Skip to main content
PLOS Pathogens logoLink to PLOS Pathogens
. 2024 Jun 17;20(6):e1012296. doi: 10.1371/journal.ppat.1012296

Wolbachia mediates crosstalk between miRNA and Toll pathways to enhance resistance to dengue virus in Aedes aegypti

Lingzhi She 1,2,#, Mengyi Shi 1,2,#, Ting Cao 1,2,#, Hao Yuan 1,2,#, Renke Wang 1,2,#, Weifeng Wang 1,2,3, Yueting She 1,2, Chaojun Wang 1,2, Qin Zeng 1,2,4, Wei Mao 1,2, Yalan Zhang 1,2, Yong Wang 5, Zhiyong Xi 6,*, Xiaoling Pan 1,2,*
Editor: Matthew C Wolfgang7
PMCID: PMC11213346  PMID: 38885278

Abstract

The obligate endosymbiont Wolbachia induces pathogen interference in the primary disease vector Aedes aegypti, facilitating the utilization of Wolbachia-based mosquito control for arbovirus prevention, particularly against dengue virus (DENV). However, the mechanisms underlying Wolbachia-mediated virus blockade have not been fully elucidated. Here, we report that Wolbachia activates the host cytoplasmic miRNA biogenesis pathway to suppress DENV infection. Through the suppression of the long noncoding RNA aae-lnc-2268 by Wolbachia wAlbB, aae-miR-34-3p, a miRNA upregulated by the Wolbachia strains wAlbB and wMelPop, promoted the expression of the antiviral effector defensin and cecropin genes through the Toll pathway regulator MyD88. Notably, anti-DENV resistance induced by Wolbachia can be further enhanced, with the potential to achieve complete virus blockade by increasing the expression of aae-miR-34-3p in Ae. aegypti. Furthermore, the downregulation of aae-miR-34-3p compromised Wolbachia-mediated virus blockade. These findings reveal a novel mechanism by which Wolbachia establishes crosstalk between the cytoplasmic miRNA pathway and the Toll pathway via aae-miR-34-3p to strengthen antiviral immune responses against DENV. Our results will aid in the advancement of Wolbachia for arbovirus control by enhancing its virus-blocking efficiency.

Author summary

Although the involvement of miRNAs has been reported in the symbiosis of Wolbachia in Ae. aegypti, the role of miRNAs in the significant strong virus inhibition by Wolbachia wAlbB is poorly understood. To our knowledge, we illustrated a novel miRNA-based antiviral mechanism involved in Wolbachia-mediated viral interference according to the first global analysis of miRNA differential expression triggered by Wolbachia wAlbB. Our findings could improve the understanding of miRNA functions involved in interactions among symbiotic bacteria, arboviruses, and mosquito hosts. In particular, we identified an antiviral miRNA that could enhance the Wolbachia-mediated antiviral immune response in Ae. aegypti, suggesting that this novel molecule could improve mosquito control techniques to combat the current resurgence of dengue and other arbovirus diseases.

Introduction

The global surge in dengue incidence across various geographic regions in recent decades has escalated the worldwide challenges associated with dengue epidemics [1]. However, due to the lack of specific therapeutics and effective vaccines for use against all serotypes of dengue virus (DENV) [2], vector control has remained the key strategy in dengue prevention and control. As a prominent innovative strategy, Wolbachia-based mosquito control techniques have been recommended for dengue prevention by the World Health Organization (WHO). An important theoretical basis for this technique is that the intracellular endosymbiotic bacterium Wolbachia can confer on hosts, such as Aedes aegypti [3] and Aedes albopictus [4], broad-spectrum resistance against human pathogens such as DENV, yellow fever virus, chikungunya virus and Plasmodium [47]. By exploring the underlying mechanism of Wolbachia-mediated pathogen interference, studies have found that the Wolbachia-activated Toll pathway plays an essential role in the antiviral immune response in the primary dengue vector Ae. aegypti [810]. Although we have demonstrated that Wolbachia induces reactive oxygen species (ROS)-dependent activation of the Toll pathway to control DENV in Ae. aegypti [8], a single antiviral mechanism cannot fully explain the robust Wolbachia-induced inhibition or even complete blockage of DENV transmission in Ae. aegypti. An in-depth understanding of multiple antiviral mechanisms induced by Wolbachia is important for practical utilization of Wolbachia for mosquito vector control strategies.

There is growing evidence suggesting that microRNAs (miRNAs) function in Wolbachia symbiosis [11] and are positively associated with Wolbachia-mediated pathogen interference in Aedes mosquitoes [5,12]. Hence, the communication between Wolbachia and host miRNA biological functions has received increasing attention. In Ae. aegypti, wMelPop, a strain of Wolbachia supergroup A identified from Drosophila melanogaster [13], triggers alterations in mosquito miRNA expression [11] and modifies the shuttling and structure of miRNA in cells [14]. This finding indicates that Wolbachia might manipulate Ae. aegypti miRNA biogenesis. Canonical miRNA biogenesis is a multistep process involving both the nucleus and cytoplasm that starts from the miRNA-encoding gene in the genome and progresses through post- or cotranscriptional processing of RNA polymerase II transcripts in the nucleus [15]. Subsequently, the primary miRNA (pri-miRNA) is cleaved by Drosha and DiGeorge syndrome critical region gene 8 (DGCR8)/Pasha to produce the precursor miRNA (pre-miRNA) [15]. After being exported into the cytoplasm, the pre-miRNA is processed into approximately 22-nucleotide (nt) molecules by Dicer-1 (DCR-1) and Argonaute-1 (AGO-1) [15]. DCR-1, a key component of the miRNA pathway, is an RNase III family protein that recognizes and processes pre-miRNA into short base-paired duplex miRNA and associates with AGO-1 for cytoplasmic maturation of miRNA [16]. Although the Wolbachia strain wMelPop has been shown to induce the production of Ae. aegypti AGO-1 [14], little is known about the exact mechanism by which Wolbachia modulates the miRNA biogenesis pathway in response to DENV infection in Ae. aegypti. Elucidating the role of the miRNA biogenesis pathway in Wolbachia-mediated antiviral responses will deepen our comprehension of the various antiviral mechanisms employed by Wolbachia in its direct combat against DENV.

Viral infection assay data have shown that Wolbachia employs host miRNAs to inhibit DENV replication in Ae. aegypti cells through non-immune-priming antiviral activity [12,17]. The Wolbachia strain wMelPop induces the expression of aae-miR-2940 to inhibit DENV replication via nonimmune genes of the host, such as genes encoding DNA methyltransferase (AaDnmt2) [12] and the protein arginine methyltransferase 3 (AaArgM3) [17]. These miRNAs and mRNAs have been shown to function as regulators of Wolbachia growth density, and Wolbachia density is positively associated with the strength of the antiviral effect [5,18,19]. Aside from the involvement of the Wolbachia strain and its density in the pathogen interference, there are multiple mechanisms underlying the potent antiviral effect [20]. In particular, Wolbachia wAlbB, a Wolbachia supergroup B strain identified from Ae. albopictus, activates the Toll pathway, an important pathway that controls Ae. aegypti antiviral immune response [10] to promote the production of Cecropin and Defensin. Cecropin and Defensin are antimicrobial peptides (AMPs) with strong antiviral activity that play a crucial role in blocking DENV [8]. Consequently, the communication between Wolbachia-regulated miRNAs and the Toll pathway was investigated in our previous work. We have demonstrated that Wolbachia upregulates host long non-coding (lncRNA) to activate the Toll pathway and regulate intracellular ROS levels [21], and ROS are essential factors restricting DENV infection in mosquitoes [22,23]. These findings reveal that Wolbachia employs host non-coding RNAs as a novel player in the antiviral immune response of Ae. aegypti. However, the strength of the miRNA-based antiviral immune response in Wolbachia-mediated anti-DENV effects is still poorly understood. We speculate that the miRNAs coregulated by different Wolbachia strains might display greater potency in viral inhibition since the Wolbachia strain has been shown to be an important factor for viral inhibition. miRNAs with strong antiviral effects could be new molecular targets for improving the implementation of mosquito control techniques in the prevention and control of the current resurgence of dengue and other arboviral diseases.

In this study, we explored a novel antiviral mechanism, the crosstalk between miRNA and the Toll pathway, which was employed by Wolbachia to directly combat DENV in Ae. aegypti. We identified aae-miR-34-3p, an Ae. aegypti miRNA induced by two different strains of Wolbachia from supergroups A and B, which was negatively regulated by aae-lnc-2268, a long intergenic noncoding RNA (lincRNA) whose expression was suppressed by Wolbachia. Notably, aae-miR-34-3p enhanced the Toll pathway’s antiviral immune responses, particularly for Cecropin and Defensin family genes, by upregulating the expression of MyD88, a key regulator of the Toll pathway. Overall, we have demonstrated for the first time that the antiviral effect of aae-miR-34-3p plays a crucial role in Wolbachia-mediated DENV interference, achieved through crosstalk between the cytoplasmic miRNA biogenesis pathway and Toll pathway in Ae. aegypti.

Results

Wolbachia manipulates the cytoplasmic miRNA biogenesis pathway to suppress DENV replication in Ae. aegypti

To explore the role of Wolbachia in the host miRNA biogenesis pathway during DENV infection in Ae. aegypti, we conducted a systematic comparative analysis of differential gene expression in the miRNA biogenesis pathway using the data from the midgut and carcass (mosquito tissue except the midgut) samples between Wolbachia wAlbB-infected (W+) and uninfected (W-) female Ae. aegypti 12 days post-DENV-2 infection (d.p.i.), which were retrieved from the microarray-based transcriptome profiles generated in our previous work [8]. The analysis results indicated that Wolbachia modulated cytoplasmic miRNA biogenesis in mosquito carcasses at 12 d.p.i. by elevating the expression of the Dcr-1 and Argonaute-1B (Ago-1B) genes (Fig 1A and 1B), which encode key regulators of cytoplasmic miRNA biogenesis (Fig 1B). Furthermore, the induction of Dcr-1 and Ago-1B gene expression by wAlbB in the carcass samples upon DENV-2 infection was confirmed via qPCR (Fig 1C).

Fig 1. Wolbachia wAlbB activates the microRNA (miRNA) pathway to inhibit dengue virus (DENV) serotype 2 (DENV-2) replication in Ae. aegypti.

Fig 1

(A) miRNA pathway alteration in DENV-2-infected Ae. aegypti triggered by Wolbachia wAlbB. The miRNA pathway regulator gene expression in the carcass (the mosquito tissue except the midgut) was compared between Wolbachia wAlbB-infected (W+, n = 4) and noninfected (W-, n = 4) female Ae. aegypti at 12 days post-DENV-2 infection (12 dpi) based on analysis of public microarray data [8]. The gray dotted line indicates the threshold value of log2(fold-change) >0.8 and log2(fold-change) <-0.8. (B) Schematic of the regulation of the miRNA biogenesis pathway by Wolbachia wAlbB in DENV-2-infected Ae. aegypti. The red arrow represents Wolbachia wAlbB-induced genes upon DENV infection. DENV+ indicates females with DENV infection, DENV- indicates females without DENV infection. (C) Quantitative PCR (qPCR) validation of Wolbachia-induced Dcr-1 (two-sided t test, W+: n = 3, W-: n = 3, P = 0.0183) and Ago1 (two-sided t test, W+: n = 3, W-: n = 3, P = 0.0048) gene expression microarray assays. (D) Schematic of the suppression of cytoplasmic miRNA biogenesis and viral infection in W+ mosquitoes. D0, D2, D5, and D12 indicate 0, 2, 5, and 12 days post-eclosion, respectively. (E) The knockdown efficiency of the Dcr-1 gene in W+ female mosquitoes at 3 days post-dsRNA injection (two-sided t test, GFPi: n = 6, DCR-1i: n = 6, P = 0.0153). (F) DENV-2 infection level in dsRNA-treated W+ females at 7 days post-DENV-2 infection (two-sided t test, GFPi: n = 6, DCR-1i: n = 6, P = 0.0014). GFPi: W+ mosquitoes injected with GFP dsRNA, used as the control group. DCRi: W+ mosquitoes injected with dsRNA of the Dcr gene. The error bars indicate the standard error. The black horizontal line indicates the mean value of DENV infection level. Each circle indicates a replicate per group. **P < 0.01; *P < 0.05.

To test the effect of Wolbachia-regulated cytoplasmic miRNA biogenesis on DENV replication in Ae. aegypti, suppression of cytoplasmic miRNA biogenesis was conducted via injection of double-stranded RNA (dsRNA) and then viral infection assays were conducted via oral feeding of a DENV-2-containing blood meal in W+ female mosquitoes (Fig 1D). Compared to the control females at 3 days post-dsGFP injection, the females with dsDCR1 injection showed a 62.75% decrease in the expression of the Dcr-1 gene (Fig 1E). Strikingly, the suppression of cytoplasmic miRNA biogenesis via injection of dsDCR1 caused a marked 16-fold increase in the DENV RNA level in females at 7 days post-feeding of the DENV-2-containing blood meal (Fig 1F). These results illustrated that Wolbachia manipulated the host cytoplasmic miRNA biosynthesis pathway via Dcr-1 upon DENV-2 infection, indicating that Wolbachia-induced cytoplasmic miRNA biosynthesis pathway may contribute to the inhibition of DENV-2 replication in Ae. aegypti.

Both Wolbachia wAlbB and wMelPop regulate common miRNAs in Ae. aegypti cells

To investigate the hypothesis that Wolbachia wAlbB might induce differentially expressed (DE) miRNAs through manipulation of the miRNA biogenesis pathway in Ae. aegypti, we performed small RNA sequencing on an Illumina NovaSeq 6000 platform to compare the host miRNA profiles between Wolbachia wAlbB-infected (W+) and uninfected (W-) Ae. aegypti Aag2 cells. According to the reference genome (GCF_002204515.2) and 164 mature miRNAs (AaegL1) of Ae. aegypti, 37,421,484 and 30,397,028 clean reads of 18–30 nt in length from W- and W+ cells, respectively, were used for miRNA identification via Bowtie software (S1 Table). As a result, we identified a total of 55 DE miRNAs out of 164 mature miRNAs with annotations in miRBase (https://www.mirbase.org/), including 26 upregulated miRNAs and 26 downregulated miRNAs in W+ cells (Fig 2A and S2 Table) as well as 3 miRNAs expressed exclusively in W- cells (Fig 2A and S2 Table).

Fig 2. Wolbachia wAlbB triggers the differential expression of miRNAs in Aag2 Ae. aegypti cells.

Fig 2

(A) Venn diagram of 55 DE miRNAs of Ae. aegypti induced by Wolbachia wAlbB according to small RNA sequencing. (B) Cluster analysis of the top 15 upregulated and downregulated DE miRNAs between W+ and W- cells with three replicates per cell identified by small RNA sequencing. According to the TPM value for DE miRNAs, red represents upregulated miRNAs, and green represents downregulated miRNAs. (C) The expression of 6 out of the top 15 up-regulated DE miRNAs was increased in whole-cell samples (left panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-989: P = 0.0002, aae-miR-980-5p: P = 2.5421×10−6, aae-miR-980-3p: P = 9.9477×10−6, aae-miR-34-3p: P = 5.9804×10−5, aae-miR-277-3p: P = 1.6964×10−5, aae-miR-2765: P = 9.1317×10−6) and cytoplasm samples (right panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-989: P = 0.0002, aae-miR-980-5p: P = 0.0052, aae-miR-980-3p: P = 0.0012, aae-miR-34-3p: P = 0.0023, aae-miR-277-3p: P = 0.0017, aae-miR-2765: P = 0.0058) from W+ cells in qPCR analysis. (D) qPCR analysis showed that the expression of 5 out of the top 15 downregulated DE miRNAs was decreased in whole-cell samples (left panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-281-5p: P = 0.0036, aae-miR-252-5p: P = 0.0188, aae-miR-2a-3p: P = 0.0397, aae-miR-12-5p: P = 9.6512×10−7, aae-miR-1175-5p: P = 0.0043) and cytoplasm samples (right panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-281-5p: P = 0.0291, aae-miR-252-5p: P = 0.0015, aae-miR-2a-3p: P = 0.0015, aae-miR-12-5p: P = 0.0006, aae-miR-1175-5p: P = 0.0015) from W+ cells in small RNA sequencing. Actin and U6 were used as reference genes for normalization of cytoplasmic and nuclear miRNA quantification, respectively. Error bars indicate the standard error. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05.

To gain further insight into the impact of Wolbachia wAlbB on cytoplasmic miRNA biogenesis, the miRNA expression between W- and W+ cells was compared in both cytoplasm and whole cell using nucleocytoplasmic separation and qPCR. Among the top 15 induced or suppressed miRNAs identified by RNA sequencing analysis (Fig 2B), 6 upregulated miRNAs (aae-miR-989, aae-miR-980-5p, aae-miR-980-3p, aae-miR-34-3p, aae-miR-277-3p, and aae-miR-2765) and 5 downregulated miRNAs (aae-miR-281-5p, aae-miR-252-5p, aae-miR-2a-3p, aae-miR-12-5p, and aae-miR-1175-5p) were identified in both whole-cell samples and cytoplasm samples of W+ cells compared to W- cells (Figs 2C, S1, 2D and S2).These results indicate that Wolbachia wAlbB alters cytoplasmic miRNA levels through the miRNA biogenesis pathway in Ae. aegypti.

To explore the DE miRNAs regulated by different strains of Wolbachia, a comparative analysis of DE miRNAs induced by Wolbachia strains wAlbB and wMelPop was carried out using our miRNA data and currently available miRNA sequencing data from Wolbachia strain wMelPop-infected and noninfected Ae. aegypti cells [14]. Only 2 of the above 11 confirmed cytoplasmic DE miRNAs shared the same pattern of regulation by those both strains. Specifically, aae-miR-34-3p in the cytoplasm was upregulated, whereas aae-miR-1175-5p in the cytoplasm was downregulated, by both wAlbB and wMelPop. These results indicate a conserved patten in regulation of miRNA by different Wolbachia strains in Ae. aegypti.

Wolbachia induces the expression of nuclear and cytoplasmic aae-miR-34-3p to enhance MyD88 expression

We next tested the hypothesis that Wolbachia might employ cytoplasmic DE miRNAs to regulate the host antiviral Toll pathway in Ae. aegypti. The interaction between the above 2 cytoplasmic DE miRNAs, regulated commonly by both wAlbB and wMelPop, and Toll pathway regulator genes was predicted using RNAhybrid [24] and RNA22 [25] software. Only aae-miR-34-3p had a predicted potential interaction with the MyD88 gene encoding the Toll pathway key regulator.

To better understand the aae-miR-34-3p expression regulated by Wolbachia wAlbB, we assayed its subcellular distribution and expression using a sequence-specific fluorescent RNA probe for RNA-FISH analysis. The fluorescence intensity of aae-miR-34-3p in W+ cells was significantly higher than that in W- cells at 24 h, 48 h, and 72 h post-cell seeding (Fig 3A and 3B). In particular, wAlbB led to a 2.39-fold increase at 48 h post-cell seeding (Fig 3A and 3B). Notably, aae-miR-34-3p was present in both the nucleus and cytoplasm of Ae. aegypti cells (Fig 3A). Furthermore, via nucleocytoplasmic separation of W- and W+ cells, the abundance of aae-miR-34-3p was measured separately in the nucleus and cytoplasm. The results showed that wAlbB increased both the abundance of nuclear and cytoplasmic aae-miR-34-3p in Ae. aegypti cells (Fig 3C).

Fig 3. Wolbachia wAlbB induces aae-miR-34-3p expression to regulate MyD88 gene expression in Ae. aegypti.

Fig 3

(A) The subcellular distribution of aae-miR-34-3p and Wolbachia wAlbB in W- and W+ cells in an RNA-FISH assay. The white horizontal line represents 5 μm. (B) The fluorescence intensity of aae-miR-34-3p per cell in W- and W+ cells in an RNA-FISH assay at 24 h post-cell seeding (24 h, repeated measures ANOVA, W-: n = 14, W+: n = 15, P = 8.2527×10−7), 48 h post-cell seeding (48 h, repeated-measures ANOVA, W-: n = 14, W+: n = 15, P = 3×10−6), and 72 h post-cell seeding (72 h, repeated-measures ANOVA, W-: n = 14, W+: n = 14, P = 9.2622×10−7). The red and blue circles indicate the fluorescence intensity of aae-miR-34-3p per cell in W- and W+ cells, respectively. (C) Comparison of nuclear aae-miR-34-3p (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0092) and cytoplasmic aae-miR-34-3p (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0353) levels between W- and W+ cells by qPCR. (D) Coexpression analysis of aae-miR-34-3p (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0004) and the MyD88 gene (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0151) in Ae. aegypti female mosquitoes. (E) Expression differences of aae-miR-34-3p (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0002) and the MyD88 gene (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0003) in Ae. aegypti cells. (F) The representative gel picture of the western blot assay demonstrated an overexpression of MyD88 protein in W+ cells in comparison to W- cells. β-actin protein was used as the housekeeping protein. (G) Differential expression of MyD88 protein between W+ and W- cells (two-sided t test, W-: n = 3, W+: n = 3, P = 0.0231). The fold change (W+ vs. W- cells) was determined in each individual test. (H) Expression difference of the MyD88 gene upon the upregulation of aae-miR-34-3p in W- cells at day 3 post-transfection (3D, two-sided t test, AC: agomir control treatment group, n = 5, A-34-3p: aae-miR-34-3p agomir treatment group, n = 5, P = 0.2×10−5) and day 5 post-transfection (5D, two-sided t test, AC: n = 5, A-34-3p: n = 5, P = 0.14×10−4). (I) The representative gel photo of MyD88 protein from the AC and A-34-3p groups of W- cells in the western blot assay. (J) The relative expression of MyD88 protein in A-34-3p group compared to AC group (two-sided t test, AC: n = 4, A-34-3p: n = 4, P = 0.0052). (K) Fold changes in the expression of the MyD88 gene in response to silencing of aae-miR-34-3p in W+ cells at 3 days post-transfection (3D, two-sided t test, ATC: Antagomir control treated group, n = 4, AT-34-3p: aae-miR-34-3p antagomir treated group, n = 4, P = 0.0162) and 5 days post-transfection (5D, two-sided t test, ATC: n = 5, AT-34-3p: n = 5, P = 0.0103). (L) The representative gel image of MyD88 protein expression difference in W+ cells between AT-34-3p and ATC groups in the western blot assay. (M) The corresponding quantification of western blot images for the MyD88 protein in the AT-34-3p group related to the ATC group (two-sided t test, ATC: n = 4, AT-34-3p: n = 4, P = 0.0010). (N) Relative expression levels of the MyD88 gene in aae-miR-34-3p agomir- and agomir control-treated cells at 3 days post-transfection (3D, two-way ANOVA, n = 5, W- AC vs. W+ AC: P = 1.0563×10−16, W+ A-34-3p vs. W+ AC: P = 1.13×10−4, W+ A-34-3p vs. W- AC: P = 1.0008×10−18) and 5 days post-transfection (5D, two-way ANOVA, n = 5, W- AC vs. W+ AC: P = 4.6183×10−14, W+ A-34-3p vs. W+ AC: P = 7.2124×10−7, W+ A-34-3p vs. W- AC: P = 1.5911×10−17). (O) Relative expression of the MyD88 gene in response to the enhancement of aae-miR-34-3p expression in female mosquitoes (one-way ANOVA, n = 9, W- AC vs. W+ AC: P = 0.046, W+ A-34-3p vs. W+ AC: P = 0.0035). (N-O): W- AC indicates agomir control treated W- female mosquitoes or W- cells, W+ AC represents agomir control treated W+ female mosquitoes or W+ cells, W+ A-34-3p means aae-miR-34-3p agomir treated W+ female mosquitoes or W+ cells. The error bars indicate the standard error. F means fold change value. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05.

To explore the association of aae-miR-34-3p and MyD88, the binding relationship between aae-miR-34-3p and the mRNA of the MyD88 gene was demonstrated using the dual-luciferase reporter assay (S3 Fig). Subsequently, we examined the coexpression of aae-miR-34-3p and the MyD88 gene in W+ and W- Ae. aegypti mosquitoes at day 7 post-eclosion (Fig 3D) and cell mixtures collected at day 1 to day 5 post-seeding (Fig 3E). The results showed that the MyD88 gene and aae-miR-34-3p were coexpressed in W+ and W- Ae. aegypti. Interestingly, the mRNA levels of the MyD88 gene were induced by wAlbB when aae-miR-34-3p expression was enhanced in W+ mosquitoes and cells (Fig 3D and 3E). Moreover, the protein level of MyD88 was elevated by wAlbB in W+ cells (Fig 3F and 3G), implying a potential involvement of aae-miR-34-3p in the regulation of MyD88 expression.

To evaluate the impact of aae-miR-34-3p on the expression of MyD88, we upregulated aae-miR-34-3p in W- cells, which have lower MyD88 gene expression levels than W+ cells (Fig 3E). Using a synthetic aae-miR-34-3p sequence-specific agomir to enrich the abundance of aae-miR-34-3p in the cells, MyD88 expression at the transcript level was significantly increased by 3.25-fold and 2.76-fold at day 3 and day 5 post-transfection, respectively (Fig 3H). Furthermore, MyD88 expression at protein level was also increased by 2.14-fold at day 5 post-transfection, compared to the cells treated with a random miRNA sequence without any host target (Fig 3I and 3J). In turn, depletion of aae-miR-34-3p assay was conducted in W+ cells transfected with a synthetic antagomir with reverse-complementary sequences to aae-miR-34-3p in comparison with the cells transfected with an antagomir control. At day 3 post-transfection, significant suppression of MyD88 at transcript level was observed in the aae-miR-34-3p antagomir-treated cells (Fig 3K). At day 5 post-transfection, obviously reduction of MyD88 at protein level was presented in the aae-miR-34-3p antagomir-treated cells (Fig 3L and 3M). These results indicate that aae-miR-34-3p positively regulates the expression of MyD88 at transcript and protein level in Ae. aegypti cells, supporting that wAlbB induces aae-miR-34-3p levels to enhance the expression of MyD88 for activation of the Toll pathway.

To assess whether aae-miR-34-3p could further enhance MyD88 gene expression in Wolbachia-infected Ae. aegypti, we conducted experiments in both cells and mosquitoes. At both day 3 and day 5 post-transfection with the agomir control, MyD88 expression was induced by Wolbachia in W+ cells and W+ female mosquitoes, compared to W- cells and W- female mosquitoes, respectively (Fig 3N and 3O). Furthermore, MyD88 expression was further enhanced in W+ cells transfected with the aae-miR-34-3p agomir, compared to W+ cells treated with the agomir control (Fig 3N). Notably, on day 5 post-aae-miR-34-3p agomir injection, a remarkable 2.08-fold increase in MyD88 gene expression was observed in W+ female mosquitoes compared to W+ female mosquitoes with injection of agomir control (Fig 3O). These findings demonstrate that aae-miR-34-3p can augment MyD88 gene expression in both W+ cells and mosquitoes, even when MyD88 gene expression has already been induced by Wolbachia.

Wolbachia suppress aae-lnc-2268 to increase the expression of aae-miR-34-3p and the MyD88 gene

To test the hypothesis that Wolbachia might utilize long non-coding RNA (lncRNA) to modulate the interaction of aae-miR-34-3p and the MyD88 gene, candidate lncRNAs with potential targets to aae-miR-34-3p were predicted using RNAhybrid software. Initially, we found that 8 candidate lncRNAs might target aae-miR-34-3p with an MFE ≤ -30 kcal/mol (Fig 4A). Among them, aae-lnc-2268, a 3140 nt lincRNA, was chosen for further characterization due to the highest fold change in expression regulated by wAlbB based on the data reported previously [21] (Fig 4B). We firstly examined the subcellular distribution of aae-miR-34-3p and aae-lnc-2268 in the W- and W+ cell lines via RNA-FISH using florescent RNA probes. The high abundance of aae-lnc-2268 observed in the cytoplasm of W- cells was significantly reduced in the cytoplasm of W+ cells, reaching a level similar to that found in the nucleus (Fig 4C). Interestingly, while aae-miR-34-3p expression was induced by Wolbachia (Fig 3C and 3E), aae-lnc-2268 levels were dramatically decreased by Wolbachia to the detection threshold of conventional PCR and qPCR in W+ cells (Figs 4D and S4).

Fig 4. Wolbachia wAlbB reduces aae-lnc-2268 expression to enhance aae-miR-34-3p expression in Ae. aegypti.

Fig 4

(A) The predicted network based on the DE lncRNAs and aae-miR-34-3p. Blue circles represent lncRNAs, and arrows indicate miRNAs. (B) The MFE value and absolute log2(FC) value for lncRNAs with a predicted interaction with aae-miR-34-3p. (C) Representative image of aae-miR-34-3p and aae-lnc-2268 subcellular distribution in W- and W+ cells at 63× magnification. The scale bar indicates 5 μm. (D) Image of aae-lnc-2268 presence in W- and W+ cells determined using electrophoresis. (E) Schematic representation of the construct psi-CHECK-2 plasmids used in the dual luciferase reporter assay shown in the on top panel. A schematic diagram of the predicted binding sites between aae-miR-34-3p agomir and aae-lnc-2268 plasmids in the dual luciferase reporter assay shown in the bottom panel. (F) Detection of the binding relationship between aae-lnc-2268 and aae-miR-34-3p via dual-luciferase reporter assay (one-way ANOVA, Luc-MUT+AC: n = 4, Luc-lnc-2268+AC: n = 4, Luc-MUT+A-34-3p: n = 4, Luc-lnc-2268+A-34-3p: n = 4, Luc-MUT+AC vs. Luc-lnc-2268+A-34-3p: P = 0.0114, Luc-MUT+AC vs. Luc-lnc-2268+AC: P = 0.5934, Luc-MUT+AC vs. Luc-MUT+A-34-3p: P = 0.9999, Luc-lnc-2268+AC vs. Luc-lnc-2268+A-34-3p:P = 0.0061, Luc-MUT+A-34-3p vs. Luc-lnc-2268+A-34-3p: P = 0.0103). Luc-MUT+AC: group cotransfected with psi-CHECK-2-MUT-2268 and agomir control, Luc-lnc-2268+A-34-3p: group with cotransfection of psi-CHECK-2-WT-2268 and aae-miR-34-3p agomir, Luc-lnc-2268+AC: group cotransfected with psi-CHECK-2-WT-2268 and agomir control, Luc-MUT+A-34-3p: group cotransfected with psi-CHECK-2-MUT-2268 and aae-miR-34-3p agomir. (G) The knockdown efficiency of aae-Inc-2268 from W- cells in the aae-lnc-2268 downregulation assay at 48 h post-transfection (two-sided t test, NC: n = 3, si-lnc-2268: n = 3, P = 0.0066). (H) Fold changes in aae-miR-34-3p from W- cells in the aae-lnc-2268 downregulation assay at 96 h post-transfection (two-sided t test, NC: n = 4, si-lnc-2268: n = 4, P = 0.0132). (I) MyD88 gene expression change in the aae-lnc-2268 downregulation assay at 120 h post-transfection (two-sided t test, NC: n = 3, si-lnc-2268: n = 3, P = 0.0046). (G-I): NC indicates the siRNA negative control-transfected cells, si-lnc-2268 indicates the aae-lnc-2268 sequence-specific siRNA-treated cells. (J) Fold change in MyD88 gene expression in the aae-Inc-2268 functional rescue assay (one-way ANOVA, NC+ATC: n = 3, si-lnc-2268+ATC: n = 3, NC+AT-34-3p: n = 3, si-lnc-2268+AT-34-3p: n = 3, NC+ATC vs. si-lnc-2268+ATC: P = 0.0045, NC+ATC vs. NC+AT-34-3p: P = 0.0010, NC+ATC vs. si-lnc-2268+AT-34-3p: P = 0.2429, si-lnc-2268+ATC vs. si-lnc-2268+AT-34-3p: P = 0.0298, NC+AT-34-3p vs. si-lnc-2268+AT-34-3p: P = 0.0002). NC+ATC: cells transfected with the siRNA control and antagomir control, si-lnc-2268+ATC: cells transfected with aae-lnc-2268 siRNA and antagomir control, NC+AT-34-3p: cells transfected with the siRNA control and aae-miR-34-3p antagomir, si-lnc-2268+AT-34-3p: cells transfected with aae-lnc-2268 siRNA and the aae-miR-34-3p antagomir. The error bars indicate the standard error. Each circle indicates a replicate per tested group. F means fold change (FC) value. ***P < 0.001; **P < 0.01; *P < 0.05; ns, non-significant.

To verify the interactions between aae-lnc-2268 and aae-miR-34-3p, a double-luciferase reporter assay was conducted using an aae-miR-34-3p agomir and the psi-CHECK-2-WT-2268 plasmid. The recombinant plasmid was generated from the psi-CHECK-2 vector to express a mimic fragment of aae-lnc-2268, which based on prediction contained the binding sites between aae-lnc-2268 and aae-miR-34-3p (Fig 4E). As a negative control, the plasmid psi-CHECK-2-MUT-2268 was constructed to express a mutated fragment of aae-lnc-2268, which included a 7-base mutation within the binding sites (Fig 4E). Cotransfection was performed in human embryonic kidney-derived 293T cells. This cell line was chosen to eliminate the potential effect of endogenous miRNAs in Ae. aegypti cells. The results indicated that the luciferase activity derived from psi-CHECK-2-WT-2268 was significantly decreased in the cells cotransfected with the aae-miR-34-3p agomir compared to that in the control group. However, there was no difference in luciferase activity in the cells cotransfected with either psi-CHECK-2-MUT-2268 with agomir control or psi-CHECK-2-WT-2268 with the aae-miR-34-3p agomir (Fig 4F). These results indicate the direct interaction between aae-miR-34-3p and aae-lnc-2268.

To detect the impact of aae-lnc-2268 on aae-miR-34-3p expression, the aae-lnc-2268 downregulation assay was performed in W- cells using aae-lnc-2268 sequence-specific siRNA. When the abundance of aae-lnc-2268 was reduced by 2.30-fold at 48 h post-transfection (Fig 4G), the expression level of aae-miR-34-3p was increased by 3.85-fold at day 4 post-transfection in the treated group compared to that in the control group (Fig 4H). Moreover, the regulation of the MyD88 gene by aae-lnc-2268 was also assessed. At day 5 post-transfection, the expression of the MyD88 gene was elevated by 2.0-fold (Fig 4I).

To further verify that indirect manipulation of the MyD88 gene was triggered by aae-lnc-2268 through aae-miR-34-3p, a functional rescue assay was conducted in W- cells by cotransfection of the aae-miR-34-3p antagomir or antagomir control with aae-lnc-2268 siRNA or the siRNA control. Similar to previous results, MyD88 gene expression was suppressed in cells cotransfected with the siRNA control and aae-miR-34-3p antagomir, but MyD88 gene expression was enhanced in cells cotransfected with aae-lnc-2268 siRNA and the antagomir control (Fig 4J). Interestingly, the reduced MyD88 expression upon depletion of aae-miR-34-3p via the antagomir reagent was rescued to the same level as that in the control group in response to the silencing of aae-lnc-2268 via the siRNA reagent. These data demonstrated that aae-lnc-2268 promoted the expression of the MyD88 gene through aae-miR-34-3p. Taken together, our results illustrate that Wolbachia-mediated downregulation of aae-lnc-2268 expression can either directly or indirectly, through up-regulation of aae-miR-34-3p, enhance MyD88 gene expression.

Wolbachia-induced aae-miR-34-3p expression activates the Toll pathway to inhibit DENV-2 replication

To investigate the hypothesis that Wolbachia-induced aae-miR-34-3p might promote the production of AMPs through activation of the Toll pathway, the effect of aae-miR-34-3p on the expression of Cecropin and Defensin family genes, the AMPs with strong antiviral activity that combat DENV through the Toll pathway induced by Wolbachia wAlbB [8], was measured in an in vitro function assay. When the aae-miR-34-3p agomir was added to W- cells to mimic the induced aae-miR-34-3p expression in W+ cells, the expression of Defensin A (DEFA), Defensin E (DEFE), Cecropin D (CECD), Cecropin E (CECE), Cecropin F (CECF), and Cecropin N (CECN) was significantly increased at day 5 post-transfection (Fig 5A).

Fig 5. Wolbachia wAlbB-induced aae-miR-34-3p expression promotes antimicrobial peptide expression to inhibit DENV replication in Ae. aegypti.

Fig 5

(A) The enhancement of Defensin genes (two-sided t test, AC: n = 4, A-34-3p: n = 4, DEFA: P = 0.0007, DEFE: P = 0.0173) and Cecropin genes (two-sided t test, AC: n = 4, A-34-3p: n = 4, CECD: P = 0.0011, CECE: P = 0.0006, CECF: P = 0.0017, CECN: P = 0.0030) in W- cells at day 5 post-transfection with aae-miR-34-3p agomir. (B) Significant increases in the expression of Defensin genes (two-sided t test, AC: n = 4, A-34-3p: n = 4, DEFA: P = 0.0334, DEFD: P = 0.0168) and Cecropin genes (two-sided t test, AC: n = 4, A-34-3p: n = 4, CECD: P = 0.0249, CECE: P = 0.0177, CECF: P = 0.0493, CECN: P = 0.0103) in W+ cells at day 5 post-transfection with aae-miR-34-3p agomir. (C) Schematic of the aae-miR-34-3p upregulation assay and viral infection assay in W- cells and W+ cells. D0, D1, D4, and D7 indicate 0, 1, 4, and 7 days post cell seeding, respectively. (D) DENV-2 infection levels in W- cells between the agomir control (AC)- and aae-miR-34-3p agomir (A-34-3p)-treated groups at 72 h post-DENV-2 infection (two-sided t test, AC: n = 6, A-34-3p: n = 6, P = 0.0327). (E) Differences in DENV-2 infection levels in W+ cells at 72 h post-DENV-2 infection (two-sided t test, AC: n = 6, A-34-3p: n = 6, P = 0.27×10−4). The DENV-positive infection rates are presented as pie diagram on top for each group. A-E: AC indicates agomir control treated group, A-34-3p means aae-miR-34-3p agomir treated group. F means fold change value. (F) Schematic of the aae-miR-34-3p downregulation assay and viral infection assay in mosquitoes. D0, D2, D5, and D9 indicate 0, 2, 5, and 9 days post-eclosion, respectively. (G) DENV-2 infection levels in female mosquitoes at day 7 post downregulation of aae-miR-34-3p. Compared to that of the antagomir control-injected W- (W-_ATC, n = 9) and W+ (W+_ATC, n = 9, one-way ANOVA, W-_ATC vs. W+_ATC: P = 0.0014) females, there was significant difference in viral infection (one-way ANOVA, W-_ATC vs. W-_AT-34-3p: P = 0.0031, W+_ATC vs. W+_AT-34-3p: P = 0.0151, W+_AT-34-3p vs. W-_AT-34-3p: P = 0.0018) in the aae-miR-34-3p antagomir-injected W- (W-_AT-34-3p, n = 8), and W+ female Ae. aegypti (W+_AT-34-3p, n = 9), respectively. However, there was no significant difference between the aae-miR-34-3p antagomir-injected W+ and antagomir control-injected W- Ae. aegypti (one-way ANOVA, W-_ATC vs. W+_AT-34-3p: P = 0.2658). The DENV-2 infection level was determined as the copy number of the DENV-2 NS5 gene normalized to that of the Ae. aegypti RPS6 gene. The line shows the mean value of the DENV infection level, and the error bar indicates the standard error. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05; ns, non-significant.

To investigate whether the increase in AMPs, stimulated by Wolbachia could be further augmented by aae-miR-34-3p, we conducted a similar function assay in W+ cells. Strikingly, the expression of DEFA, DEFD, CECD, CECE, CECF, and CECN was further increased in the W+ cells treated with aae-miR-34-3p agomir (Fig 5B). This finding suggested that Wolbachia wAlbB increased aae-miR-34-3p expression to induce cecropin and defensin gene expression through activation of the Toll pathway, and boosting aae-miR-34-3p expression in W+ cells can further promote Wolbachia-mediated virus blocking in Ae. aegypti.

Subsequently, we evaluated the effect of Wolbachia-induced aae-miR-34-3p expression on DENV-2 infection in Ae. aegypti. In an aae-miR-34-3p function assay, the abundance of aae-miR-34-3p was initially enhanced in W- cells via transfection of aae-miR-34-3p agomir (Fig 5C). At day 3 post-transfection, the cells were subjected to a second transfection with the aae-miR-34-3p agomir or agomir control, as well as DENV-2 infection at a multiplicity of infection (MOI) = 0.1 (Fig 5C). At day 3 post-DENV-2 infection, a significant decrease in DENV genomic RNA levels was observed in the aae-miR-34-3p agomir-transfected W- cells (Fig 5D). These results indicate that over-expression of aae-miR-34-3p can result in inhibition of DENV in Ae. aegypti.

We then performed a similar assay in W+ cells to test whether Wolbachia-mediated DENV inhibition could be further enhanced by an increase in aae-miR-34-3p expression (Fig 5C and 5E). Notably, DENV-2 replication was suppressed by 8.69-fold in cells transfected with the aae-miR-34-3p agomir, in which the positive viral infection rate dropped to 16.67% with the complete blockade of viral infection in 5 out of 6 biological replicates at day 3 post-viral infection (Fig 5E). This suggests that the anti-DENV-2 resistance induced by Wolbachia can be further enhanced, and it is possible to achieve complete blocking of DENV-2 by increasing the aae-miR-34-3p level in Ae. aegypti.

To further investigate the role of aae-miR-34-3p in Wolbachia-induced resistance to DENV-2 in Ae. aegypti mosquitoes, we downregulated aae-miR-34-3p in female mosquitoes on day 2 post-eclosion, followed by viral infection on day 3 after treatment with antagomir (Fig 5F). As expected, wAlbB induced strong resistance to DENV-2, as evidence by the comparison of virus infection levels between W+ and W- females treated with the antagomir control (Fig 5G). Silencing of aae-miR-34-3p led to a significant increase in DENV-2 infection level in the group injected with aae-miR-34-3p antagomir compared to the control group in both W+ and W- mosquitoes (Fig 5G). Interestingly, aae-miR-34-3p silencing in W+ mosquitoes led to recovery of the DENV replication level to a level similar to that in antagomir control-treated W- mosquitoes, although the viral infection also increased in W- mosquito post aae-miR-34-3p silencing (Fig 5G). Taken together, these findings suggest that Wolbachia-induced aae-miR-34-3p plays a crucial role in Wolbachia-mediated anti-DENV-2 effects.

Discussion

Since the symbiont Wolbachia has a remarkable ability to significantly inhibit or even completely block DENV transmission in its host Ae. aegypti [6,9], the mechanism underlying Wolbachia-mediated interference with DENV infection has garnered considerable attention. We have previously uncovered that Wolbachia induces ROS-dependent activation of the Toll pathway to control DENV in Ae. aegypti [8]. To extend this finding, we further investigated the hypothesis that Wolbachia might employ multiple antiviral mechanisms in its battle against DENV. Here, we found that Wolbachia induces Dcr-1 and Ago-1B gene expression to modulate the cytoplasmic miRNA biogenesis pathway upon DENV-2 infection and that suppression of cytoplasmic miRNA biogenesis via depletion of Dcr-1 strongly enhances DENV replication in female Ae. aegypti. Regarding the miRNA pathway-induced antiviral effects, we demonstrate that Wolbachia subgroups A (wMelPop) and B (wAlbB) increase both the nuclear and cytoplasmic levels of aae-miR-34-3p, a 23 nt immuno-microRNA in Ae. aegypti. This augmentation strengthens the Toll pathway antiviral immune response against DENV-2 by upregulating the expression of the MyD88 gene and genes within Cecropin and Defensin families in Ae. aegypti. Moreover, we found that Wolbachia wAlbB suppresses aae-lnc-2268 to reduce its negative regulation of aae-miR-34-3p through direct binding, which reinforces the aae-miR-34-3p-mediated antiviral immune response, enhancing Wolbachia-induced antiviral effects in W+ cells. We assessed the contribution of the aae-miR-34-3p-mediated antiviral effect in female Ae. aegypti through a viral infection assay, underscoring its pivotal role in Wolbachia-induced interference with DENV-2 replication. Thus, we illustrate a novel mechanism by which Wolbachia orchestrates crosstalk between the cytoplasmic miRNA biogenesis pathway and the Toll pathway via aae-miR-34-3p, ultimately strengthening its potent antiviral effect on DENV-2 replication (Fig 6).

Fig 6. Schematic diagram of the findings in this study.

Fig 6

The white sharp-ended arrows and the white flat-ended arrows represent the promoting effects and inhibitory effects detected in this study, respectively.

In the contest between Wolbachia and DENV, Wolbachia either activates Toll pathway antiviral immune responses [8,9] or employs nonimmune miRNAs dedicated to potent pathogen interference [12,17]. We have also found that Wolbachia wAlbB has the capacity to induce Dcr-1 and Ago-1 gene expression upon DENV infection in Ae. aegypti, suggesting that Wolbachia could manipulate miRNA maturation, stability and functionality via Ago-1 and Dcr-1 genes in response to DENV-2 infection. These two genes encode the key regulators of cytoplasmic miRNA biogenesis and functionality [26], which are sensitive to viral infection in insects [27,28]. During infection by Israeli acute paralysis virus (IAPV) and slow bee paralysis virus (SBPV), Dcr-1 and Ago-1 gene expression is increased in bees [27]. Moreover, differences in AGO-1 protein expression have been found in silkworms in response to infection with the baculovirus Bombyx mori nucleopolyhedrovirus (BmNPV) [28]. Furthermore, here, we demonstrated the essential role of the cytoplasmic miRNA biogenesis pathway via the Dcr-1 gene in the inhibition of DENV-2 replication in W+ Ae. aegypti. Silencing the Dcr-1 or Ago-1 gene led to significant increases in the virus titers of DENV-2 and DENV-4, which has been previously shown in Drosophila melanogaster [29]. These data suggest that Wolbachia’s strong antiviral effect in pathogen interference is unlikely to foster resistance due to the involvement of multiple antiviral mechanisms. This reinforces the notion that Wolbachia-based mosquito control strategies are stable and effective in long-term field applications for mosquito control and arboviral disease prevention.

To our knowledge, this is the first work using small RNA sequencing that shows how Wolbachia wAlbB regulates the miRNA profile in Ae. aegypti cells. We identified 55 DE miRNAs whose expression was altered by Wolbachia wAlbB, supporting the finding of miRNAs modulation by Wolbachia in Ae. aegypti mosquito [12,30]. Among which most DE miRNAs were expressed in Wolbachia strain-specific patterns according to the comparison between the 55 DE miRNAs by Wolbachia wAlbB and DE miRNAs induced by Wolbachia wMelPop in Ae. aegypti cells [14]. This finding suggests that subgroup A (wMelPop strain) and B (wAlbB strain) Wolbachia trigger distinct alterations in the Ae. aegypti miRNA profile. In total, 2 out of the 55 DE miRNAs, namely, aae-miR-34-3p and aae-miR-1175-5p, were regulated by both Wolbachia strains wAlbB and wMelPop. Intriguingly, aae-miR-34-3p expression was induced in the cytoplasm by Wolbachia wMelPop and wAlbB, and it was also increased in the nucleus by Wolbachia wAlbB. This finding implies that nuclear-cytoplasmic shuttling allows mature aae-miR-34-3p to be imported into the nucleus from the cytoplasm. Although the potential mechanism underlying the nuclear–cytoplasmic shuttling of aae-miR-34-3p is still unclear, the broad presence of aae-miR-34-3p in the nucleus and cytoplasm enables aae-miR-34-3p to interact with mRNAs or noncoding RNAs through distinct mechanisms. Herein, we have elucidated that aae-miR-34-3p is associated with increased expression of the MyD88 gene and negative regulation of aae-miR-34-3p via direct binding with aae-lnc-2268 in Ae. aegypti. Our findings indicate the complexity of miRNA functions in Ae. aegypti. The complex regulatory functions of miRNAs that are commonly regulated by different strains of Wolbachia are an interesting topic that we aim to explore in future research.

Increasing evidence has shown that nuclear miRNAs participate in two processes: transcriptional gene silencing [31] and transcriptional gene activation [12,3133]. Our miRNA functional data provide new evidence supporting the latter function of miRNA-mediated gene activation, as aae-miR-34-3p enhanced the expression of the MyD88 gene in Ae. aegypti. Likewise, in Wolbachia-host interactions, aae-miR-2940 induces host metalloprotease gene expression by binding the 3’-UTR, which benefits Wolbachia wMelPop growth in Ae. aegypti [11]. In fungal-plant interactions, positive gene regulation by the natural protective miRNA miR171b enables the symbiosis of Arbuscular mycorrhizal [34]. In virus–host interactions, miR-122 enhances hepatitis C virus replication by targeting 5′-UTR [35]. In tumorigenesis, upregulation of target genes at both mRNA and protein levels by miRNA MIR-G-1 could promote nuclear autophagy in cancer cells [36]. Although the mechanism underlying the direct interaction of aae-miR-34-3p and the MyD88 gene is currently unknown, we speculate that nucleus-localized aae-miR-34-3p exerts its gene-activating ability through the following mechanisms: binding to transcriptional start sites, matching the sequence motif in the promoter [37,38], localizing to an enhancer region, modifying chromatin as an enhancer [32], or increase the stability of target mRNA. As the last hypothesis, Wolbachia reduces the sponge effect of aae-lnc-2268 on aae-miR-34-3p, resulting in increased aae-miR-34 and MyD88 in Ae. aegypti. In any case, we report that aae-miR-34-3p functions as an epigenetic modifier via transcriptional gene activation to improve the triple interaction among Wolbachia, Ae. aegypti and DENV.

In our previous study, we found that Wolbachia wAlbB utilized the competing endogenous RNA network to activate the Toll pathway in Ae. aegypti [21]. Here, we have shown the crucial role of miRNA-mediated Toll pathway activation in Wolbachia-induced DENV interference in Ae. aegypti cells and mosquitoes. Emerging data suggest that Aedes miRNAs play a role in interference with DENV replication, such as aae-miR-989 suppressing DENV replication through the regulation of Ae. aegypti atlastin (AaATL) expression [39]. In contrast to nonimmune miRNAs, aae-miR-34-3p serves as a novel enhancer to strengthen the Toll pathway antiviral immune response. Aside from enhancing the gene expression of MyD88, the key regulator of the Toll pathway, aae-miR-34-3p elevated the expression of Cecropin and Defensin family genes, which are important Toll pathway immune effectors with strong antiviral activity. A similar immune miRNA mechanism has been reported for aae-miR-375; however, aae-miR-375 functions as an immune inhibitor of the Toll pathway immune response that facilitates DENV-2 replication via the Cactus and Rel1 genes in Ae. aegypti [31,40]. Notably, the strength of the Wolbachia-mediated antiviral effect could be further enhanced by increasing the abundance of aae-miR-34-3p in W+ cells, suggesting the effectiveness and feasibility of the aae-miR-34-3p-induced antiviral effect. Moreover, the relative antiviral contribution of aae-miR-34-3p could even take up 91.17% of Wolbachia-medicated anti-DENV effect in Ae. aegypti mosquitoes, indicating the crucial role of aae-miR-34-3p-induced antiviral effects in Wolbachia-mediated interference with DENV-2. It is unclear whether the aae-miR-34-3p-induced antiviral effects are pathogen-specific to DENV-2 given reports that miRNA-mediated regulation occurs in human cancer cells in a cell type-specific manner [41]. We speculate that aae-miR-34-3p-induced antiviral effects are likely not limited to DENV-2 because they strengthen the Toll pathway antiviral immune responses through multiple genes. In future research, we aim to expand our investigation to assess the impact of aae-miR-34-3p on the replication of other DENV serotypes and various mosquito-borne viral pathogens.

In conclusion, we offer a novel, safe immune miRNA with prominent antiviral capabilities that has the potential to be developed as an environmentally friendly, innovative vector control tool by reducing the susceptibility to, or transmission of, DENV in insecticide-resistant Ae. aegypti mosquitoes. As Wolbachia-mediated pathogen interference can be enhanced by aae-miR-34-3p, this novel small molecule is highly compatible with Wolbachia-based vector control strategies, which have shown their synergistic effects in strongly inhibiting or even blocking DENV replication. Further research is necessary to explore ways of enhancing the implementation of vector control strategies based on the novel miRNAs.

Materials and methods

Ethics Statement

All mosquito experiments and virus studies were conducted in accordance with the protocol approved by the Ethics Committee on Biomedical Research of Hunan Normal University (No. 2018–023) and Michigan State University Institutional Animal Care and Use Committees (03/14-036-00).

Mosquitoes

The Wolbachia strain wAlbB-infected Ae. aegypti (W+ mosquito) and Wolbachia-free wild-type Ae. aegypti (W- mosquito) were reared at 28°C and 80% humidity with a 12-h/12-h light/dark cycle [42]. Briefly, larvae were fed a 6% (w/v) bovine liver powder solution, while adult mosquitoes were fed a 10% (w/v) sugar solution, and female mosquitoes were fed mouse blood according to standard rearing procedures [42].

Cells

The Wolbachia wAlbB-carrying Ae. aegypti WAag2 cell line (W+ cell) and the Aag2 cell line (W- cell), a Wolbachia-free Ae. aegypti cell line, were maintained in cell culture medium (Schneider’s Drosophila medium with L-glutamine supplemented with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin/streptomycin) at 26°C [5,43]. In addition, the Ae. albopictus cell line C6/36 was cultured in minimal essential medium (MEM) with 10% (v/v) heat-inactivated FBS, 1% (v/v) penicillin/streptomycin, 1% (v/v) L-glutamine, and 1% (v/v) nonessential amino acids at 32°C in a 5% (v/v) CO2 incubator.

In addition, human embryonic kidney 293T cells were grown in Dulbecco’s modified Eagle medium (DMEM) with 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin at 37°C under 5% (v/v) CO2, as previously described [21].

RNA interference in mosquitoes

First, dsRNA was synthesized using a MEGAscript T7 transcription kit (Invitrogen, TX, USA) and purified using a MEGAclear kit (Invitrogen) according to the manufacturer’s instructions. T7 promoter sequences (TAATACGACTCACTATAGGG) were incorporated in both forward and reverse primers to amplify the Ae. aegypti Dicer-1 gene (forward: 5′-TCCGTTATGGATCACCCACT-3′; reverse: 5′-TGTTTTTGCCGTTTGAGGAT-3′) and GFP (forward: 5′-GGAGAAGAACTTTTCACTGG-3′; reverse: 5′-AGTTGAACGGATCCATCTTC—3′). mRNA downregulation via RNA interference was conducted through adult mosquito thorax injection, according to the standard methodology [44]. A total of 69 nL of 4 μg/μL dsRNA of DCR or GFP was injected into the thorax of CO2-anesthetized 1- to 2-day-old female mosquitoes using a nanoinjector. At day 3 post-dsRNA injection, some females were dissected for midgut sample collection used in evaluation of gene knockdown efficiency and the remaining females from each group were infected with DENV-2 through oral feeding of a blood meal. At day 7 post-DENV infection, the midguts were dissected to measure the DENV infection level. There were 6 samples for each group with 3 midguts per sample.

miRNA function assay

The aae-miR-34-3p sequence-specific agomir and antagomir were synthesized by GenePharma (http://www.genepharma.com), and the sequence information is listed in S3 Table. Agomirs are chemically modified double-stranded RNAs that can mimic mature endogenous miRNAs for use in miRNA upregulation assays. In contrast, antagomirs are chemically modified single-stranded RNAs that can silence endogenous miRNAs for use in miRNA downregulation assays.

In the in vivo function test, the aae-miR-34-3p agomir/antagomir was injected into the thorax of CO2-anesthetized female mosquitoes at day 3 post-eclosion at a dose of 800 μM in a volume of 207 nL using the same method as mentioned above. Female mosquitoes were injected with the same dose of the miRNA control reagent, which is a random sequence that cannot bind to the genome of Ae. aegypti. To test the impact of aae-miR-34-3p on mRNA expression, whole mosquito samples (one mosquito as one sample) were collected at day 5 post-injection. To explore the role of aae-miR-34-3p in DENV infection, the females from each group were subjected to DENV-2 infection via thorax injection at 3 days post-injection.

In the in vitro function test, the cells were seeded in 48-well and 96-well cell plates 24 h prior to transfection at a density of 2×105 and 1×105 cells per well, respectively. A total of 800 nM miRNA agomir/antagomir with 0.5 μL of DharmaFECT Transfection reagent (Thermo Scientific, KS, USA) in 20 μL of Schneider’s Drosophila medium were incubated for 20 minutes at room temperature. Subsequently, the transfection reagent-miRNA agomir/antagomir complexes were gently added into each well of cells, according to the manufacturer’s instructions. To detect the role of miRNA on Toll pathway-related gene expression, the cell samples from 96-well plates were collected at day 3 and day 5 post-transfection for RNA extraction, and cell samples from 48-well plates were collected at day 5 post-transfection for protein extraction. To analyze the effect of miRNA on DENV replication, the cells were subjected to DENV infection with a second transfection of 800 nM miRNA reagent at day 3 post-transfection.

DENV infection

The New Guinea C (NGC) strain of DENV serum type 2 was used for Ae. aegypti in vivo and in vitro viral infection assays. Initially, C6/36 cell monolayers at 80% confluence were infected with a DENV-2 stock (107 pfu/mL) at an MOI of 1.0 at 32°C for 1 h, and then viral culture medium (MEM supplemented with 2% heat-inactivated FBS, 1% penicillin/streptomycin, 1% L-glutamine, and 1% nonessential amino acids) was added to the cell monolayers after the removal of DENV-2. Subsequently, DENV-2 was propagated in C6/36 cells at 32°C with 5% (v/v) CO2 and collected at 7 days post-infection for the viral infection assay.

In the in vivo viral infection assay, mosquitoes were infected with DENV-2 through either oral feeding or thorax injection. For DENV-2-infected blood oral feeding, the freshly collected DENV-2 supernatant mixed with commercial defibrinated sheep blood (Colorado Serum Company, CO, USA) in a 1:1 ratio was maintained at 37°C for 30 min prior to the blood meal. The virus-containing blood meal was offered to female mosquitoes for 45 mins through glass feeders covered with a membrane of porcine intestine, and the feeders were connected to a circulating water bath (Fisher) at 37°C. Subsequently, the mosquitoes were anesthetized immediately post-feeding using CO2, and only the fully engorged mosquitoes were chosen and transferred into a new waterproof cardboard container for further testing. For the DENV-2 infection assay via thorax injection, thorax injection with 69 nL of DENV-2 (107 PFU/mL) was performed on each female mosquito (day 3 post-injection of the miRNA antagomir reagent) using a nanoinjector (Thermo Fisher Scientific). At day 7 post-antagomir injection, whole mosquito samples (one mosquito as one sample) were collected for testing.

In the in vitro viral infection assay, DENV-2 infection was performed in W+ cells and W- cells at day 3 post-transfection of the miRNA agomir or antagomir reagent with an MOI = 1 and MOI = 0.1, respectively. The higher viral dose for W+ cells was because Wolbachia mediated a strong antiviral effect against DENV in W+ cells. The infected cell samples were collected at day 3 post-DENV infection.

Detection of differential expression of miRNA pathway genes

The transcript profiles of the midgut and carcass (remaining tissues except the midgut) from Wolbachia wAlbB-infected and uninfected female Ae. aegypti at 12 days post-DENV infection were downloaded [8] and used for the detection of Wolbachia wAlbB-regulated miRNA pathway regulator genes upon DENV-2 infection. The differentially expressed genes were identified based on a threshold defined as the absolute value of log2(fold-change) ≥0.8.

To validate the differential expression of mRNA in microarray data, the viral infection assay was carried out via DENV-containing blood meal in W+ and W- female mosquitoes at 7 days post-eclosion. At 12 days post-DENV infection, 10 midguts and corresponding carcasses were dissected and pooled as one sample. There were 3 samples for each group. Sample homogenization was performed in 600 μL RLT buffer provided by the RNeasy Mini Kit (QIAGEN Sciences, MD, USA) on ice for 2 min using a disposable sterile enzyme-free pestle. The processed mosquito samples were used for subsequent RNA extraction, cDNA synthesis and quantitative real-time PCR.

Measurement of the differential expression of mRNA via quantitative real-time PCR

Total RNA was extracted from mosquitoes or cells using an RNeasy Mini Kit (QIAGEN Sciences), and then cDNA was synthesized using a QuantiTect Reverse Transcription Kit (QIAGEN Sciences) according to the manufacturer’s recommendations [5]. Quantitative real-time PCR was conducted using a Quantities SYBR Green PCR Kit (QIAGEN Sciences) and an ABI Prism 7900HT Sequence Detection System. The primers for the ribosomal protein S6 (RPS6) gene [8] and NS5 gene of DENV-2 [9] were described previously. The other primers used for qPCR are listed in S4 Table. The real copy numbers of the NS5 and RPS6 genes were detected based on the standard curve generated using ten-fold serial dilutions from 1×108 to 1×101 copies/μL of the DNA plasmid containing the NS5 or RPS6 gene, respectively. The RPS6 gene was used for normalization of cDNA templates. In addition, the relative quantification of other mRNAs was carried out according to the Ct value using the 2-ΔΔCT method.

Small RNA sequencing

Total RNA was extracted from W+ and W- cells for three biological replicates of pooled cell mixtures from day 1 to day 5 post-cell passage using TRIzol reagent (Invitrogen) per the manufacturer’s protocol. The quality and quantity of RNA samples were assessed by a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) and a Bioanalyzer 2100 System with an RNA Pico 6000 Assay Kit (Agilent Technologies, CA, USA). Subsequently, the miRNA library and small RNA sequencing were constructed at Biomarker Technologies. In brief, 1 μg of total RNA for each sample was used in the synthesis of a small RNA library, according to the manufacturer’s recommendation for the NEBNext Small RNA Library Prep Set (New England Biolabs, USA). Specialized adaptors were used to ligate both ends of the cDNA fragments, introducing a unique barcode for each library. Library quality was evaluated using the Agilent Bioanalyzer 2100 system. The validated libraries were sequenced on the Illumina HiSeq2500 at Biomarker Technologies, resulting in 50 bp single-end reads. No spike-in controls were used in the construction of this dataset.

miRNA quantification and differential expression analysis

The raw sequencing data underwent quality assessment to generate clean reads by filtering out adapter-containing reads, poly-N-containing reads, and low-quality reads. Subsequently, the high-quality 18- to 30-nt clean reads were filtered for elimination of ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), other ncRNA, and repetitive sequences by Bowtie software (http://bowtieapp.com/) based on the SILVA ribosomal RNA database (https://www.arb-silva.de), Genomic tRNA Database (GtRNAdb), Rfam database (http://www.sanger.ac.uk/Software/Rfam), and Repbase (https://www.girinst.org/repbase). The remaining clean reads that could be mapped to Ae. aegypti reference genome (GCF_002204515.2) from NCBI (https://www.ncbi.nlm.nih.gov/) and matched to known Ae. aegypti miRNAs from miRbase (http://www.mirbase.org) were used for further analysis.

The transcripts per million (TPM) normalization method [45,46] was employed for the determination of miRNA expression levels. Then, the DE miRNAs were defined based on |log2(fold-change)| ≥1 and false discovery rate(FDR)≤0.05 by DESeq2 software [47]. Moreover, a heat map of top 15 up-regulated and down-regulated miRNAs was generated based on the TPM value in each sample using TBtools software (https://github.com/CJ-Chen/TBtools/releases) [48].

Validation of differentially expressed miRNAs via real-time quantitative PCR

The miRNAs were extracted from female mosquitoes (day 7 post-eclosion without blood feeding) and cell samples (pooled samples with cells collected from day 1 to day 5 post-cell passage) using a miPure Cell/Tissue miRNA Kit (Vazyme, Nanjing, China) according to the manufacturer’s protocol. Following treatment with DNase I (Invitrogen), the purified miRNAs were converted to cDNA using a thermal cycler (Bio-Rad, CA, USA) with a Mir-X miRNA First-Strand Synthesis Kit (Takara, Kusatsu, Japan). The DE miRNAs were verified with the CFX96 PCR detection system (Bio-Rad) using TB Green Advantage qPCR Premix (Takara). The miRNA sequence-specific forward primers are summarized in S5 Table, and the universal reverse primer from the Mir-X miRNA First-Strand Synthesis Kit (Takara) is complementary to the 3’-end universal tag sequence of miRNAs. The thermocycling conditions were as follows: 95°C for 30 sec of denaturation, followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec. Finally, the relative quantification of miRNA was carried out according to the Ct value using the 2-ΔΔCT method with the S7 and S5 gene serving as the reference gene for mosquito and cell samples, respectively. In addition, the expression of miRNAs was normalized to the amount of cDNA template (100 ng), and the results are shown in the supporting information.

Detection of nuclear and cytoplasmic miRNA

The cell samples were collected using 200 μL of ice-cold lysis buffer from a Cytoplasmic and Nuclear RNA Purification Kit (Norgen BioTek, ON, Canada) with three replicates. Nuclear and cytoplasmic RNA fractions from cell samples were isolated according to the manufacturer’s instructions. The effectiveness of cellular separation was ensured by assessment of the cytoplasmic and nuclear markers actin and U6, respectively. Subsequently, cDNA synthesis and amplification were conducted as described above via qPCR, and the relative quantification of cytoplasmic and nuclear miRNA was performed using the 2-ΔΔCT method with the reference gene of actin and U6 gene, respectively.

Western blot analysis

Proteins were extracted from W+ and W- Ae. aegypti cells at day 5 post-transfection or day 5 post-passage. For each group, 2×106 cells per sample were collected in 200μL lysis buffer containing 1% (v/v) halt proteinase inhibitor cocktail, 0.1% (v/v) phosphatase inhibitor, and 0.5% (v/v) 100 mM PMSF from the whole protein extraction kit (KeyGEN BioTECH, Jiangsu, China) according to the manufacturer’s protocol recommendation. Following a 30-min incubation on ice, the lysed cells were centrifuged at 12,000 × g for 10 min at 4°C and the supernatant was collected. Protein was then quantified using the BCA protein assay kit (KeyGEN BioTECH).

After incubation at 100°C for 10 min with the protein loading buffer (Coolaber, Beijing, China), the weighted proteins were subjected to 10% SDS-PAGE gel electrophoresis at a constant voltage of 120 V, and then transferred to PVDF membranes (Millipore, MA, USA) at a constant 300 mA. The membranes were blocked with 5% non-fat milk for 2 h and then incubated overnight at 4°C with primary antibodies, including the mouse monoclonal anti-MyD88 antibody (Proteintech, Wuhan, China, 67969-1-Ig, 1:500) and the mouse monoclonal anti-β-actin antibody (Proteintech, 67969-1-Ig, 1:1000). After being washed three times for 10 min each with TBS-T (0.1% Tween-20) at room temperature, the membranes were incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG secondary antibody (Abbkine, China, 1:5000) at room temperature for 2 h. The ECL staining fluid (Abbkine) was used for imaging on the ChemiDoc MP Imaging System (BIO-RAD). The relative protein expression was compared between the W+ and W- cell groups, agomir and agomir control-treated groups, antagomir and antagomir control groups, according to the gray values of the protein bands measured by ImageJ software. Normalization was performed using the loading control of β-actin.

Prediction of binding sites for RNA interaction

RNAhybrid [24] and RNA22 [25] software were used to search for potential binding sites between Toll pathway regulator gene mRNA and 2 DE miRNAs in Ae. aegypti genome, based on the three main criteria, namely, a complementarity of seed region ≥ 7, an MFE < -25 kcal/mol and P < 0.05. Moreover, the possible interaction between lncRNA and aae-miR-34-3p was predicted according to the threshold MFE value ≤ -30 kcal/mol, P < 0.05 and |log2(fold-change)| ≥1, where fold change refers to the fold change of lncRNA expression level between W+ and W- cells.

Measurement of lncRNA expression via quantitative PCR

lncRNA was isolated from mixed cell samples from day 1 to day 5 post-cell passage via a miPure Cell/Tissue miRNA Kit (Vazyme) and then used for cDNA synthesis with a PrimeScript RT Reagent Kit (Takara). lncRNA quantification was conducted on a CFX96 PCR detection system (Bio-Rad) using TB Green Advantage qPCR Premix (Takara) with the sequence-specific primers listed in S5 Table. The qPCR conditions were as follows: initial denaturation at 95°C for 3 min, followed by 40 amplification cycles of denaturation at 95°C for 10 sec, 55°C for 30 sec of annealing, and 72°C for 30 sec of extension. The relative expression of lncRNAs was analyzed using the 2-ΔΔCT method, with the RPS6 gene serving as the reference gene.

Detection of lncRNA via conventional PCR and electrophoresis

The expression of lncRNA was detected by conventional PCR using GoTaq Green Master Mix (Promega, Madison, WI, USA) with the primers listed in S5 Table. The PCR conditions were set as follows: initial denaturation at 95°C for 2 min, followed by 35 cycles of 95°C for 45 s, 60°C for 30 s, and 72°C for 15 s, extension at 72°C for 5 min, and 4°C until collection. The RPS6 gene was used to confirm the quality of the cDNA samples. The PCR products were evaluated via 2% agarose gel electrophoresis with GelRed (Vazyme) staining. The gel image of PCR products was visualized and analyzed using Gel Doc XR+ (Bio-Rad).

Fluorescence in situ hybridization (FISH)

The cell samples from each treatment group with 4 biological replicates were fixed in 8-well cell culture chamber slides (Biologix, China) with 4% paraformaldehyde (Solarbio, Beijing, China) at 4°C for 1 h and then washed 3 times with PBST [0.1% (v/v) Tween 20 in PBS]. Permeabilization was performed using 100 μL of 0.1% Triton X-100 (GenePharma, Suzhou, China) at room temperature for 15 min. To visualize the distribution of Wolbachia and aae-miR-34-3p, hybridization was conducted with 1 μM 6-carboxyfluorescein (FAM)-labeled aae-miR-34-3p probe and 1 μM Sulfo-Cyanine3 (Cy3)-labeled 16S rDNA Wolbachia probe [7] (synthesized by GenePharma) in buffer E (RNA FISH Kit, GenePharma) at 37°C for 24 h, following the manufacturer’s instructions. In addition, to visualize the intracellular localization of aae-lnc-2268 and aae-miR-34-3p, hybridization was performed with 5 μM Cy3-labeled aae-lnc-2268 probe (synthesized by GenePharma) and 1 μM FAM-labeled aae-miR-34-3p probe in buffer E at 37°C for 48 h in the dark. After washing, the cells were stained with 100 μL of 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, included in the kit) at room temperature for 15 min in the dark. The samples were viewed on a Leica Confocal Microscope system (Leica TCS SP8, Wetzlar, Germany). The Leica Application Suite software was used to capture 3–4 images randomly for each sample from different groups. The images were taken with the same laser intensity value, laser power, master gain value, digital offset value, and digital gain value under each fluorescence channel to ensure consistency for comparison. Fluorescence intensity was quantified using ImageJ software [49] and normalized to cell number, based on 14 individual samples per group. Probe sequences are summarized in S6 Table.

lncRNA functional assay

A lncRNA functional assay was performed when the monolayer cells reached 80% confluence in 96-well plates. In the lncRNA downregulation assay, aae-lnc-2268 sequence-specific siRNAs or negative controls (synthesized by GenePharma Co., Ltd. S3 Table) at 300 nM per well were transfected with Lipofectamine 2000 reagent following the manufacturer’s instructions. The cell samples at 48 h, 96 h, and 120 h post-transfection were used for the measurement of lncRNA, miRNA, and mRNA expression, respectively.

In the functional rescue assay, cells were first transfected with aae-lnc-2268 siRNAs or the negative control using Lipofectamine 2000 reagent (Invitrogen). At 48 h post-transfection, the cells were subjected to a second transfection with 800 nM aae-miR-34-3p antagomir or negative control antagomir. Four groups of transfected cells were used for comparison: aae-lnc-2268 siRNA with the aae-miR-34-3p antagomir, aae-lnc-2268 siRNA with the negative control antagomir, negative control siRNA with the aae-miR-34-3p antagomir, and negative control siRNA with the negative control antagomir. At 72 h after the second transfection, cell samples were collected for further analysis.

Dual-luciferase reporter assay

In the investigation of the binding relationship between the MyD88 gene and aae-miR-34-3p, psi-CHECK-2-WT-MyD88 and psi-CHECK-2-MUT-MyD88 plasmids were employed to express a 25-nt predicted binding sequence and a 24-nt binding sequence with 8 base mutations, respectively. In addition, the psi-CHECK-2-WT-2268 and psi-CHECK-2-MUT-2268 plasmids were constructed to express a 24-nt predicted binding sequence and a mutated binding sequence (7 base mutations) between the aae-lnc-2268 and aae-miR-34-3p, respectively. The above luciferase reporter plasmids were constructed by Sangon Biotech (Shanghai, China). The predicted or mutated binding site sequences were cloned into the NotI and XhoI restriction sites located downstream of the Renilla luciferase translational stop codon in the 3’-UTR of the psi-CHECK-2 vector.

293T cells in 24-well plates were cotransfected with 500 ng of plasmid and 140 nM miRNA agomir (aae-miR-34-3p agomir or the negative control agomir) using Lipofectamine 2000 reagent (Invitrogen). The relative luciferase activities were detected using a dual−luciferase reporter assay system (Promega) at 48 h post-transfection and normalized to the internal reference of firefly luciferase activity.

Quantification and statistical analysis

Repeated measures ANOVA was used to determine the difference in miRNA intensity between W+ and W- cells at three distinct time points. Two-way ANOVA was utilized to assess the alteration of MyD88 expression between W+ and W- cells in response to the different treatment in the miRNA upregulation assay. One-way ANOVA was used for pairwise comparisons among multiple groups in comparisons of the relative luciferase activity in the dual−luciferase reporter assay, lncRNA rescue assay, and DENV infection assay. Student’s t test was used for pairwise comparisons between two groups of mRNAs, miRNAs and lncRNAs, and the differences in DENV infection levels between two groups in Ae. aegypti. A P value lower than 0.05 was considered to indicate statistical significance. The experimental results are expressed as the mean ± standard error of the mean (mean ± SEM). All data were analyzed with GraphPad Prism 9.0 and IBM SPSS statistic 25.0 software.

Supporting information

S1 Table. Small RNA sequencing information.

(DOCX)

ppat.1012296.s001.docx (13.6KB, docx)
S2 Table. The differentially expressed miRNAs in Ae. aegypti induced by Wolbachia wAlbB.

(DOCX)

ppat.1012296.s002.docx (16.8KB, docx)
S3 Table. The sequence-specific reagents used in the miRNA and lncRNA function assays.

(DOCX)

ppat.1012296.s003.docx (14KB, docx)
S4 Table. The sequence of mRNA primers used in qPCR.

(DOCX)

ppat.1012296.s004.docx (15.9KB, docx)
S5 Table. The primer sequence used in quantification of noncoding RNAs via PCR.

(DOCX)

ppat.1012296.s005.docx (17.4KB, docx)
S6 Table. The fluorescent RNA probes used in FISH.

(DOCX)

ppat.1012296.s006.docx (14KB, docx)
S1 Fig. Induced miRNAs identified by RNA sequencing analysis of both cytoplasm and whole cell using qPCR with normalization of weighted cDNA templates.

The expression of 6 out of the top 15 up-regulated DE miRNAs was increased in whole-cell samples (left panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-989: P = 0.0005, aae-miR-980-5p: P = 0.0411, aae-miR-980-3p: P = 0.0156, aae-miR-34-3p: P = 0.0092, aae-miR-277-3p: P = 8.4345×10−5, aae-miR-2765: P = 0.0025) and cytoplasm samples (right panel, two-sided t test, W-: n = 3, W+: n = 3, aae-miR-989: P = 0.0005, aae-miR-980-5p: P = 0.0043, aae-miR-980-3p: P = 0.0002, aae-miR-34-3p: P = 0.0026, aae-miR-277-3p: P = 1.3807×10−6, aae-miR-2765: P = 0.0002) from W+ cells in qPCR analysis. The expression of miRNAs was normalized to the amount of cDNA template (100 ng). The error bars indicate the standard error. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05.

(TIF)

ppat.1012296.s007.tif (462.3KB, tif)
S2 Fig. Suppressed miRNAs identified by RNA sequencing analysis both cytoplasm and whole cell using qPCR with normalization of weighted cDNA templates.

qPCR analysis showed that the expression of 6 out of the top 15 downregulated DE miRNAs was decreased in whole-cell samples (left panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-9a: P = 0.0043, aae-miR-281-5p: P = 0.0010, aae-miR-252-5p: P = 0.0449, aae-miR-2a-3p: P = 0.0192, aae-miR-12-5p: P = 0.0089, aae-miR-1175-5p: P = 2.1435×10−6) and cytoplasm samples (right panel, two-sided t test, W-: n = 3, W+: n = 3, aae-miR-9a: P = 0.0130, aae-miR-281-5p: P = 0.0005, aae-miR-252-5p: P = 0.0087, aae-miR-2a-3p: P = 0.0058, aae-miR-12-5p: P = 0.0002, aae-miR-1175-5p: P = 0.0033) from W+ cells in small RNA sequencing. The expression of miRNAs was normalized to the amount of cDNA template (100 ng). The error bars indicate the standard error. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05.

(TIF)

ppat.1012296.s008.tif (459.2KB, tif)
S3 Fig. The binding relationship between aae-miR-34-3p and MyD88 gene.

(A) Schematic representation of the construct psi-CHECK-2 plasmids used in the dual luciferase reporter assay shown in the upper panel. A schematic diagram of the predicted binding sites between aae-miR-34-3p agomir and MyD88 plasmids in the dual luciferase reporter assay shown in the bottom panel. (B) The binding relationship between MyD88 and aae-miR-34-3p was determined via a dual-luciferase reporter assay (one-way ANOVA, Luc-MUT+AC: n = 6, Luc-MyD88+AC: n = 6, Luc-MUT+A-34-3p: n = 6, Luc-MyD88+A-34-3p: n = 6, Luc-MUT+AC vs. Luc-MyD88+A-34-3p: P = 0.0326, Luc-MUT+AC vs. Luc-MyD88+AC: P = 0.8503, Luc-MUT+AC vs. Luc-MUT+A-34-3p: P = 0.9680, Luc-MyD88+AC vs. Luc-MyD88+A-34-3p:P = 0.0055, Luc-MUT+A-34-3p vs. Luc-MyD88+A-34-3p: P = 0.0363). Luc-MUT+AC: group cotransfected with psi-CHECK-2-MUT-MyD88 and agomir control, Luc-MyD88+A-34-3p: group with cotransfection of psi-CHECK-2-WT-MyD88 and aae-miR-34-3p agomir, Luc-MyD88+AC: group cotransfected with psi-CHECK-2-WT-MyD88 and agomir control, Luc-MUT+A-34-3p: group cotransfected with psi-CHECK-2-MUT-MyD88 and aae-miR-34-3p agomir. The error bars indicate the standard error. Each circle indicates a replicate per tested group. **P < 0.01; *P < 0.05; ns, non-significant.

(TIF)

ppat.1012296.s009.tif (693.9KB, tif)
S4 Fig. The Ct value of aae-lnc-2268 in W- and W+ cells determined by qPCR.

The black line indicates the mean Ct value. Each circle indicates a Ct value for aae-lnc-2268 or the RPS6 gene. The red dashed line indicates the threshold Ct value of 40.

(TIF)

ppat.1012296.s010.tif (497KB, tif)
S1 Raw Images. Raw images in this study.

(PDF)

ppat.1012296.s011.pdf (990.5KB, pdf)
S1 Data. Supporting data underlying the figures.

(XLSX)

ppat.1012296.s012.xlsx (73.6KB, xlsx)

Acknowledgments

We thank the Engineering Research Center of Reproduction and Translational Medicine of Hunan Province and the Key Laboratory of Protein Chemistry and Developmental Biology of Fish of the Ministry of Education for providing the platform and support.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This project has received funding from the Key Program of Natural Science Foundation of Hunan Province of China (2024JJ3025) to XP; the Key Program of Science Foundation of Hunan Educational Committee (22A0028) to XP; the National Natural Science Foundation of China for grants 81873967 and 81702036 to XP; the Natural Science Foundation of Hunan Province, China, for grants 2019JJ20013 and 2018RS3068 to XP; grants from Hunan Normal University (23CSY163 to MS, KF2022025 to TC, 22CSY170 to RW, KF2021018 to LS, 21CSY059 to HY, 21CSY058 to LS, 20CSY103 to QZ, and 20CSY102 to WM); and the National Institutes of Health/National Institute of Allergy and Infectious Disease R01AI080597 to ZX. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Wong JM, Adams LE, Durbin AP, Muñoz-Jordán JL, Poehling KA, Sánchez-González LM, et al. Dengue: a growing problem with new interventions. Pediatrics. 2022;149(6):e2021055522. doi: 10.1542/peds.2021-055522 [DOI] [PubMed] [Google Scholar]
  • 2.Huang CH, Tsai YT, Wang SF, Wang WH, Chen YH. Dengue vaccine: an update. Expert Rev Anti Infect Ther. 2021;19(12):1495–1502. doi: 10.1080/14787210.2021.1949983 [DOI] [PubMed] [Google Scholar]
  • 3.Xi Z, Khoo CC, Dobson SL. Wolbachia establishment and invasion in an Aedes aegypti laboratory population. Science. 2005;310(5746):326–328. doi: 10.1126/science.1117607 [DOI] [PubMed] [Google Scholar]
  • 4.Zheng X, Zhang D, Li Y, Yang C, Wu Y, Liang X, et al. Incompatible and sterile insect techniques combined eliminate mosquitoes. Nature. 2019;572(7767):56–61. doi: 10.1038/s41586-019-1407-9 [DOI] [PubMed] [Google Scholar]
  • 5.Lu P, Bian G, Pan X, Xi Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl Trop Dis. 2012;6(7):e1754. doi: 10.1371/journal.pntd.0001754 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, chikungunya, and Plasmodium. Cell. 2009;139(7):1268–1278. doi: 10.1016/j.cell.2009.11.042 [DOI] [PubMed] [Google Scholar]
  • 7.Bian G, Joshi D, Dong Y, Lu P, Zhou G, Pan X, et al. Wolbachia invades Anopheles stephensi populations and induces refractoriness to Plasmodium infection. Science. 2013;340(6133):748–751. doi: 10.1126/science.1236192 [DOI] [PubMed] [Google Scholar]
  • 8.Pan X, Zhou G, Wu J, Bian G, Lu P, Raikhel AS, et al. Wolbachia induces reactive oxygen species (ROS)-dependent activation of the Toll pathway to control dengue virus in the mosquito Aedes aegypti. Proc. Natl. Acad. Sci. U.S.A. 2012;109(1):E23–E31. doi: 10.1073/pnas.1116932108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bian G, Xu Y, Lu P, Xie Y, Xi Z. The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti. PLoS Pathog. 2010;6(4):e1000833. doi: 10.1371/journal.ppat.1000833 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Xi Z, Ramirez JL, Dimopoulos G. The Aedes aegypti Toll pathway controls dengue virus infection. PLoS Pathog. 2008;4(7):e1000098. doi: 10.1371/journal.ppat.1000098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hussain M, Frentiu FD, Moreira LA, O’Neill SL, Asgari S. Wolbachia uses host microRNAs to manipulate host gene expression and facilitate colonization of the dengue vector Aedes aegypti. Proc. Natl. Acad. Sci. U.S.A. 2011;108(22):9250–9255. doi: 10.1073/pnas.1105469108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhang G, Hussain M, O’Neill SL, Asgari S. Wolbachia uses a host microRNA to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti. Proc. Natl. Acad. Sci. U.S.A. 2013;110(25):10276–10281. doi: 10.1073/pnas.1303603110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fraser JE, O’Donnell TB, Duyvestyn JM, O’Neill SL, Simmons CP, Flores HA. Novel phenotype of Wolbachia strain wPip in Aedes aegypti challenges assumptions on mechanisms of Wolbachia-mediated dengue virus inhibition. PLoS Pathog. 2020;16(7):e1008410. doi: 10.1371/journal.ppat.1008410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mayoral JG, Etebari K, Hussain M, Khromykh AA, Asgari S. Wolbachia infection modifies the profile, shuttling and structure of microRNAs in a mosquito cell line. PLoS One. 2014;9(4):e96107. doi: 10.1371/journal.pone.0096107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ha M, Kim VN. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 2014;15(8):509–524. doi: 10.1038/nrm3838 [DOI] [PubMed] [Google Scholar]
  • 16.Lucas KJ, Myles KM, Raikhel AS. Small RNAs: a new frontier in mosquito biology. Trends Parasitol. 2013;29(6):295–303. doi: 10.1016/j.pt.2013.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang G, Hussain M, Asgari S. Regulation of arginine methyltransferase 3 by a Wolbachia-induced microRNA in Aedes aegypti and its effect on Wolbachia and dengue virus replication. Insect Biochem. Mol. Biol. 2014;53:81–88. doi: 10.1016/j.ibmb.2014.08.003 [DOI] [PubMed] [Google Scholar]
  • 18.Schultz MJ, Isern S, Michael SF, Corley RB, Connor JH, Frydman HM. Variable inhibition of Zika virus replication by different Wolbachia strains in mosquito cell cultures. Journal of Virology. 2017;91(14):e00339–17. doi: 10.1128/JVI.00339-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mousson L, Zouache K, Arias-Goeta C, Raquin V, Mavingui P, Failloux AB. The Native Wolbachia Symbionts Limit Transmission of Dengue Virus in Aedes albopictus. PLoS Neglected Tropical Diseases. 2012;6(12):1–10. doi: 10.1371/journal.pntd.0001989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lindsey ARI, Bhattacharya T, Newton ILG, Hardy RW. Conflict in the Intracellular Lives of Endosymbionts and Viruses: A Mechanistic Look at Wolbachia-Mediated Pathogen-blocking. Viruses. 2018;10(4):141. doi: 10.3390/v10040141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mao W, Zeng Q, She L, Yuan H, Luo Y, Wang R, et al. Wolbachia utilizes lncRNAs to activate the anti-dengue Toll pathway and balance reactive oxygen species stress in Aedes aegypti through a competitive endogenous RNA network. Front. Cell. Infect. Microbiol. 2022;11:823403. doi: 10.3389/fcimb.2021.823403 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Liu J, Liu Y, Nie K, Du S, Qiu J, Pang X, et al. Flavivirus NS1 protein in infected host sera enhances viral acquisition by mosquitoes. Nat. Microbiol. 2016;1(9):16087. doi: 10.1038/nmicrobiol.2016.87 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhu Y, Tong L, Nie K, Wiwatanaratanabutr I, Sun P, Li Q, et al. Host serum iron modulates dengue virus acquisition by mosquitoes. Nat. Microbiol. 2019;4(12):2405–2415. doi: 10.1038/s41564-019-0555-x [DOI] [PubMed] [Google Scholar]
  • 24.Krüger J, Rehmsmeier M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006;34:W451–W454. doi: 10.1093/nar/gkl243 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Loher P, Rigoutsos I. Interactive exploration of RNA22 microRNA target predictions. Bioinformatics. 2012;28(24):3322–3323. doi: 10.1093/bioinformatics/bts615 [DOI] [PubMed] [Google Scholar]
  • 26.Lee YS, Nakahara K, Pham JW, Kim K, He Z, Sontheimer EJ, et al. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell. 2004;117(1):69–81. doi: 10.1016/s0092-8674(04)00261-2 [DOI] [PubMed] [Google Scholar]
  • 27.Niu J, Meeus I, De Coninck DI, Deforce D, Etebari K, Asgari S, et al. Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris. Sci Rep. 2017;7:45620. doi: 10.1038/srep45620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang GH, Jiang L, Zhu L, Cheng TC, Niu WH, Yan YF, et al. Characterization of Argonaute family members in the silkworm, Bombyx mori. Insect Science. 2013;20(1):78–91. doi: 10.1111/j.1744-7917.2012.01555.x [DOI] [PubMed] [Google Scholar]
  • 29.Mukherjee S, Hanley KA. RNA interference modulates replication of dengue virus in Drosophila melanogaster cells. BMC Microbiol. 2010;10:127. doi: 10.1186/1471-2180-10-127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bishop C, Hussain M, Hugo LE, Asgari S. Analysis of Aedes aegypti microRNAs in response to Wolbachia wAlbB infection and their potential role in mosquito longevity. Sci Rep. 2022;12(1):15245. doi: 10.1038/s41598-022-19574-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Cui C, Wang Y, Li Y, Sun P, Jiang J, Zhou H, et al. Expression of mosquito miRNAs in entomopathogenic fungus induces pathogen-mediated host RNA interference and increases fungal efficacy. Cell Rep. 2022;41(4):111527. doi: 10.1016/j.celrep.2022.111527 [DOI] [PubMed] [Google Scholar]
  • 32.Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, et al. MicroRNAs activate gene transcription epigenetically as an enhancer trigger. RNA biology. 2017;14(10):1326–1334. doi: 10.1080/15476286.2015.1112487 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sartorelli V, Lauberth SM. Enhancer RNAs are an important regulatory layer of the epigenome. Nat Struct Mol Biol. 2020;27(6):521–528. doi: 10.1038/s41594-020-0446-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Couzigou JM, Lauressergues D, André O, Gutjahr C, Guillotin B, Bécard G, et al. Positive gene regulation by a natural protective miRNA enables arbuscular mycorrhizal symbiosis. Cell Host Microbe. 2017;21(1):106–112. doi: 10.1016/j.chom.2016.12.001 [DOI] [PubMed] [Google Scholar]
  • 35.Roberts AP, Lewis AP, Jopling CL. MiR-122 activates hepatitis C virus translation by a specialized mechanism requiring particular RNA components. Nucleic Acids Res. 2011;39(17): 7716–7729. doi: 10.1093/nar/gkr426 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yang Z, Sun Q, Guo J, Wang S, Song G, Liu W, et al. GRSF1-mediated MIR-G-1 promotes malignant behavior and nuclear autophagy by directly upregulating TMED5 and LMNB1 in cervical cancer cells. Autophagy. 2019;15(4):668–685. doi: 10.1080/15548627.2018.1539590 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 37.Correction for Place et al. MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc. Natl. Acad. Sci. U.S.A. 2018;115(14):E3325. doi: 10.1073/pnas.1803343115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Place RF, Li LC, Pookot D, Noonan EJ, Dahiya R. MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc. Natl. Acad. Sci. U. S. A. 2008;105(5):1608–1613. doi: 10.1073/pnas.0707594105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hussain M, Bradshaw T, Lee M, Asgari S. The involvement of atlastin in dengue virus and Wolbachia infection in Aedes aegypti and its regulation by aae-miR-989. Microbiol. Spectr. 2022;10(5):e0225822. doi: 10.1128/spectrum.02258-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hussain M, Walker T, O’Neill SL, Asgari S. Blood meal induced microRNA regulates development and immune associated genes in the dengue mosquito vector, Aedes aegypti. Insect Biochem. Mol. Biol. 2013;43(2):146–152. doi: 10.1016/j.ibmb.2012.11.005 [DOI] [PubMed] [Google Scholar]
  • 41.Stavast CJ, Erkeland SJ. The non-canonical aspects of microRNAs: many roads to gene regulation. Cells. 2019;8(11):1465. doi: 10.3390/cells8111465 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pan X, Pike A, Joshi D, Bian G, McFadden MJ, Lu P, et al. The bacterium Wolbachia exploits host innate immunity to establish a symbiotic relationship with the dengue vector mosquito Aedes aegypti. Isme J. 2018;12(1):277–288. doi: 10.1038/ismej.2017.174 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Lu P, Sun Q, Fu P, Li K, Liang X, Xi Z. Wolbachia inhibits binding of dengue and zika viruses to mosquito cells. Front. Microbiol. 2020;11:1750. doi: 10.3389/fmicb.2020.01750 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Garver L, Dimopoulos G. Protocol for RNAi assays in adult mosquitoes (A. gambiae). Journal of visualized experiments. J. Vis. Exp. 2007;(5):230. doi: 10.3791/230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics. 2011;12:323–323. doi: 10.1186/1471-2105-12-323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wagner GP, Kin K, Lynch VJ. Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples. Theory Biosci. 2012;131(4):281–285. doi: 10.1007/s12064-012-0162-3 [DOI] [PubMed] [Google Scholar]
  • 47.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. doi: 10.1186/s13059-014-0550-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, et al. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol Plant. 2020;13(8):1194–1202. doi: 10.1016/j.molp.2020.06.009 [DOI] [PubMed] [Google Scholar]
  • 49.Schroeder AB, Dobson ETA, Rueden CT, Tomancak P, Jug F, Eliceiri KW. The imageJ ecosystem: open-source software for image visualization, processing, and analysis. Protein Sci. 2021;30(1):234–249. doi: 10.1002/pro.3993 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Small RNA sequencing information.

(DOCX)

ppat.1012296.s001.docx (13.6KB, docx)
S2 Table. The differentially expressed miRNAs in Ae. aegypti induced by Wolbachia wAlbB.

(DOCX)

ppat.1012296.s002.docx (16.8KB, docx)
S3 Table. The sequence-specific reagents used in the miRNA and lncRNA function assays.

(DOCX)

ppat.1012296.s003.docx (14KB, docx)
S4 Table. The sequence of mRNA primers used in qPCR.

(DOCX)

ppat.1012296.s004.docx (15.9KB, docx)
S5 Table. The primer sequence used in quantification of noncoding RNAs via PCR.

(DOCX)

ppat.1012296.s005.docx (17.4KB, docx)
S6 Table. The fluorescent RNA probes used in FISH.

(DOCX)

ppat.1012296.s006.docx (14KB, docx)
S1 Fig. Induced miRNAs identified by RNA sequencing analysis of both cytoplasm and whole cell using qPCR with normalization of weighted cDNA templates.

The expression of 6 out of the top 15 up-regulated DE miRNAs was increased in whole-cell samples (left panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-989: P = 0.0005, aae-miR-980-5p: P = 0.0411, aae-miR-980-3p: P = 0.0156, aae-miR-34-3p: P = 0.0092, aae-miR-277-3p: P = 8.4345×10−5, aae-miR-2765: P = 0.0025) and cytoplasm samples (right panel, two-sided t test, W-: n = 3, W+: n = 3, aae-miR-989: P = 0.0005, aae-miR-980-5p: P = 0.0043, aae-miR-980-3p: P = 0.0002, aae-miR-34-3p: P = 0.0026, aae-miR-277-3p: P = 1.3807×10−6, aae-miR-2765: P = 0.0002) from W+ cells in qPCR analysis. The expression of miRNAs was normalized to the amount of cDNA template (100 ng). The error bars indicate the standard error. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05.

(TIF)

ppat.1012296.s007.tif (462.3KB, tif)
S2 Fig. Suppressed miRNAs identified by RNA sequencing analysis both cytoplasm and whole cell using qPCR with normalization of weighted cDNA templates.

qPCR analysis showed that the expression of 6 out of the top 15 downregulated DE miRNAs was decreased in whole-cell samples (left panel, two-sided t test, W-: n = 4, W+: n = 4, aae-miR-9a: P = 0.0043, aae-miR-281-5p: P = 0.0010, aae-miR-252-5p: P = 0.0449, aae-miR-2a-3p: P = 0.0192, aae-miR-12-5p: P = 0.0089, aae-miR-1175-5p: P = 2.1435×10−6) and cytoplasm samples (right panel, two-sided t test, W-: n = 3, W+: n = 3, aae-miR-9a: P = 0.0130, aae-miR-281-5p: P = 0.0005, aae-miR-252-5p: P = 0.0087, aae-miR-2a-3p: P = 0.0058, aae-miR-12-5p: P = 0.0002, aae-miR-1175-5p: P = 0.0033) from W+ cells in small RNA sequencing. The expression of miRNAs was normalized to the amount of cDNA template (100 ng). The error bars indicate the standard error. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05.

(TIF)

ppat.1012296.s008.tif (459.2KB, tif)
S3 Fig. The binding relationship between aae-miR-34-3p and MyD88 gene.

(A) Schematic representation of the construct psi-CHECK-2 plasmids used in the dual luciferase reporter assay shown in the upper panel. A schematic diagram of the predicted binding sites between aae-miR-34-3p agomir and MyD88 plasmids in the dual luciferase reporter assay shown in the bottom panel. (B) The binding relationship between MyD88 and aae-miR-34-3p was determined via a dual-luciferase reporter assay (one-way ANOVA, Luc-MUT+AC: n = 6, Luc-MyD88+AC: n = 6, Luc-MUT+A-34-3p: n = 6, Luc-MyD88+A-34-3p: n = 6, Luc-MUT+AC vs. Luc-MyD88+A-34-3p: P = 0.0326, Luc-MUT+AC vs. Luc-MyD88+AC: P = 0.8503, Luc-MUT+AC vs. Luc-MUT+A-34-3p: P = 0.9680, Luc-MyD88+AC vs. Luc-MyD88+A-34-3p:P = 0.0055, Luc-MUT+A-34-3p vs. Luc-MyD88+A-34-3p: P = 0.0363). Luc-MUT+AC: group cotransfected with psi-CHECK-2-MUT-MyD88 and agomir control, Luc-MyD88+A-34-3p: group with cotransfection of psi-CHECK-2-WT-MyD88 and aae-miR-34-3p agomir, Luc-MyD88+AC: group cotransfected with psi-CHECK-2-WT-MyD88 and agomir control, Luc-MUT+A-34-3p: group cotransfected with psi-CHECK-2-MUT-MyD88 and aae-miR-34-3p agomir. The error bars indicate the standard error. Each circle indicates a replicate per tested group. **P < 0.01; *P < 0.05; ns, non-significant.

(TIF)

ppat.1012296.s009.tif (693.9KB, tif)
S4 Fig. The Ct value of aae-lnc-2268 in W- and W+ cells determined by qPCR.

The black line indicates the mean Ct value. Each circle indicates a Ct value for aae-lnc-2268 or the RPS6 gene. The red dashed line indicates the threshold Ct value of 40.

(TIF)

ppat.1012296.s010.tif (497KB, tif)
S1 Raw Images. Raw images in this study.

(PDF)

ppat.1012296.s011.pdf (990.5KB, pdf)
S1 Data. Supporting data underlying the figures.

(XLSX)

ppat.1012296.s012.xlsx (73.6KB, xlsx)

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.


Articles from PLOS Pathogens are provided here courtesy of PLOS

RESOURCES