) (Fig 4D). Using the GTRD database, among the 6 TFs, we found that GLI2, BARX2 and EN1 had been shown to contain binding sites for human, which were identified by ChIP-seq experiments (-1000, +100).

Fig 4 — (A) Heat map obtained from high-throughput RNA-seq profiling of Tan-treated TE-1 ESCC cells (20 μg/ml, 24 h) and control cells (Con). (B) The loop graph showing the markedly enriched biological processes, molecular function, cellular components, and KEGG pathways. The red and blue dots represent up-regulated and down-regulated genes, respectively. (C) Venn diagram revealing the 18 TFs that were not only aberrantly expressed in ESCC but also were controlled by Tan treatment in TE-1 ESCC cells. (D) Differential ordering diagram of 18 TFs in ESCC vs normal tissues, as well as in Tan treatment and con group.

Tan reduces the expression and transcriptional activity of GLI2 in ESCC cells

Next, we wanted to evaluate whether the three TFs (GLI2, BARX2 and EN1) are involved in the anti-ESCC activity of Tan. We analyzed their expression in Tan-treated TE-1 and KYSE150 ESCC cells by qRT-PCR. Treatment of Tan led to a significant down-regulation in GLI2 mRNA expression, and BARX2 and EN1 mRNA levels did not reduce following Tan treatment in the cells (Fig 5A and 5B). We thus focused on the GLI2 TF as a potential target gene of Tan. Our western blot results further confirmed the reduction of GLI2 expression at the protein level following Tan treatment in TE-1 and KYSE150 ESCC cells (Fig 5C). To determine whether Tan could influence the transcriptional activity of GLI2, we adopted luciferase assays in TE-1 cells. Treatment of Tan caused a clear down-regulation in the luciferase activity of the GLI2-luc luciferase reporter plasmid (Fig 5D), supporting our hypothesis that Tan could inhibit the transcriptional activity of GLI2 in ESCC cells.

Fig 5 — (A and B) qRT-PCR of the mRNA levels of GLI2, BARX2 and EN1 in Tan-treated TE-1 and KYSE150 ESCC cells (20 μg/ml, 24 h) and control cells (Con). (C) Western blot analysis of GLI2 protein expression in Tan-treated TE-1 and KYSE150 ESCC cells (20 μg/ml, 24 h) and control cells (Con). (D) TE-1 cells were introduced with GLI2-luc luciferase reporter plasmid and pRL-TK *Renilla* control vector and then subjected to Tan treatment (20 μg/ml, 24 h) or control (Con), followed by the evaluation of the luciferase activity. *P < 0.05, ***P < 0.001.

Tan down-regulates GPNMB expression by suppressing GLI2-mediated transcription of GPNMB in ESCC cells

To identify GLI2 downstream genes responsible for the anti-ESCC activity of Tan, we integrated these genes including the 587 genes with a significant variation following Tan treatment in TE-1 cells (S1 Table), the differentially expressed genes in ESCC tissues and normal esophageal tissues using the TCGA database (S3 Table), and the downstream target genes of GLI2 using hTF-target database (S4 Table). Of the 24 genes that overlapped among the 3 lists (Fig 5A), we found that 8 genes (ABCC3, BMP7, TM4SF1, GPNMB, COBLL1, FRY, BCAT1, ENHO) were positively correlated with GLI2 expression in ESCC tissues (Fig 6A). Furthermore, only GPNMB, BMP7, BCAT1 levels were markedly elevated in ESCC (Fig 6B, S3 Table) and were down-regulated following Tan treatment in TE-1 ESCC cells (Fig 6B, S1 Table). In consideration of the markedly correlation of GPNMB and BMP7 with P < 0.01 (Fig 6A), we further confirmed the expression of GPNMB and BMP7 in GLI2-lossed TE-1 and KYSE150 cells. As expected, silencing of GLI2 resulted in reduced mRNA levels of GPNMB in the two cell lines (Fig 6C), thereby, we selected GPNMB for further exploration. Western blot results also confirmed the down-regulation of GPNMB protein level in GLI2-silenced TE-1 and KYSE150 cells (Fig 6D), indicating that GLI2 positively regulated GPNMB expression in ESCC cells.

Fig 6 — (A and B) Venn diagram revealing the 24 genes that overlapped among the 3 lists. Correlation clustering heat map of GLI2 and 24 target genes. Red “*” indicates positive correlation, and blue “*” indicates negative. (B) The volcano map of differentially expressed genes in ESCC vs normal tissue and Tan treatment vs Con. (C) qRT-PCR of the mRNA levels of GPNMB and BMP7 in TE-1 and KYSE150 ESCC cells after transfection by si-GLI2 or si-NC. (D) Western blot of GPNMB protein level in cells transfected as indicated. *P < 0.05, **P < 0.01, ***P < 0.001.

To search the binding region between GLI2 and the GPNMB promoter, we interrogated the JASPAR database and found a putative binding motif (Fig 7A) and two putative binding sites at positions +(343–354) (named BS-1) and +(1539–1550) (named BS-2) in the GPNMB promoter (Fig 7B). To verify this, we cloned the fragments (about 100 bp) of the GPNMB promoter containing the +(343–354) (named BS-1) position sequence or +(1539–1550) (named BS-2) position sequence into the pGL3-basic luciferase plasmid and transfected them into 293T cells together with si-GLI2. With the BS-2 reporter construct and GLI2 silencing led to a reduction in luciferase activity (Fig 7B). When the BS-1 reporter plasmid was introduced, no reduction in luciferase was observed with GLI2 silencing (Fig 7B), demonstrating that GLI2 could bind to the GPNMB promoter through the site at position +(1539–1550). Furthermore, ChIP experiments showed that the GPNMB promoter at position +(1539–1550) was preferentially enriched in GLI2-associating immunoprecipitates compared with IgG controls (Fig 7C), reinforcing the binding relationship between GLI2 and the GPNMB promoter. All these findings indicate that GLI2 positively regulates GPNMB transcription by binding to the GPNMB promoter.

Having established that Tan inhibits GLI2 transcriptional activity, we next determined whether Tan could affect GPNMB expression in ESCC cells. Notably, treatment of Tan down-regulated GPNMB expression at both mRNA and protein in TE-1 and KYSE150 ESCC cells (Fig 7D and 7E). In summary, these observations suggest that Tan inhibits GPNMB expression at least in part by suppressing GLI2-mediated transcription of GPNMB in ESCC cells.

Re-expression of GPNMB reverses anti-migration and anti-invasion functions of Tan in ESCC cells

To determine whether the anti-tumor activity of Tan in ESCC is due to the reduction of GPNMB, a GPNMB cDNA plasmid was introduced before Tan treatment and assayed for cell migration and invasiveness. The efficacy of the cDNA plasmid in increasing GPNMB expression was validated by qRT-PCR in ESCC cells (Fig 8A). Indeed, re-expression of GPNMB strongly abolished Tan-driven suppression of viability, migration, and invasiveness of TE-1 and KYSE150 cells (Fig 8B–8E). Furthermore, GPNMB re-expression abated Tan-mediated reduction of PCNA and MMP9 levels in the two cell lines (Fig 9A and 9B). Collectively, these findings point to the notion that Tan diminishes ESCC cell migration and invasion partially via the suppression of GPNMB.

Fig 8 — (A) qRT-PCR of GPNMB mRNA in cells transfected with vec or GPNMB. (B-E) TE-1 and KYSE150 cells were introduced with or without the GPNMB cDNA plasmid or control plasmid (vec) before Tan treatment (20 μg/ml, 24 h) and control treatment (Con). (B) Cell viability was determined by CCK8 assay. (C) Representative images showing a cell migration assay with cells treated as indicated and cell migration by wound-healing assay. Scale bars: 100 μm. (D and E) Representative images depicting transwell migration and invasion assays performed with cells treated as indicated. Scale bar: 100 μm. *P < 0.05, **P < 0.01, ***P < 0.001.

Fig 9 — (A and B) TE-1 and KYSE150 cells were introduced with or without the GPNMB cDNA plasmid or control plasmid (vec) before Tan treatment (20 μg/ml, 24 h) and control treatment (Con), followed by the detection of PCNA (A) and MMP9 (B) expression by immunofluorescence. Scale bars: 100 μm (A) and 50 μm (B). *P < 0.05, **P < 0.01, ***P < 0.001.

Discussion

Emerging evidence supports the notion that Tan exhibits potent anti-tumor efficacy against numerous human cancers [5, 6]. Identifying the molecular determinants underlying the activity of Tan has been challenging. In the current work, we first demonstrate the anti-cancer activity of Tan in TE-1 and KYSE150 ESCC cells. Furthermore, we uncover the relevance of GLI2-mediated GPNMB transcription to the anti-ESCC activity of Tan, providing a new understanding of the inhibitory mechanism of Tan in ESCC development and a rationale for developing Tan as a potential agent against ESCC.

Functional studies in cancer cell lines have unveiled the tumor-inhibitory potential of Tan. For instance, in hepatocellular carcinoma HepG2 cells, Tan possesses the suppressive effects on cell growth and migration by elevating autophagy via the JNK/Bcl-2/beclin1 pathway [30]. In colorectal carcinoma COLO205 cells, Tan strongly enhances cell cycle arrest at G1 phase at least in part by diminishing cyclin-dependent kinases 2 (Cdk2) and 4 (Cdk4) activities [31]. Treatment of Tan in prostate cancer PC-3 cells leads to suppressed EMT by attenuating Vimentin expression and increasing E-cad level through the PI3K/Akt/mTOR pathway [32]. Moreover, Tan-zinc oxide quantum dots perform a strong anti-metastasis property in metastatic lung cancer NCI-H358 cells [33]. In the current report, we identify, for the first time, the anti-migration, anti-invasion, and anti-tumor functions of Tan in ESCC cells. Intriguingly, Tan (1–100 μg/ml) did not significantly affect the growth of normal esophageal HET-1A cells, and the IC50 value of Tan was 520.6 μg/ml against HET-1A cells (S1 Fig), suggesting the safety of Tan at low doses as an anti-tumor drug.

By analyzing the transcriptional profiling of Tan-stimulated TE-1 ESCC cells, the GLI2 TF seems to be a candidate for the Tan target genes. The Sonic Hedgehog signaling has established a vital role in cancer biology [34]. As the downstream gene of the pathway, numerous reports have implicated GLI2 in the regulation of human carcinogenesis by inducing cancer cell malignant phenotypes, suggesting the potential of GLI2 as a new target for cancer treatment [13]. For example, GLI2 participates in the enhanced invasive ability of gallbladder cancer cells by increasing cell EMT [16]. Knocking down GLI2 in cervical cancer cells can cause suppressed cell growth and migration [35]. Moreover, GLI2 has been identified as a potent oncogene in esophageal cancer, including ESCC, and it is present at high levels in these diseases [17, 18]. Our results first discovered that in TE-1 and KYSE150 ESCC cells, Tan down-regulates GLI2 expression by diminishing the transcriptional activity of GLI2. We thus speculate that GLI2 deregulation might be responsible for the anti-ESCC activity of Tan. In addition to the Hedgehog signaling, GLI2 has identified as a direct target of the TGF-β/SMAD pathway [13]. Previous work also uncovered the inhibition of Tan in TGF-β1 expression in human retinal pigment epithelial cells [36]. These conclusions suggest that Tan may reduce GLI2 expression by suppressing the TGF-β/SMAD pathway. Related field research is warranted in future work.

TFs can modulate the transcription of the key cancer-related genes and thus actively participate in human carcinogenesis [11]. According to a series of bioinformatics analyses and our siRNA experiments, GPNMB is identified as a target gene of GLI2. Furthermore, we first define that GLI2 positively regulates GPNMB transcription by binding to the GPNMB promoter at position +(1539–1550). GPNMB, an endogenous transmembrane protein, has emerged as a critical positive contributor to human carcinogenesis and is present at high levels in various types of cancers, thereby targeting GPNMB as an attractive strategy against cancer [37, 38]. GPNMB functions as a pro-tumorigenic factor predominantly by promoting tumor migration and invasiveness and elevating the levels of tumorigenic factors [37]. Bioinformatics analysis revealed the overexpression of GPNMB in ESCC. Nonetheless, no reports proved whether GPNMB overexpression is causally involved in ESCC pathogenesis. In the current work, we first demonstrate the inhibitory effect of Tan on GPNMB expression in TE-1 and KYSE150 ESCC cells. More intriguingly, our study defines the causal association between the reduction of GPNMB and the anti-migration and anti-invasion functions of Tan in TE-1 and KYSE150 ESCC cells. Some important metastasis-related markers, such as EMT specific molecule Snail, angiogenesis-related molecule VEGF, and cell cycle regulator Cyclin D1, have been identified as target genes of GLI2 TF [39, 40]. Our data also uncovered the repression of Tan in the expression of Slug, Snail, VEGF, and Cyclin D1 in ESCC cells (S2 Fig), suggesting that Tan may downregulate their expression via GLI2 and thus influences ESCC metastasis. Future work will build on the findings by elucidating whether Tan exerts an anti-metastasis function in ESCC in vivo and whether the novel mechanism is involved in the anti-metastasis function of Tan in vivo. Moreover, more studies are required to determine the long-term efficacy and safety of Tan in various experimental models. Additionally, MMP9 is a crucial regulator implicated in ESCC outcome and prognosis [41], and its expression can be regulated by GLI2 in melanoma cells [42]. A previous document proved that GPNMB can influence MMP9 expression in chronic obstructive pulmonary disease [43]. Our data also showed that Tan can down-regulate MMP9 expression by diminishing GPNMB level in ESCC cells. With these findings, we speculate that Tan in ESCC cells down-regulates MMP9 expression by suppressing GLI2-mediated GPNMB transcription.

Owing to the diverse pharmacological activities and minimal side effects, the flavonoids, including Tan, have gained much attention in the prevention and treatment of cancer [5]. However, certain limitations, such as the difficult purification process and poor solubility, impede their clinical use [5]. Therefore, it is very important to study how these limitations are resolved for their clinical use.

Conclusions

Here, we conclude that Tan exerts anti-migration and anti-invasion effects in ESCC cells by down-regulating GPNMB by suppressing GLI2-mediated GPNMB transcription, providing a new understanding of the tumor-inhibitory mechanism of Tan and the basis for the development of Tan as a therapeutic agent against ESCC.

Supporting information

S1 Fig. The IC50 value of Tan in normal esophageal HET-1A cells.

(TIF)

pone.0291531.s001.tif^{(113.2KB, tif)}

S2 Fig. Effect of Tan on the expression of VEGF, Slug, Snail and Cyclin D1.

(TIF)

pone.0291531.s002.tif^{(457.8KB, tif)}

S1 Table. The 587 genes with a significant variation following Tan treatment in TE-1 cells.

(XLSX)

pone.0291531.s003.xlsx^{(134.6KB, xlsx)}

S2 Table. The all 1665 human transcriptional factors.

(XLSX)

pone.0291531.s004.xlsx^{(109.9KB, xlsx)}

S3 Table. The differentially expressed genes in ESCC tissues and normal esophageal tissues using the TCGA database.

(XLSX)

pone.0291531.s005.xlsx^{(595.8KB, xlsx)}

S4 Table. The genes that could be regulated by GLI2 from hTF-target database.

(XLSX)

pone.0291531.s006.xlsx^{(117.4KB, xlsx)}

S1 Raw images

(PDF)

pone.0291531.s007.pdf^{(1.5MB, pdf)}

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This research was supported by Key Science and Technology Projects in Henan Province (No. 212102310669, No. 222102310045), and Henan Province Medical Science and Technology Research Plan Joint Construction Project (No. SBGJ202102022) and “23456 Talent Project” of Henan Provincial People’s Hospital.

References

1.Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021; 71(3): 209–249. doi: 10.3322/caac.21660 [DOI] [PubMed] [Google Scholar]
2.Reichenbach ZW, Murray MG, Saxena R, Farkas D, Karassik EG, Klochkova A, et al. Clinical and translational advances in esophageal squamous cell carcinoma. Adv Cancer Res. 2019; 144(95–135. doi: 10.1016/bs.acr.2019.05.004 [DOI] [PubMed] [Google Scholar]
3.Leng XF, Daiko H, Han YT, Mao YS. Optimal preoperative neoadjuvant therapy for resectable locally advanced esophageal squamous cell carcinoma. Ann N Y Acad Sci. 2020; 1482(1): 213–224. doi: 10.1111/nyas.14508 [DOI] [PubMed] [Google Scholar]
4.Ashrafizadeh M, Ahmadi Z, Mohammadinejad R, Ghasemipour Afshar E. Tangeretin: a mechanistic review of its pharmacological and therapeutic effects. J Basic Clin Physiol Pharmacol. 2020; 31(4). doi: 10.1515/jbcpp-2019-0191 [DOI] [PubMed] [Google Scholar]
5.Raza W, Luqman S, Meena A. Prospects of tangeretin as a modulator of cancer targets/pathways. Pharmacol Res. 2020; 161(105202. doi: 10.1016/j.phrs.2020.105202 [DOI] [PubMed] [Google Scholar]
6.Arafa EA, Shurrab NT, Buabeid MA. Therapeutic Implications of a Polymethoxylated Flavone, Tangeretin, in the Management of Cancer via Modulation of Different Molecular Pathways. Adv Pharmacol Pharm Sci. 2021; 2021(4709818. doi: 10.1155/2021/4709818 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Alhamad DW, Elgendy SM, Al-Tel TH, Omar HA. Tangeretin as an adjuvant and chemotherapeutic sensitizer against various types of cancers: a comparative overview. J Pharm Pharmacol. 2021; 73(5): 601–610. doi: 10.1093/jpp/rgab013 [DOI] [PubMed] [Google Scholar]
8.Hermawan A, Putri H, Hanif N, Ikawati M. Integrative Bioinformatics Study of Tangeretin Potential Targets for Preventing Metastatic Breast Cancer. Evid Based Complement Alternat Med. 2021; 2021(2234554. doi: 10.1155/2021/2234554 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.P S, K L. Anti-tumorigenic Efficacy of Tangeretin in Liver Cancer—An In Silico Approach. Curr Comput Aided Drug Des. 2021; 17(3): 337–343. doi: 10.2174/1573409916666200219120254 [DOI] [PubMed] [Google Scholar]
10.Lin JJ, Huang CC, Su YL, Luo HL, Lee NL, Sung MT, et al. Proteomics Analysis of Tangeretin-Induced Apoptosis through Mitochondrial Dysfunction in Bladder Cancer Cells. Int J Mol Sci. 2019; 20(5). doi: 10.3390/ijms20051017 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Lambert M, Jambon S, Depauw S, David-Cordonnier MH. Targeting Transcription Factors for Cancer Treatment. Molecules. 2018; 23(6). doi: 10.3390/molecules23061479 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Han W, Allam SA, Elsawa SF. GLI2-Mediated Inflammation in the Tumor Microenvironment. Adv Exp Med Biol. 2020; 1263(55–65. doi: 10.1007/978-3-030-44518-8_5 [DOI] [PubMed] [Google Scholar]
13.Javelaud D, Alexaki VI, Dennler S, Mohammad KS, Guise TA, Mauviel A. TGF-β/SMAD/GLI2 signaling axis in cancer progression and metastasis. Cancer Res. 2011; 71(17): 5606–5610. doi: 10.1158/0008-5472.CAN-11-1194 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Xia L, Bouamar H, Gu X, Zeballos C, Qin T, Wang B, et al. Gli2 mediates the development of castration‑resistant prostate cancer. Int J Oncol. 2020; 57(1): 100–112. doi: 10.3892/ijo.2020.5044 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Bai JY, Jin B, Ma JB, Liu TJ, Yang C, Chong Y, et al. HOTAIR and androgen receptor synergistically increase GLI2 transcription to promote tumor angiogenesis and cancer stemness in renal cell carcinoma. Cancer Lett. 2021; 498(70–79. doi: 10.1016/j.canlet.2020.10.031 [DOI] [PubMed] [Google Scholar]
16.Ichimiya S, Onishi H, Nagao S, Koga S, Sakihama K, Nakayama K, et al. GLI2 but not GLI1/GLI3 plays a central role in the induction of malignant phenotype of gallbladder cancer. Oncol Rep. 2021; 45(3): 997–1010. doi: 10.3892/or.2021.7947 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Katoh Y, Katoh M. Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med. 2009; 9(7): 873–886. doi: 10.2174/156652409789105570 [DOI] [PubMed] [Google Scholar]
18.Zhang Y, Zheng A, Xu R, Zhou F, Hao A, Yang H, et al. NR2F1-induced NR2F1-AS1 promotes esophageal squamous cell carcinoma progression via activating Hedgehog signaling pathway. Biochem Biophys Res Commun. 2019; 519(3): 497–504. doi: 10.1016/j.bbrc.2019.09.015 [DOI] [PubMed] [Google Scholar]
19.Chen PY, Chao TY, Hsu HJ, Wang CY, Lin CY, Gao WY, et al. The Lipid-Modulating Effect of Tangeretin on the Inhibition of Angiopoietin-like 3 (ANGPTL3) Gene Expression through Regulation of LXRα Activation in Hepatic Cells. Int J Mol Sci. 2021; 22(18). doi: 10.3390/ijms22189853 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Ko YC, Choi HS, Liu R, Kim JH, Kim SL, Yun BS, et al. Inhibitory Effects of Tangeretin, A Citrus Peel-Derived Flavonoid, on Breast Cancer Stem Cell Formation through Suppression of Stat3 Signaling. Molecules. 2020; 25(11). doi: 10.3390/molecules25112599 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Mao X, Zhou J, Kong L, Zhu L, Yang D, Zhang Z. A peptide encoded by lncRNA MIR7-3 host gene (MIR7-3HG) alleviates dexamethasone-induced dysfunction in pancreatic β-cells through the PI3K/AKT signaling pathway. Biochem Biophys Res Commun. 2023; 647(62–71. doi: 10.1016/j.bbrc.2023.01.004 [DOI] [PubMed] [Google Scholar]
22.Wang L, Jiang X, Wang L, Wang W, Fu C, Yan X, et al. A survey of transcriptome complexity using PacBio single-molecule real-time analysis combined with Illumina RNA sequencing for a better understanding of ricinoleic acid biosynthesis in Ricinus communis. BMC Genomics. 2019; 20(1): 456. doi: 10.1186/s12864-019-5832-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019; 37(8): 907–915. doi: 10.1038/s41587-019-0201-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Putri GH, Anders S, Pyl PT, Pimanda JE, Zanini F. Analysing high-throughput sequencing data in Python with HTSeq 2.0. Bioinformatics. 2022. doi: 10.1093/bioinformatics/btac166 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25(4): 402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
26.Xin Q, Cheng G, Kong F, Ji Q, Li H, Jiang W, et al. STAT1 transcriptionally regulates the expression of S1PR1 by binding its promoter region. Gene. 2020; 736(144417. doi: 10.1016/j.gene.2020.144417 [DOI] [PubMed] [Google Scholar]
27.Yang L, Wang L, Wu J, Wang Y. Circ_0000069 contributes to the growth, metastasis and glutamine metabolism in renal cell carcinoma (RCC) via regulating miR-125a-5p-dependent SLC1A5 expression. Transpl Immunol. 2023; 77(101764. doi: 10.1016/j.trim.2022.101764 [DOI] [PubMed] [Google Scholar]
28.Li Y, Chen H, Yang Q, Wan L, Zhao J, Wu Y, et al. Increased Drp1 promotes autophagy and ESCC progression by mtDNA stress mediated cGAS-STING pathway. J Exp Clin Cancer Res. 2022; 41(1): 76. doi: 10.1186/s13046-022-02262-z [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Korpal M, Ell BJ, Buffa FM, Ibrahim T, Blanco MA, Celià-Terrassa T, et al. Direct targeting of Sec23a by miR-200s influences cancer cell secretome and promotes metastatic colonization. Nat Med. 2011; 17(9): 1101–1108. doi: 10.1038/nm.2401 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Zheng J, Shao Y, Jiang Y, Chen F, Liu S, Yu N, et al. Tangeretin inhibits hepatocellular carcinoma proliferation and migration by promoting autophagy-related BECLIN1. Cancer Manag Res. 2019; 11(5231–5242. doi: 10.2147/CMAR.S200974 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
31.Pan MH, Chen WJ, Lin-Shiau SY, Ho CT, Lin JK. Tangeretin induces cell-cycle G1 arrest through inhibiting cyclin-dependent kinases 2 and 4 activities as well as elevating Cdk inhibitors p21 and p27 in human colorectal carcinoma cells. Carcinogenesis. 2002; 23(10): 1677–1684. doi: 10.1093/carcin/23.10.1677 [DOI] [PubMed] [Google Scholar]
32.Zhu WB, Xiao N, Liu XJ. Dietary flavonoid tangeretin induces reprogramming of epithelial to mesenchymal transition in prostate cancer cells by targeting the PI3K/Akt/mTOR signaling pathway. Oncol Lett. 2018; 15(1): 433–440. doi: 10.3892/ol.2017.7307 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Roshini A, Jagadeesan S, Arivazhagan L, Cho YJ, Lim JH, Doh YH, et al. pH-sensitive tangeretin-ZnO quantum dots exert apoptotic and anti-metastatic effects in metastatic lung cancer cell line. Mater Sci Eng C Mater Biol Appl. 2018; 92(477–488. doi: 10.1016/j.msec.2018.06.073 [DOI] [PubMed] [Google Scholar]
34.Skoda AM, Simovic D, Karin V, Kardum V, Vranic S, Serman L. The role of the Hedgehog signaling pathway in cancer: A comprehensive review. Bosn J Basic Med Sci. 2018; 18(1): 8–20. doi: 10.17305/bjbms.2018.2756 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, et al. Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo. Lab Invest. 2018; 98(11): 1384–1396. doi: 10.1038/s41374-018-0089-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Qin D, Jiang YR. Tangeretin Inhibition of High-Glucose-Induced IL-1β, IL-6, TGF-β1, and VEGF Expression in Human RPE Cells. J Diabetes Res. 2020; 2020(9490642. doi: 10.1155/2020/9490642 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Taya M, Hammes SR. Glycoprotein Non-Metastatic Melanoma Protein B (GPNMB) and Cancer: A Novel Potential Therapeutic Target. Steroids. 2018; 133(102–107. doi: 10.1016/j.steroids.2017.10.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Rose AAN, Biondini M, Curiel R, Siegel PM. Targeting GPNMB with glembatumumab vedotin: Current developments and future opportunities for the treatment of cancer. Pharmacol Ther. 2017; 179(127–141. doi: 10.1016/j.pharmthera.2017.05.010 [DOI] [PubMed] [Google Scholar]
39.Maiti S, Mondal S, Satyavarapu EM, Mandal C. mTORC2 regulates hedgehog pathway activity by promoting stability to Gli2 protein and its nuclear translocation. Cell Death Dis. 2017; 8(7): e2926. doi: 10.1038/cddis.2017.296 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
40.Horák P, Kreisingerová K, Réda J, Ondrušová L, Balko J, Vachtenheim J Jr., et al. The Hedgehog/GLI signaling pathway activates transcription of Slug (Snail2) in melanoma cells. Oncol Rep. 2023; 49(4). doi: 10.3892/or.2023.8512 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Zeng R, Duan L, Kong Y, Liang Y, Wu X, Wei X, et al. Clinicopathological and prognostic role of MMP-9 in esophageal squamous cell carcinoma: a meta-analysis. Chin J Cancer Res. 2013; 25(6): 637–645. doi: 10.3978/j.issn.1000-9604.2013.11.03 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Faião-Flores F, Alves-Fernandes DK, Pennacchi PC, Sandri S, Vicente AL, Scapulatempo-Neto C, et al. Targeting the hedgehog transcription factors GLI1 and GLI2 restores sensitivity to vemurafenib-resistant human melanoma cells. Oncogene. 2017; 36(13): 1849–1861. doi: 10.1038/onc.2016.348 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Zhang XJ, Cui ZH, Dong Y, Liang XW, Zhao YX, Baranova A, et al. GPNMB contributes to a vicious circle for chronic obstructive pulmonary disease. Biosci Rep. 2020; 40(6). doi: 10.1042/BSR20194459 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0291531.r001

Decision Letter 0

Arunava Roy

27 Feb 2023

PONE-D-23-03144The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMBPLOS ONE

Dear Dr. Yao,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Your manuscript has been reviewed by three independent reviewers and all of them provided positive reviews. You will find their individual comments below and notice that many of them suggests minor revisions. Only one experiment has been suggested by reviewer#3.

Please submit your revised manuscript by Apr 13 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Arunava Roy, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

7. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. Provide at least a reference for the given methodology mentioned in materials and methods.

2. In table 1, check the page format which affected the name EN1

3. Provide the scale bar for fig.1 & 7 B, arrange an original (un-edited) figure for the fig.1&7 B (Wound-healing assay) in supplementary info.

4. Figure 1 looks packed, it’s better to split into 2 figures for better visualization.

5. In the figure 1E and F, the resolution is poor to understand the differences between treated versus control. Increase resolution and mark the changes with arrow.

6. Provide the approval info in manuscript, regarding animal study and ethical concerns.

7. The figure 2D&E about Immunofluorescence for PCNA and MMP9, the finding are not clear. More resolution and highlight the difference.

8. Unable to read the legends of figure 3 and 5, please increase the resolution and font size.

Reviewer #2: In this manuscript, Quan Zhang et al., describes the anti-migration and anti-invasion properties of a flavonoid natural product tangeretin in esophageal squamous cell carcinoma (ESCC) cells. In xenograft tumor mouse model, tangeretin reduced the tumor growth and decreased the proliferation markers. Using gene silencing experiments, Chip assays, RNA seq and bioinformatic analysis, the authors have shown that suppression of GLI-2 mediated GPNMB transcription is responsible for the observed anticancer activity. Even though various publications highlight the potential anticancer properties of tangeretin, the results presented in this manuscript is interesting and the studies were well planned and executed. I would recommend this manuscript after addressing the following minor issues.

1. Scale bars should be included in figures or figure legends where fluorescent images were reported.

2. The author showed that tangeretin suppressed GLI-2 mediated GPNMB transcription in ESCC cells. Through invitro and invivo experiments the authors showed that tangeretin reduced the expression of MMP-9 levels. Is there a shared mechanism behind these two processes, or does GLI2 downregulation result in decreased MMP-9 expression in ESCC? For example, various articles (example. Chin J Cancer Res. 25(6), 637–645) explaining the role of MMP-9 in ESCC and other cancers. Especially, Faião-Flores et al., (Oncogene, 36, 2017, 1849–186) showed that downregulating GLI2 expression leads to reduced MMP-9 expression in melanoma cell lines. In line with these findings, I would recommend the authors to briefly discuss about this relationship in the manuscript.

3. Even though tangeretin acts by downregulating GLI2 transcription factor, the molecular target of tangeretin is still unknown. I would encourage the authors to briefly comment about the upstream activators of GLI2 as the possible molecular target of tangeretin.

4. Is there any weight loss noticed with the treatment group compared to the control group in vivo tumor xenograft studies?

5. In the abstract, background section, the following sentence should be rewritten,

“However, the precise action of Tan in the development of esophageal squamous cell carcinoma (ESCC) has remained a mystery”

6. The manuscript will get benefit from additional English proof reading.

Reviewer #3: Remarks to the Author:

The article “The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by

inhibiting GLI2-mediated transcription of GPNMB’’ is an interesting study detecting the effect of tangeretin on migration and invasion in esophageal cancer cells by downregulating GLI2-mediated transcription.

However, the existing data are partially supportive of the authors' conclusions. Additional experiments are needed to fully support their findings. Minor revision is needed in recommending this manuscript for publication.

Minor issues:

1. In Fig.1A the author mentioned that the IC50 of tangeretin in TE-1 and KYSE150 is 85.92 and 94.34 μg/ml respectively, but why the author has selected the dose of 20 μg/ml concentration for evaluation of the anti-migratory effect tangeretin in these cells is unclear. Moreover, the IC50 value of tangeretin in normal esophageal cells need to be included in the result. The effect of tangeretin on normal cell growth and proliferation need to be included.

2. Authors mentioned that Gli2 downregulation by tangeretin causes reduction in cancer cell migration and invasion. Authors only showed the expression of MMP9 and PCNA, but Gli2 itself controls the transcription of EMT (epithelial-mesenchymal transition) specific molecules like Slug, Snail and also controls molecules like VEGF, Cyclin D1, Cyclin D2, Cyclin E. Hence the effect of tangeretin on the expression these proteins should be determined by western blot analysis.

3. The resolution of Fig 3 (A-D), Fig. 5 A,B are very poor and should be changed with higher resolution figures.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Jun 26;19(6):e0291531. doi: 10.1371/journal.pone.0291531.r002

Author response to Decision Letter 0

24 Jun 2023

Dear Editor,

We have revised the manuscript according to Reviewers’ comments and journal requirements. We look forward to hearing from you. Thank you very much.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: We have revised the style and ensured that our manuscript meets PLOS ONE’s style requirements.

Response: We have added the details about the above questions in the Revised manuscript.

In your revised cover letter, please address the following prompts:

We will update your Data Availability statement on your behalf to reflect the information you provide.

Response: We have provided raw images including all western blots and wound-healing assays in the Supporting Information.

Response: We have provided all raw images for western blot in the Supporting Information in the Revised manuscript.

Response: We have added the ORCID iD of the corresponding author in the Revised manuscript.

Response: We have added captions for the Supporting Information files at the end of our Revised manuscript.

[Note: HTML markup is below. Please do not edit.]

Response: We have checked the reference list and ensured that no retracted documents were cited in our manuscript. We have also revised the reference style according to the PLOS ONE's style requirements in the Revised manuscript.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

5. Review Comments to the Author

Reviewer #1:

1. Provide at least a reference for the given methodology mentioned in materials and methods.

Response: Thank you for your valuable suggestion. We have provided references for the methods in the Revised manuscript.

2. In table 1, check the page format which affected the name EN1

Response: Thank you. We have checked the page format, and revised it.

3. Provide the scale bar for fig.1 & 7 B, arrange an original (un-edited) figure for the fig.1&7 B (Wound-healing assay) in supplementary info.

Response: Thank you for your kind recommendations. We have added the scale bars in Revised Figure 1 and 7 and manuscript. We also provided the original figures for wound-healing assay in the Supporting information.

4. Figure 1 looks packed, it’s better to split into 2 figures for better visualization.

Response: We have split the Figure 1 into 2 figures in the Revised manuscript.

5. In the figure 1E and F, the resolution is poor to understand the differences between treated versus control. Increase resolution and mark the changes with arrow.

Response: Thank you for your valuable suggestion. We have increased resolution in the Revised Figure 2A and 2B. In these assays, Tan reduced the expression of PCNA and MMP9 in ESCC cells, as presented by the reduced mean green fluorescence intensity.

6. Provide the approval info in manuscript, regarding animal study and ethical concerns.

Response: We have provided the approval info in manuscript, regarding animal study and ethical concerns in the Revised manuscript as below.

All animal procedures were conducted in accordance with a protocol approved by Animal Care and Use Committee of Henan Provincial People's Hospital. (page 9, paragraph 2)

7. The figure 2D&E about Immunofluorescence for PCNA and MMP9, the finding are not clear. More resolution and highlight the difference.

Response: According to the comment, we have provided more resolution pictures in the Revised Figure 3D and 3E. In these assays, Tan reduced the expression of PCNA and MMP9 in xenograft tumors, as presented by the reduced PCNA positive cells (red-stained cells) and mean red fluorescence intensity of MMP9, respectively.

8. Unable to read the legends of figure 3 and 5, please increase the resolution and font size.

Response: Thank you for your valuable suggestion. We have increased the solution and font size in the Revised Figure 4 and 6.

Reviewer #2:

In this manuscript, Quan Zhang et al., describes the anti-migration and anti-invasion properties of a flavonoid natural product tangeretin in esophageal squamous cell carcinoma (ESCC) cells. In xenograft tumor mouse model, tangeretin reduced the tumor growth and decreased the proliferation markers. Using gene silencing experiments, Chip assays, RNA seq and bioinformatic analysis, the authors have shown that suppression of GLI-2 mediated GPNMB transcription is responsible for the observed anticancer activity. Even though various publications highlight the potential anticancer properties of tangeretin, the results presented in this manuscript is interesting and the studies were well planned and executed. I would recommend this manuscript after addressing the following minor issues.

1. Scale bars should be included in figures or figure legends where fluorescent images were reported.

Response: Thank you for your valuable suggestion. We have added scale bars in Revised figures and figure legends.

2. The author showed that tangeretin suppressed GLI-2 mediated GPNMB transcription in ESCC cells. Through in vitro and in vivo experiments, the authors showed that tangeretin reduced the expression of MMP-9 levels. Is there a shared mechanism behind these two processes, or does GLI2 downregulation result in decreased MMP-9 expression in ESCC? For example, various articles (example. Chin J Cancer Res. 25(6), 637–645) explaining the role of MMP-9 in ESCC and other cancers. Especially, Faião-Flores et al., (Oncogene, 36, 2017, 1849–186) showed that downregulating GLI2 expression leads to reduced MMP-9 expression in melanoma cell lines. In line with these findings, I would recommend the authors to briefly discuss about this relationship in the manuscript.

Response: Thank you for your valuable suggestion. We have discussed the related relationship in the Revised manuscript as below.

Additionally, MMP9 is a crucial regulator implicated in ESCC outcome and prognosis [41], and its expression can be regulated by GLI2 in melanoma cells [42]. A previous document proved the modulation of GPNMB in MMP9 in chronic obstructive pulmonary disease [43]. Our data also showed that Tan can down-regulate MMP9 expression by diminishing GPNMB level in ESCC cells. With these findings, we speculate that Tan in ESCC cells down-regulates MMP9 expression by suppressing GLI2-mediated GPNMB transcription. (discussion section, page 16-17, paragraph 2)

Response: According to the comment, we have added the discussion about the mechanism by which tangeretin downregulates GLI2 in the Revised manuscript as below.

In addition to the Hedgehog signaling, GLI2 has identified as a direct target of the TGF-β/SMAD pathway [13]. Previous work also uncovered the inhibition of Tan in TGF-β1 expression in human retinal pigment epithelial cells [36]. These conclusions suggest that Tan may reduce GLI2 expression by suppressing the TGF-β/SMAD pathway. Related field research is warranted in future work. (discussion section, page 15-16, paragraph 3)

4. Is there any weight loss noticed with the treatment group compared to the control group in vivo tumor xenograft studies?

Response: In this study, the generated xenograft tumors have little effect on the animal’s health and behavior. Owing to the light xenograft weight, there was no significant difference in body weight between the treatment group and the control group.

5. In the abstract, background section, the following sentence should be rewritten,

“However, the precise action of Tan in the development of esophageal squamous cell carcinoma (ESCC) has remained a mystery”

Response: We have revised the sentence to “However, the precise role of Tan in the development of esophageal squamous cell carcinoma (ESCC) remains unclear” in the Revised manuscript.

6. The manuscript will get benefit from additional English proof reading.

Response: Thank you for your valuable suggestion. According to the comment, we have re-revised the English in the Revised manuscript as below (for instance).

eg. Functional studies in various cancer cell lines have highlighted the tumor-inhibitory potential of Tan [8-10], but its precise action in ESCC pathogenesis remains unclear. (introduction section, page 12, paragraph 2)

eg. A loop graph was drawn for the visualization of the enrichment results. (method section, page 5, paragraph 2)

eg. We identified 587 genes with a significant variation following Tan treatment in TE-1 cells, in which 361 genes were down-regulated and 226 genes were up-regulated (S1 Table), and the cluster heat map of differentially expressed genes was shown in Fig 4A. (result 3 section, page 11, paragraph 2)

eg. Emerging evidence supports the notion that Tan exhibits potent anti-tumor efficacy against numerous human cancers [5,6]. (discussion section, page 14, paragraph 4)

Reviewer #3:

Remarks to the Author:

The article “The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by

Minor issues:

Response: Thank you for your kind recommendations. Based on the use of 1/5-1/2 IC50 of tangeretin in studies studying the effect of tangeretin on cancer cell behaviors, we used 20 μg/ml concentration (1/4-1/5) to assay the effect of tangeratin on ESCC cell migration and invasion in this study. In this study, we found that 20 μg/ml of tangeretin can significantly repress ESCC cell migration and invasion. When the concentration of tangeratin is high, the cell viability and migration will be significantly inhibited, which is not conducive to the study of the mechanism of tangeratin (rescue experiments). According to the comment, we have added the IC50 value of tangeretin in normal esophageal HET-1A cells to show the effect of tangeretin on cell growth in the S1 Fig and Revised manuscript as below.

Intriguingly, Tan (1-100 μg/ml) did not significantly affect the growth of normal esophageal HET-1A cells, and the IC50 value of Tan was 520.6 μg/ml against HET-1A cells (S1 Fig), suggesting the safety of Tan at low doses as an anti-tumor drug. (page 15, paragraph 2)

2. Authors mentioned that Gli2 downregulation by tangeretin causes reduction in cancer cell migration and invasion. Authors only showed the expression of MMP9 and PCNA, but Gli2 itself controls the transcription of EMT (epithelial-mesenchymal transition) specific molecules like Slug, Snail and also controls molecules like VEGF, Cyclin D1, Cyclin D2, Cyclin E. Hence, the effect of tangeretin on the expression these proteins should be determined by western blot analysis.

Response: Thank you for your valuable comments. According to the comment, we have added the discussion in the Revised manuscript as below.

Some important metastasis-related markers, such as EMT specific molecule Snail, angiogenesis-related molecule VEGF, and cell cycle regulator Cyclin D1, have been identified as target genes of GLI2 TF [39,40]. Our data also uncovered the repression of Tan in the expression of Slug, Snail, VEGF, and Cyclin D1 in ESCC cells (S2 Fig), suggesting that Tan may downregulate their expression via GLI2 and thus influences ESCC metastasis. (page 16, paragraph 2)

3. The resolution of Fig 3 (A-D), Fig. 5 A, B are very poor and should be changed with higher resolution figures.

Response: Thank you for your kind recommendations. We have provided higher resolution figures in the Revised Figure 3 and 5.

________________________________________

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Attachment

Submitted filename: Response to Reviewers.docx

pone.0291531.s008.docx^{(57KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0291531.r003

Decision Letter 1

Arunava Roy

17 Jul 2023

PONE-D-23-03144R1The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMBPLOS ONE

Dear Dr. Yao,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The original reviewers reviewed the revised manuscript, and though they overall had positive recommendations, two of them suggested minor changes.

Please submit your revised manuscript by Aug 31 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Arunava Roy, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: The revised manuscript entitled "The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB" is addressed all the concerns raised by reviewers.

The manuscript could be accepted after quality check especially the figures.

Reviewer #2: The authors made necessary changes in the manuscript. I recommend accepting the manuscript. However, the following typos should be modified to provide a clear message to the readers.

1. Furthermore, Tan is the capacity of enhancing the sensitivity of the drugs and reducing the toxicity induced by chemotherapy

2. A previous document proved the modulation of GPNMB in MMP9 in chronic obstructive pulmonary disease.

3. Therefore, while studying the anti-cancer mechanism of Tan, it is very important to study how overcomes these limitations for enhancing the therapeutic efficacy and reaching the clinical use

Reviewer #3: Remarks to the Author:

The article “The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by

inhibiting GLI2-mediated transcription of GPNMB’’ is an interesting study. Minor revision is needed in recommending this manuscript for publication.

Minor issues:

The Quality of the images should be increased.

1. In Fig.1A, 1B, 1C, 1D need to be replaced with high resolution images. All the cell images 1B, 1C need scale bars as many of them lack scale bars into it. In fig. 1A and the graphs in Fig. 1B, 1C and 1D the font size should be increased for clear visibility.

2. In Fig.2 A and 2B all the fluorescent images needed scale bars into it. The font size of the graphs in these figure need to be increased.

3. Fig. 3E needs to be changed with high resolution image.

4. Fig. 4A, 4B, 4C font size need to be increased.

5. Fig. 6A, 6B need to be needs to be changed with high resolution images with increased font size.

6. Font size of fig.7B needs to be increased.

7. Fig. 8C, 8D and 8E needs to be changed with high resolution images and scale bars must be added in each cell images.

8. Fig. 9A, 9B scale bars need to be added in each immunofluorescence cell images.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Jayaprakash Narayana Kolla

Reviewer #2: No

Reviewer #3: No

**********

Attachment

Submitted filename: Review comments.docx

pone.0291531.s009.docx^{(12.2KB, docx)}

PLoS One. 2024 Jun 26;19(6):e0291531. doi: 10.1371/journal.pone.0291531.r004

Author response to Decision Letter 1

28 Aug 2023

PONE-D-23-03144R1

The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB

PLOS ONE

Dear Dr. Yao,

The original reviewers reviewed the revised manuscript, and though they overall had positive recommendations, two of them suggested minor changes.

Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Arunava Roy, Ph.D.

Academic Editor

PLOS ONE

Dear Editor,

We have revised the manuscript according to Reviewers’ comments and journal requirements. We look forward to hearing from you. Thank you very much.

Journal Requirements:

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

________________________________________

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

________________________________________

6. Review Comments to the Author

The manuscript could be accepted after quality check especially the figures.

Response: We have improved the quality of the manuscript including the figures in the Revised manuscript.

Reviewer #2: The authors made necessary changes in the manuscript. I recommend accepting the manuscript. However, the following typos should be modified to provide a clear message to the readers.

1. Furthermore, Tan is the capacity of enhancing the sensitivity of the drugs and reducing the toxicity induced by chemotherapy

Response: We have changed the sentence to “Furthermore, Tan enhances the sensitivity of the chemotherapy drugs and reduces chemotherapy-induced toxicity” in the Revised manuscript.

2. A previous document proved the modulation of GPNMB in MMP9 in chronic obstructive pulmonary disease.

Response: We have changed the sentence to “A previous document proved that GPNMB can influence MMP9 expression in chronic obstructive pulmonary disease” in the Revised manuscript.

3. Therefore, while studying the anti-cancer mechanism of Tan, it is very important to study how overcomes these limitations for enhancing the therapeutic efficacy and reaching the clinical use

Response: We have changed the sentence to “Therefore, it is very important to study how these limitations are resolved for their clinical use.” in the Revised manuscript.

Reviewer #3: Remarks to the Author:

The article “The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB’’ is an interesting study. Minor revision is needed in recommending this manuscript for publication.

Minor issues:

The Quality of the images should be increased.

Response: According to the comment, we have provided high resolution images and increased the font size in the Revised Figure 1.

2. In Fig.2 A and 2B all the fluorescent images needed scale bars into it. The font size of the graphs in these figures need to be increased.

Response: We have added scale bars for all the fluorescent images and increased the font size in the Revised Figure 2.

3. Fig. 3E needs to be changed with high resolution image.

Response: We have provided higher resolution images in the Revised Figure 3.

4. Fig. 4A, 4B, 4C font size need to be increased.

Response: We have increased the font size in the Revised Figure 4.

5. Fig. 6A, 6B need to be needs to be changed with high resolution images with increased font size.

Response: We have changed with high resolution images with increased font size in the Revised Figure 6A and 6B.

6. Font size of fig.7B needs to be increased.

Response: We have added the font size in the Revised Figure 7B.

7. Fig. 8C, 8D and 8E needs to be changed with high resolution images and scale bars must be added in each cell images.

Response: We have changed with high resolution images and added scale bars for all microscopy images in the Revised Figure 8.

8. Fig. 9A, 9B scale bars need to be added in each immunofluorescence cell images.

Response: We have added scale bars in each immunofluorescence cell images in the Revised Figure 9.

________________________________________

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Jayaprakash Narayana Kolla

Reviewer #2: No

Reviewer #3: No

________________________________________

In compliance with data protection regulations, you may request that we remove your personal registration details at any time. (Remove my information/details). Please contact the publication office if you have any questions.

Attachment

Submitted filename: Response to Reviewers.docx

pone.0291531.s010.docx^{(27.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0291531.r005

Decision Letter 2

Arunava Roy

1 Sep 2023

The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB

PONE-D-23-03144R2

Dear Dr. Yao,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Arunava Roy, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0291531.r006

Acceptance letter

Arunava Roy

4 Jan 2024

PONE-D-23-03144R2

PLOS ONE

Dear Dr. Yao,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Arunava Roy

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. The IC50 value of Tan in normal esophageal HET-1A cells.

(TIF)

pone.0291531.s001.tif^{(113.2KB, tif)}

S2 Fig. Effect of Tan on the expression of VEGF, Slug, Snail and Cyclin D1.

(TIF)

pone.0291531.s002.tif^{(457.8KB, tif)}

S1 Table. The 587 genes with a significant variation following Tan treatment in TE-1 cells.

(XLSX)

pone.0291531.s003.xlsx^{(134.6KB, xlsx)}

S2 Table. The all 1665 human transcriptional factors.

(XLSX)

pone.0291531.s004.xlsx^{(109.9KB, xlsx)}

S3 Table. The differentially expressed genes in ESCC tissues and normal esophageal tissues using the TCGA database.

(XLSX)

pone.0291531.s005.xlsx^{(595.8KB, xlsx)}

S4 Table. The genes that could be regulated by GLI2 from hTF-target database.

(XLSX)

pone.0291531.s006.xlsx^{(117.4KB, xlsx)}

S1 Raw images

(PDF)

pone.0291531.s007.pdf^{(1.5MB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0291531.s008.docx^{(57KB, docx)}

Attachment

Submitted filename: Review comments.docx

pone.0291531.s009.docx^{(12.2KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0291531.s010.docx^{(27.6KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0291531.ref001] 1.Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021; 71(3): 209–249. doi: 10.3322/caac.21660 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref002] 2.Reichenbach ZW, Murray MG, Saxena R, Farkas D, Karassik EG, Klochkova A, et al. Clinical and translational advances in esophageal squamous cell carcinoma. Adv Cancer Res. 2019; 144(95–135. doi: 10.1016/bs.acr.2019.05.004 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref003] 3.Leng XF, Daiko H, Han YT, Mao YS. Optimal preoperative neoadjuvant therapy for resectable locally advanced esophageal squamous cell carcinoma. Ann N Y Acad Sci. 2020; 1482(1): 213–224. doi: 10.1111/nyas.14508 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref004] 4.Ashrafizadeh M, Ahmadi Z, Mohammadinejad R, Ghasemipour Afshar E. Tangeretin: a mechanistic review of its pharmacological and therapeutic effects. J Basic Clin Physiol Pharmacol. 2020; 31(4). doi: 10.1515/jbcpp-2019-0191 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref005] 5.Raza W, Luqman S, Meena A. Prospects of tangeretin as a modulator of cancer targets/pathways. Pharmacol Res. 2020; 161(105202. doi: 10.1016/j.phrs.2020.105202 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref006] 6.Arafa EA, Shurrab NT, Buabeid MA. Therapeutic Implications of a Polymethoxylated Flavone, Tangeretin, in the Management of Cancer via Modulation of Different Molecular Pathways. Adv Pharmacol Pharm Sci. 2021; 2021(4709818. doi: 10.1155/2021/4709818 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref007] 7.Alhamad DW, Elgendy SM, Al-Tel TH, Omar HA. Tangeretin as an adjuvant and chemotherapeutic sensitizer against various types of cancers: a comparative overview. J Pharm Pharmacol. 2021; 73(5): 601–610. doi: 10.1093/jpp/rgab013 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref008] 8.Hermawan A, Putri H, Hanif N, Ikawati M. Integrative Bioinformatics Study of Tangeretin Potential Targets for Preventing Metastatic Breast Cancer. Evid Based Complement Alternat Med. 2021; 2021(2234554. doi: 10.1155/2021/2234554 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref009] 9.P S, K L. Anti-tumorigenic Efficacy of Tangeretin in Liver Cancer—An In Silico Approach. Curr Comput Aided Drug Des. 2021; 17(3): 337–343. doi: 10.2174/1573409916666200219120254 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref010] 10.Lin JJ, Huang CC, Su YL, Luo HL, Lee NL, Sung MT, et al. Proteomics Analysis of Tangeretin-Induced Apoptosis through Mitochondrial Dysfunction in Bladder Cancer Cells. Int J Mol Sci. 2019; 20(5). doi: 10.3390/ijms20051017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref011] 11.Lambert M, Jambon S, Depauw S, David-Cordonnier MH. Targeting Transcription Factors for Cancer Treatment. Molecules. 2018; 23(6). doi: 10.3390/molecules23061479 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref012] 12.Han W, Allam SA, Elsawa SF. GLI2-Mediated Inflammation in the Tumor Microenvironment. Adv Exp Med Biol. 2020; 1263(55–65. doi: 10.1007/978-3-030-44518-8_5 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref013] 13.Javelaud D, Alexaki VI, Dennler S, Mohammad KS, Guise TA, Mauviel A. TGF-β/SMAD/GLI2 signaling axis in cancer progression and metastasis. Cancer Res. 2011; 71(17): 5606–5610. doi: 10.1158/0008-5472.CAN-11-1194 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref014] 14.Xia L, Bouamar H, Gu X, Zeballos C, Qin T, Wang B, et al. Gli2 mediates the development of castration‑resistant prostate cancer. Int J Oncol. 2020; 57(1): 100–112. doi: 10.3892/ijo.2020.5044 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref015] 15.Bai JY, Jin B, Ma JB, Liu TJ, Yang C, Chong Y, et al. HOTAIR and androgen receptor synergistically increase GLI2 transcription to promote tumor angiogenesis and cancer stemness in renal cell carcinoma. Cancer Lett. 2021; 498(70–79. doi: 10.1016/j.canlet.2020.10.031 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref016] 16.Ichimiya S, Onishi H, Nagao S, Koga S, Sakihama K, Nakayama K, et al. GLI2 but not GLI1/GLI3 plays a central role in the induction of malignant phenotype of gallbladder cancer. Oncol Rep. 2021; 45(3): 997–1010. doi: 10.3892/or.2021.7947 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref017] 17.Katoh Y, Katoh M. Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med. 2009; 9(7): 873–886. doi: 10.2174/156652409789105570 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref018] 18.Zhang Y, Zheng A, Xu R, Zhou F, Hao A, Yang H, et al. NR2F1-induced NR2F1-AS1 promotes esophageal squamous cell carcinoma progression via activating Hedgehog signaling pathway. Biochem Biophys Res Commun. 2019; 519(3): 497–504. doi: 10.1016/j.bbrc.2019.09.015 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref019] 19.Chen PY, Chao TY, Hsu HJ, Wang CY, Lin CY, Gao WY, et al. The Lipid-Modulating Effect of Tangeretin on the Inhibition of Angiopoietin-like 3 (ANGPTL3) Gene Expression through Regulation of LXRα Activation in Hepatic Cells. Int J Mol Sci. 2021; 22(18). doi: 10.3390/ijms22189853 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref020] 20.Ko YC, Choi HS, Liu R, Kim JH, Kim SL, Yun BS, et al. Inhibitory Effects of Tangeretin, A Citrus Peel-Derived Flavonoid, on Breast Cancer Stem Cell Formation through Suppression of Stat3 Signaling. Molecules. 2020; 25(11). doi: 10.3390/molecules25112599 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref021] 21.Mao X, Zhou J, Kong L, Zhu L, Yang D, Zhang Z. A peptide encoded by lncRNA MIR7-3 host gene (MIR7-3HG) alleviates dexamethasone-induced dysfunction in pancreatic β-cells through the PI3K/AKT signaling pathway. Biochem Biophys Res Commun. 2023; 647(62–71. doi: 10.1016/j.bbrc.2023.01.004 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref022] 22.Wang L, Jiang X, Wang L, Wang W, Fu C, Yan X, et al. A survey of transcriptome complexity using PacBio single-molecule real-time analysis combined with Illumina RNA sequencing for a better understanding of ricinoleic acid biosynthesis in Ricinus communis. BMC Genomics. 2019; 20(1): 456. doi: 10.1186/s12864-019-5832-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref023] 23.Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019; 37(8): 907–915. doi: 10.1038/s41587-019-0201-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref024] 24.Putri GH, Anders S, Pyl PT, Pimanda JE, Zanini F. Analysing high-throughput sequencing data in Python with HTSeq 2.0. Bioinformatics. 2022. doi: 10.1093/bioinformatics/btac166 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref025] 25.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25(4): 402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref026] 26.Xin Q, Cheng G, Kong F, Ji Q, Li H, Jiang W, et al. STAT1 transcriptionally regulates the expression of S1PR1 by binding its promoter region. Gene. 2020; 736(144417. doi: 10.1016/j.gene.2020.144417 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref027] 27.Yang L, Wang L, Wu J, Wang Y. Circ_0000069 contributes to the growth, metastasis and glutamine metabolism in renal cell carcinoma (RCC) via regulating miR-125a-5p-dependent SLC1A5 expression. Transpl Immunol. 2023; 77(101764. doi: 10.1016/j.trim.2022.101764 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref028] 28.Li Y, Chen H, Yang Q, Wan L, Zhao J, Wu Y, et al. Increased Drp1 promotes autophagy and ESCC progression by mtDNA stress mediated cGAS-STING pathway. J Exp Clin Cancer Res. 2022; 41(1): 76. doi: 10.1186/s13046-022-02262-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref029] 29.Korpal M, Ell BJ, Buffa FM, Ibrahim T, Blanco MA, Celià-Terrassa T, et al. Direct targeting of Sec23a by miR-200s influences cancer cell secretome and promotes metastatic colonization. Nat Med. 2011; 17(9): 1101–1108. doi: 10.1038/nm.2401 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref030] 30.Zheng J, Shao Y, Jiang Y, Chen F, Liu S, Yu N, et al. Tangeretin inhibits hepatocellular carcinoma proliferation and migration by promoting autophagy-related BECLIN1. Cancer Manag Res. 2019; 11(5231–5242. doi: 10.2147/CMAR.S200974 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[pone.0291531.ref031] 31.Pan MH, Chen WJ, Lin-Shiau SY, Ho CT, Lin JK. Tangeretin induces cell-cycle G1 arrest through inhibiting cyclin-dependent kinases 2 and 4 activities as well as elevating Cdk inhibitors p21 and p27 in human colorectal carcinoma cells. Carcinogenesis. 2002; 23(10): 1677–1684. doi: 10.1093/carcin/23.10.1677 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref032] 32.Zhu WB, Xiao N, Liu XJ. Dietary flavonoid tangeretin induces reprogramming of epithelial to mesenchymal transition in prostate cancer cells by targeting the PI3K/Akt/mTOR signaling pathway. Oncol Lett. 2018; 15(1): 433–440. doi: 10.3892/ol.2017.7307 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref033] 33.Roshini A, Jagadeesan S, Arivazhagan L, Cho YJ, Lim JH, Doh YH, et al. pH-sensitive tangeretin-ZnO quantum dots exert apoptotic and anti-metastatic effects in metastatic lung cancer cell line. Mater Sci Eng C Mater Biol Appl. 2018; 92(477–488. doi: 10.1016/j.msec.2018.06.073 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref034] 34.Skoda AM, Simovic D, Karin V, Kardum V, Vranic S, Serman L. The role of the Hedgehog signaling pathway in cancer: A comprehensive review. Bosn J Basic Med Sci. 2018; 18(1): 8–20. doi: 10.17305/bjbms.2018.2756 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref035] 35.Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, et al. Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo. Lab Invest. 2018; 98(11): 1384–1396. doi: 10.1038/s41374-018-0089-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref036] 36.Qin D, Jiang YR. Tangeretin Inhibition of High-Glucose-Induced IL-1β, IL-6, TGF-β1, and VEGF Expression in Human RPE Cells. J Diabetes Res. 2020; 2020(9490642. doi: 10.1155/2020/9490642 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref037] 37.Taya M, Hammes SR. Glycoprotein Non-Metastatic Melanoma Protein B (GPNMB) and Cancer: A Novel Potential Therapeutic Target. Steroids. 2018; 133(102–107. doi: 10.1016/j.steroids.2017.10.013 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref038] 38.Rose AAN, Biondini M, Curiel R, Siegel PM. Targeting GPNMB with glembatumumab vedotin: Current developments and future opportunities for the treatment of cancer. Pharmacol Ther. 2017; 179(127–141. doi: 10.1016/j.pharmthera.2017.05.010 [DOI] [PubMed] [Google Scholar]

[pone.0291531.ref039] 39.Maiti S, Mondal S, Satyavarapu EM, Mandal C. mTORC2 regulates hedgehog pathway activity by promoting stability to Gli2 protein and its nuclear translocation. Cell Death Dis. 2017; 8(7): e2926. doi: 10.1038/cddis.2017.296 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[pone.0291531.ref040] 40.Horák P, Kreisingerová K, Réda J, Ondrušová L, Balko J, Vachtenheim J Jr., et al. The Hedgehog/GLI signaling pathway activates transcription of Slug (Snail2) in melanoma cells. Oncol Rep. 2023; 49(4). doi: 10.3892/or.2023.8512 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref041] 41.Zeng R, Duan L, Kong Y, Liang Y, Wu X, Wei X, et al. Clinicopathological and prognostic role of MMP-9 in esophageal squamous cell carcinoma: a meta-analysis. Chin J Cancer Res. 2013; 25(6): 637–645. doi: 10.3978/j.issn.1000-9604.2013.11.03 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref042] 42.Faião-Flores F, Alves-Fernandes DK, Pennacchi PC, Sandri S, Vicente AL, Scapulatempo-Neto C, et al. Targeting the hedgehog transcription factors GLI1 and GLI2 restores sensitivity to vemurafenib-resistant human melanoma cells. Oncogene. 2017; 36(13): 1849–1861. doi: 10.1038/onc.2016.348 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291531.ref043] 43.Zhang XJ, Cui ZH, Dong Y, Liang XW, Zhao YX, Baranova A, et al. GPNMB contributes to a vicious circle for chronic obstructive pulmonary disease. Biosci Rep. 2020; 40(6). doi: 10.1042/BSR20194459 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

The anti-tumor activity of tangeretin in esophageal squamous cell carcinoma by inhibiting GLI2-mediated transcription of GPNMB

Dong Yang

Quan Zhang

Haoyong Kuang

Jian Liu

Sen Wu

Li Wei

Wenjian Yao

Roles

Abstract

Introduction

Materials and methods

Cell culture and treatment

Determination of cell survival after Tan treatment

RNA sequencing

Bioinformatics analysis

siRNAs, plasmids and cell transfection

qRT-PCR of mRNA in ESCC cell lines

Table 1. Primers sequences used for qRT-PCR.

Western blot

Luciferase reporter assay

Chromatin immunoprecipitation (ChIP) assay

Measuring cell migration by wound-healing assay

Transwell migration and invasion assays

Xenograft studies

Immunofluorescence

Statistical analysis

Results

Tan exerts anti-migration and anti-invasion functions in ESCC cells in vitro

Fig 1. Anti-migration and anti-invasion effects of Tan in TE-1 and KYSE150 ESCC cells.

Fig 2. Regulation of Tan in PCNA and MMP9 expression in ESCC cells.

Tan diminishes tumor growth in vivo

Fig 3. The tumor-inhibitory effect of Tan in vivo.

Transcriptional profiling of Tan-treated ESCC cells and selection of the regulatory TFs of Tan in ESCC

Fig 4. Selection of TFs that were up-regulated in ESCC and were inhibited by Tan treatment in TE-1 ESCC cells.

Tan reduces the expression and transcriptional activity of GLI2 in ESCC cells

Fig 5. Tan inhibits the expression and transcriptional activity of GLI2 in ESCC cells.

Tan down-regulates GPNMB expression by suppressing GLI2-mediated transcription of GPNMB in ESCC cells

Fig 6. GPNMB is a potential target gene of GLI2 in ESCC cells.

Fig 7. Tan inhibits GPNMB expression via GLI2-mediated transcription of GPNMB in ESCC cells.

Re-expression of GPNMB reverses anti-migration and anti-invasion functions of Tan in ESCC cells

Fig 8. Anti-migration and anti-invasion activities of Tan in ESCC cells are due to the down-regulation of GPNMB.

Fig 9. Regulation of Tan in the expression of PCNA and MMP9 in ESCC cells through GPNMB.

Discussion

Conclusions

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Arunava Roy

Roles

Author response to Decision Letter 0

Decision Letter 1

Arunava Roy

Roles

Author response to Decision Letter 1

Decision Letter 2

Arunava Roy

Roles

Acceptance letter

Arunava Roy

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases