Abstract
Background
Contrast-induced acute kidney injury (CI-AKI) is a serious and common complication following the use of iodinated contrast media, with a 20% fatality rate. The function of long non-coding RNA HILPDA (lnc-HILPDA) in CI-AKI development was investigated in this study.
Methods
CI-AKI models were constructed by iopromide treatment. Kidney pathological changes were analyzed by HE staining. TUNEL labeling and flow cytometry were used to examine cell apoptosis. CCK-8 assay was used to determine cell viability. The interactions between lnc-HILPDA, eIF4B, and XPO1 were verified by RIP or Co-IP assay.
Results
Lnc-HILPDA was upregulated in CI-AKI, and its knockdown decreased contrast-trigged oxidative stress and apoptosis in HK-2 cells. Mechanically, lnc-HILPDA activated the NF-κB pathway by upregulating XPO1 through interacting with eIF4B. Moreover, the inhibitory effect of lnc-HILPDA downregulation on contrast-induced oxidative stress and apoptosis in HK-2 cells was weakened by XPO1 overexpression.
Conclusion
Lnc-HILPDA accelerated CI-AKI progression by elevating XPO1 expression through eIF4B to activate NF-κB pathway.
Keywords: contrast-induced acute kidney injury, oxidative stress, apoptosis, Lnc-HILPDA, XPO1
Introduction
Contrast is a clinically used chemical substance that is injected (or absorbed) into human tissues to enhance imaging observation.1 Contrast media used intravenously, on the other hand, can cause acute kidney injury known as contrast-induced acute kidney injury (CI-AKI).2 CI-AKI is the third leading cause of hospital-acquired AKI.3 CI-AKI incidence continuously rises, as high as 30%–50% for those at high risk.4 Conventional therapeutic options have been shown to be ineffective for CI-AKI patients.5 Therefore, there is an urgent need to discover innovative treatment techniques for CI-AKI, and understanding CI-AKI pathogenesis is critical to accomplishing this aim.
Long non-coding RNAs (LncRNAs) are non-coding RNAs that are longer than 200 nts.6 Several studies have showed that lncRNA dysregulation is closely related to CI-AKI development. As evidence, Bao et al. discovered 910 differently expressed lncRNAs in kidney tissue of CI-AKI rats.7 LncRNA NEAT1 expression was markedly increased in the CI-AKI cell model, and its silencing reduced cell injury and apoptosis.8 A previous study reported that lncRNA HILPDA (lnc-HILPDA) was highly expressed in CI-AKI patients and rats.9 Nevertheless, the role and mechanisms of lnc-HILPDA in controlling CI-AKI development are unknown and warrant additional investigation. As reported, the implementation of lncRNA function requires interaction with one or more RNA binding proteins (RBPs) in most cases.10 Using the RBPDB database, it was predicted that lnc-HILPDA may interact with eukaryotic translation initiation factor 4B (eIF4B) in the current research. eIF4B is as identified as a key pathophysiologic component in the progression of nephropathy.11,12 Nevertheless, the function of eIF4B in CI-AKI and the interaction between lnc-HILPDA and eIF4B in regulating CI-AKI progression remain unclear, which deserves further research.
Exportin 1 (XPO1), as a nuclear exporter, regulates the nucleocytoplasmic distribution of over 200 nuclear export signal-containing proteins.13 Notably, XPO1 is closely related to AKI. For instance, Jin et al. demonstrated that XPO1 knockdown ameliorated sepsis-induced AKI in mice.14 However, the expression level and function of XPO1 in CI-AKI haven’t yet been elucidated. As widely reported, eIF4B is a member of eIF4 group, that promotes mRNA interaction with the initiation complex to favor mRNA translation.15 As proof, eIF4B can regulate glutamine metabolism by enhancing Myc translation efficiency.16 Herein, by using the Hitpredict database, it was predicted that eIF4B might interact with XPO1. Therefore, we preliminarily speculate that eIF4B accelerates CI-AKI progression by promoting XPO1 translation.
Based on the above evidence, it’s speculated that lnc-HILPDA facilitated CI-AKI development by upregulating XPO1 through eIF4B. Our findings provide a theoretical foundation for the development of innovative CI-AKI treatment approaches.
Materials and methods
Animal experiments
A total of 32 male SD rats (8 weeks old, 250–300 g) were purchased from Charies River (Beijing, China). After one week of acclimatization, rats were randomly assigned into four groups (n = 8): Control group, CI-AKI group, CI-AKI + sh-NC group and CI-AKI + sh-Lnc-HILPDA group. The CI-AKI rat model was established as previously reported.17 In brief, rats were injected with indomethacin (10 mg/kg, Sigma-Aldrich, MO, USA) through the tail vein, followed by N-nitro-L-arginine methyl ester (10 mg/kg, Sigma-Aldrich) and iopromide (2.9 g/kg, Bayer, Leverkusen, Germany) at 15 and 30 min, respectively. A 50% increase in Scr relative to the baseline is a hallmark of successful construction of the CI-AKI model.9 Meanwhile, rats in the CI-AKI + sh-NC and CI-AKI + sh-Lnc-HILPDA groups received tail vein injections with sh-NC and sh-Lnc-HILPDA lentivirus (2 × 109 TU/mL), respectively. The lentiviruses were purchased from GenePharma (Shanghai, China). Rats were sacrificed 48 h later, and kidney tissue and blood samples were collected for further analysis. All experimental procedures were approved by Xiangya Hospital, Central South University.
Hematoxylin-eosin (HE) staining
The paraffin sections of kidney tissue (4 μm in thickness) were prepared. The sections were dehydrated using different alcohol concentration, stained with hematoxylin (Sigma-Aldrich) for 15 min, differentiated, washed, stained with 0.5% eosin (Sigma-Aldrich) for 3 min, and then soaked in ethanol for 5 min. Morphological changes in the kidney were evaluated using an Olympus microscope (Tokyo, Japan) at ×200 magnification. The degree of foaming and the detachment of renal tubular cells were scored on a scale of 0–4 as follows: no injury (0); mild: 0%–25% (1); moderate: 25%–50% (2); severe: 50%–75% (3); and very severe: 75%–100% (4) as previously reported.18
Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining
The kidney tissues were fixed, permeabilized, and washed with PBS. Then, the sections were incubated with TUNEL solution (Beyotime, Shanghai, China) for 1 h. After the reaction was stopped, the sodium citrate buffer was added. The nuclei were then colored with DAPI (Beyotime). The sections were examined under an Olympus microscope after being counterstained with DAB (Sigma-Aldrich).
Enzyme linked immunosorbent assay (ELISA)
The levels of creatinine (Scr), cystatin C (Cys C) and blood urea nitrogen (BUN) in serum were measured by the ELISA kits purchased from Biolead (Beijing, China). All operations were carried out exactly as specified in the instructions.
Measurement of ROS, MDA and SOD
The levels of reactive oxygen species (ROS) and malondialdehyde (MDA), as well as the activity of superoxide dismutase (SOD) were detected by the kits obtained from Jiancheng (Jiangsu, China). All operations were carried out exactly as specified in the instructions.
Cell culture and treatment
Human renal tubular epithelial cells (HK-2) were purchased from ATCC (VA, USA). Cells were cultured in DMEM (Gibco, MD, USA) with 10% FBS (Gibco) at 37 °C with 5% CO2. To establish the CI-AKI cell model, HK-2 cells were incubated with different concentrations of iopromide (50, 150, 300 mgI/mL, Bayer) for 1 h.
Cell counting kit-8 (CCK-8) assay
HK-2 cells were incubated using CCK-8 solution (10 μL, Sangon) at 37 °C for 3 h. The absorbance at 450 nm was measured using a microplate spectrophotometer (Bioteke, Beijing, China).
Measurement of ROS
HK-2 cells were planted into 12-well plates at a density of 5 × 105 cells/per well. After the indicated treatments and being washed twice with PBS, cells were incubated with 10 μM DCFH-DA solution (Beyotime) for 15 min. The nuclei were then stained with DAPI (Beyotime). The photographs were taken using an Olympus fluorescence microscope.
Cell apoptosis assay
HK-2 cells were re-suspended in 500 μL of 1X Annexin-binding buffer (Beyotime) and incubated with 10 μL Annexin V-FITC and 5 μL PI stain for 10 min. Flow cytometry (BD, NJ, USA) was used to evaluate the samples immediately.
Nucleo-cytoplasmic separation
Total cellular fractions were separated into cytoplasmic and nuclear fractions using a PARIS kit (Thermo Fisher Scientific, MA, USA) according to the manufacturer's instructions. Lnc-HILPDA expression in the nucleus and cytoplasm was analyzed by qRT-PCR, and normalized using U6 and GAPDH, respectively.
Fluorescence In situ hybridization (FISH)
FAM-labeled probes for lnc-HILPDA were purchased from RioBio (Guangzhou, China). Cells were fixed before being treated with the probes overnight at 37 °C. DAPI was used to label the nuclei, which were then imaged using confocal microscopy (Carl Zeiss, Germany).
Coimmunoprecipitation (Co-IP)
HK-2 cells were lysed in lysis solution including protease inhibitors. The cell lysate was incubated with IgG (Abcam, Cambridge, UK, 1:50, ab172730) and eIF4B (Abcam, 1:100, ab245618) antibodies overnight at 4 °C. The lysate was then incubated with Protein G agarose (Millipore, MA, USA) for 3 h, and the bound proteins were purified and analyzed by Western blot.
RNA binding protein immunoprecipitation (RIP) assay
The MagnaRIP RIP Kit (Millipore) was used for the RIP experiment. Total mRNA isolated from cells was incubated with eIF4B antibody (Abcam, 1:30, ab245618) or IgG antibody (Abcam, 1:100, ab109489) and protein A/G magnetic beads for 1 h. RNA was isolated and analyzed using qRT-PCR.
Quantitative real-time polymerase chain reaction (qRT-PCR)
The total RNA was extracted with TRIzol (ThermoFisher Scientific), and cDNA was synthetized using the reverse transcriptase kit (Toyobo, Tokyo, Japan). qRT-PCR was performed using SYBR (Thermo Fisher Scientific). GAPDH was utilized as the control gene. The data were analyzed using the 2−ΔΔCT method. The primers used in the study were listed as follows (5′-3′):
Lnc-HILPDA (F): TTATGGCTATGAGATAGGTTGATC, Lnc-HILPDA (R): GACAGATGTTTAGGAAGTAGGGTT;
XPO1 (F): AGCAAAGAATGGCTCAAGAAGT, XPO1 (R): TATTCCTTCGCACTGGTTCCT;
GAPDH (F): CCAGGTGGTCTCCTCTGA, GAPDH (R): GCTGTAGCCAAATCGTTGT.
Western blot
RIPA (Beyotime) was used to isolate the proteins, and the protein concentration was quantified by a BCA kit (Beyotime). The total protein (20 μg) was subsequently separated using 10% SDS-PAGE and transferred to a Millipore PVDF membrane. The membranes were then blocked and incubated with antibodies against Bax (Abcam, 1:1000, ab32503), Bcl-2 (Abcam, 1:1000, ab196495), Cleaved caspase 3 (Cell Signaling Technology, MA, USA, 1:1000, #9661), Caspase 3 (Abcam, 1:5000, ab32351), XPO1 (Abcam, 1:1000, ab191081), P65 (Cell Signaling Technology, 1:1000, #8242), p-P65 (Abcam, 1:1000, ab76302) and GAPDH (Abcam, 1:5000, ab8245) overnight, then hybridized with the secondary antibody (Abcam, 1:5000, ab7090) for 60 min. The blots were visualized by the GEL imaging system (Bio-Rad, CA, USA) and analyzed using ImageJ software (National Institutes of Health, MA, USA).
Statistical analysis
All our data were obtained from three independent experiments. Statistical data was analyzed by SPSS 20.0 (IBM, New York, USA) was used to examine the statistical data and expressed as Means ± SD. Student's t-tests were used to examine the differences between the two groups. To analyze the differences across several groups, one-way ANOVA was used, followed by Tukey’s post hoc test. The P values less than 0.05 were regarded as significant.
Results
Lnc-HILPDA was significantly upregulated in CI-AKI rat model
As previously reported, lnc-HILPDA was overexpressed in both CI-AKI patients and rats.9 To investigate the role of lnc-HILPDA in CI-AKI, the rat model of CI-AKI was constructed. The results revealed that plasma AKI biomarkers (Scr, Cys C and BUN) in the CI-AKI rat group were higher than in the control group (Fig. 1A). As reported, a 50% increase in Scr compared to the baseline is a hallmark of successful construction of the CI-AKI model.9 Therefore, the increased Scr level in this study indicated the successful establishment of the CI-AKI rat model. HE staining demonstrated the typical shape of the renal tubular lumen, with ordered organization of renal tubular epithelial cells and minimal infiltration of red blood cells were observed in the control group, while t The CI-AKI group showed typical pathological symptoms, including decrease in renal tubular lumen, changes in cell morphology, significant increase in inflammatory cell infiltration and increase in histological scores (Fig. 1B). In addition, the number of TUNEL-positive cells in CI-AKI rat kidney tissue was significantly higher than in the control group (Fig. 1C). Meanwhile, as compared to the control group, rats in the CI-AKI group had higher ROS and MDA levels and lower SOD activity in kidney tissue (Fig. 1D). Moreover, Bax level and the ratio of Cleaved caspase 3/total caspase 3 in CI-AKI rat kidney were higher than the control group, while Bcl-2 level was lower (Fig. 1E). Finally, lnc-HILPDA was significantly upregulated in kidney tissues of CI-AKI rats compared with the control group (Fig. 1F). Collectively, lnc-HILPDA might be related to CI-AKI progression.
Fig. 1.
Lnc-HILPDA was significantly upregulated in CI-AKI rat model. CI-AKI rat model was induced by administration of iopromide after the inhibition of prostaglandin and nitric oxide synthesis. A) The levels of Scr, Cys C and BUN in plasma were measured by ELISA. B) HE staining was used to assess pathological changes in kidney tissue. C) TUNEL labeling was used to detect cell apoptosis in kidney tissue. D) ROS and MDA levels, and SOD activity in kidney tissue were measured by the corresponding kits. E) Bax, Bcl-2, total caspase 3 and cleaved caspase 3 protein levels were assessed by western blot. F) Lnc-HILPDA expression in kidney tissue was examined by qRT-PCR. The measurement data were presented as mean ± SD. n = 8. *P < 0.05, **P < 0.01, ***P < 0.001.
Lnc-HILPDA knockdown alleviated contrast-induced oxidative stress and cell apoptosis in HK-2 cells
The involvement of lnc-HILPDA in CI-AKI was subsequently studied. HK-2 cells were treated with iopromide to construct the CI-AKI cell model. Iopromide concentration-dependently decreased HK-2 cell viability (Fig. 2A), and viability was significantly reduced at 150 mgI/mL. Moreover, lnc-HILPDA expression gradually increased with the increase of iopromide concentration, peaking at 150 mgI/mL (Fig. 2B). Therefore, 150 mgI/mL iopromide was used for following tests. To investigate the role of lnc-HILPDA in CI-AKI progression, lnc-HILPDA knockdown was induced in iopromide-treated HK-2 cells by transfecting sh-lnc-HILPDA into cells. Lnc-HILPDA in HK-2 cells was markedly upregulated after iopromide stimulation, which was abolished by sh-lnc-HILPDA transfection (Fig. 2B). In addition, lnc-HILPDA knockdown prevented iopromide-induced decrease in HK-2 cell viability (Fig. 2C). Furthermore, iopromide treatment increased ROS level in HK-2 cells, while this change was eliminated by lnc-HILPDA knockdown (Fig. 2D). Meanwhile, iopromide reduced SOD activity and elevated MDA level in HK-2 cells, whereas lnc-HILPDA silencing eliminated these changes (Fig. 2E). Finally, iopromide treatment promoted HK-2 cell apoptosis, which was reversed by lnc-HILPDA downregulation (Fig. 3A). Consistently, iopromide treatment increased the protein levels of Bax, XPO1, nuclear factor kappa-B (NF-κB) pathway-related protein (p-P65), and the ratio of Cleaved caspase 3/total caspase 3, while decreasing Bcl-2 level in HK-2 cells, whereas lnc-HILPDA silencing prevented these changes (Fig. 3B). All these results suggested that lnc-HILPDA downregulation reduced contrast-induced oxidative stress and cell apoptosis in HK-2 cells.
Fig. 2.
Lnc-HILPDA knockdown alleviated contrast-induced oxidative stress in HK-2 cells. HK-2 cells were incubated with iopromide (50, 150, 300 mgI/mL) for 1 h. A) CCK-8 test was used to assess cell viability, and (B) qRT-PCR was used to determine lnc-HILPDA expression in cells. HK-2 cells were treated with 150 mgI/mL iopromide and subsequently transfected with sh-NC or sh-lnc-HILPDA. B) Lnc-HILPDA expression was detected by qRT-PCR. (C) CCK-8 test was used to assess cell viability. D) The DCFH-DA probe was used to measure ROS level. E) MDA level and SOD activity in cells were measured by the corresponding kits. The measurement data were presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
Fig. 3.
Lnc-HILPDA knockdown alleviated contrast-induced HK-2 cell apoptosis. Iopromide-treated HK-2 cells were subsequently transfected with sh-NC or sh-lnc-HILPDA. A) Flow cytometry was used to determine cell apoptosis. B) Bax, Bcl-2, total caspase 3, cleaved caspase 3, XPO1, p-P65 and P65 levels were measured using western blot. The measurement data were presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
Lnc-HILPDA activated NF-κB pathway in HK-2 cells by increasing XPO1 expression through eIF4B
The mechanism of lnc-HILPDA in CI-AKI was then studied. Initially, the FISH assay result revealed that lnc-HILPDA was primarily localized in the cytoplasm (Fig. 4A), which was further confirmed by the nucleo-cytoplasmic separation experiment (Fig. 4B). It has been discovered that lncRNAs can regulate gene expression via interacting with RBPs.19 eIF4B is a RBP, regulating the progression of various diseases.20 Using the RBPDB database, it was predicted that lnc-HILPDA may interact with eIF4B. RIP assay further revealed that lnc-HILPDA interacted with eIF4B, and this interaction was further enhanced by iopromide treatment (Fig. 4C). XPO1 is a nuclear output protein that regulates the transport of over 200 proteins and is significantly upregulated in sepsis-induced AKI.14 It was predicted that eIF4B potentially interacted with XPO1 protein by the Hitpredict database. The interaction between eIF4B and XPO1 was identified in HK-2 cells by Co-IP. Co-IP results showed that eIF4B antibody could pull down eIF4B and XPO1 proteins, while IgG couldn’t pull down proteins, indicating that eIF4B interacted with XPO1 (Fig. 4D). It was also observed that the interaction between eIF4B and XPO1 was weakened by lnc-HILPDA silencing (Fig. 4D). Finally, lnc-HILPDA knockdown reduced XPO1 and p-P65 protein levels in HK-2 cells, while this effect of sh-lnc-HILPDA was reserved by eIF4B overexpression (Fig. 4E). Meanwhile, it was observed that lnc-HILPDA knockdown slightly reduced eIF4B protein level in HK-2 cells, but there was no statistical difference, while sh-lnc-HILPDA and oe-eIF4B co-transfection significantly elevated eIF4B protein level in HK-2 cells (Fig. 4E). It also turned out that eIF4B was slightly upregulated in Iopromide-treated HK-2 cells, but there was no statistically significant difference (Fig. S1A). Taken together, lnc-HILPDA activated NF-κB pathway during the development of CI-AKI by upregulating XPO1 through interaction with eIF4B.
Fig. 4.
Lnc-HILPDA activated NF-κB pathway in HK-2 cells by increasing XPO1 expression through eIF4B. A) The subcellular localization of lnc-HILPDA in HK-2 cells was analyzed by FISH assay. B) Lnc-HILPDA in the cytoplasm and nucleus was measured by qRT-PCR. C) The interaction between lnc-HILPDA and eIF4B was analyzed by RIP assay. D) The interaction between eIF4B and endogenous XPO1 was verified by Co-IP assay. As a positive control, the whole lysates, marked as input, were blotted with anti-eIF4B antibody. The homogenates immunoprecipitated with IgG alone were used as a negative control. E) After lnc-HILPDA silencing and XPO1 upregulation were induced in HK-2 cells, western bolt was used to measure XPO1, p-P65, P65, and eIF4B levels. The measurement data were presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
Lnc-HILPDA promoted contrast-induced oxidative stress and cell apoptosis in HK-2 cells through XPO1
To investigate the function of XPO1 in lnc-HILPDA-mediated biological effects during CI-AKI development, both lnc-HILPDA silencing and XPO1 overexpression were induced in iopromide-treated HK-2 cells. As shown in Fig. 5A and B, lnc-HILPDA knockdown reduced XPO1 expression level in iopromide-treated HK-2 cells, but XOP1 overexpression abolished this effect. Lnc-HILPDA knockdown increased iopromide-treated HK-2 cell viability, while XOP1 upregulation reversed this effect (Fig. 5C). Additionally, lnc-HILPDA knockdown reduced ROS level in iopromide-treated HK-2 cells, which was eliminated by XPO1 upregulation (Fig. 5D). It was also observed that lnc-HILPDA silencing elevated SOD activity while reducing MDA level in iopromide-treated HK-2 cells, which were abrogated after XPO1 upregulation (Fig. 5E). Moreover, XPO1 overexpression increased iopromide-treated HK-2 cell apoptosis, elevated the protein levels of Bax and p-P65 and the ratio of Cleaved caspase 3/total caspase 3 in cells while reducing Bcl-2 level, which weakened the effects of lnc-HILPDA knockdown (Fig. 6A and B). In conclusion, lnc-HILPDA facilitated iopromide-trigged oxidative stress and apoptosis in HK-2 cells by increasing XPO1 expression.
Fig. 5.
Lnc-HILPDA promoted contrast-induced oxidative stress in HK-2 cells through XPO1. Both lnc-HILPDA silencing and XPO1 upregulation were induced in iopromide-treated HK-2 cells. A and B) XPO1 expression level in cells were assessed using qRT-PCR and western blot. C) CCK-8 was employed to analyze cell viability. D) The DCFH-DA probe was used to measure ROS level. E) MDA level and SOD activity in cells were measured by the kits. The measurement data were presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
Fig. 6.
Lnc-HILPDA promoted contrast-induced HK-2 cell apoptosis through XPO1. Both lnc-HILPDA silencing and XPO1 upregulation were induced in iopromide-treated HK-2 cells. A) Flow cytometry was used to analyze cell apoptosis. B) Western blot was adopted to measure Bax, Bcl-2, total caspase 3, cleaved caspase 3, p-P65 and P65 levels. The measurement data were presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
Lnc-HILPDA knockdown alleviated contrast-induced AKI in rats
To study the role of lnc-HILPDA in regulating CI-AKI development in vivo, CI-AKI rats were injected with the lentivirus of sh-Lnc-HILPDA. As shown in Fig. 7A, lnc-HILPDA knockdown reduced plasma Scr, Cys C and BUN levels in CI-AKI rats. HE staining also showed that lnc-HILPDA knockdown improved the inflammatory infiltration and injury in kidney tissue of CI-AKI rats and reduced the histological scores (Fig. 7B). The number of TUNEL-positive cells in CI-AKI rat kidney tissue was also reduced by lnc-HILPDA silencing (Fig. 7C). As expected, sh-lnc-HILPDA injection reduced lnc-HILPDA expression in CI-AKI rat kidney tissue (Fig. 7D). In addition, lnc-HILPDA knockdown ameliorated the contrast-induced rise in ROS and MDA levels in kidney tissue while also preventing the contrast-trigged decrease in SOD activity (Fig. 8A). Moreover, lnc-HILPDA silencing reduced the protein levels of XPO1, Bax, p-P65 and the ratio of Cleaved caspase 3/total caspase 3 while increasing Bcl-2 level in kidney tissue of CI-AKI rats (Fig. 8B). Finally, it was also observed that eIF4B was slightly upregulated in kidney tissue of CI-AKI rats, but there was no statistically significant difference (Fig. S1B). To sum up, lnc-HILPDA knockdown alleviated contrast-trigged oxidative stress and apoptosis in rat kidney tissue.
Fig. 7.
Lnc-HILPDA knockdown alleviated contrast-induced AKI in rats. CI-AKI rats were injected with the lentivirus of sh-Lnc-HILPDA or sh-NC. A) Plasma Scr, Cys C and BUN levels were examined using ELISA. B) HE staining was adopted to assess pathological changes in kidney tissue. C) TUNEL staining was adopted to detect cell apoptosis in kidney tissue. D) Lnc-HILPDA expression in kidney tissue was determined using qRT-PCR. The measurement data were presented as mean ± SD. n = 8. *P < 0.05, **P < 0.01, ***P < 0.001.
Fig. 8.
Lnc-HILPDA knockdown alleviated contrast-induced AKI in rats. CI-AKI rats were injected with the lentivirus of sh-Lnc-HILPDA or sh-NC. A) ROS and MDA levels and SOD activity in kidney tissue were measured by the corresponding kits. B) XPO1, Bax, Bcl-2, total caspase 3, cleaved caspase 3, p-P65 and P65 protein levels in kidney tissue were analyzed using western blot. The measurement data were presented as mean ± SD. n = 8. *P < 0.05, **P < 0.01, ***P < 0.001.
Discussion
CI-AKI has become a common iatrogenic AKI due to the increased use of contrast agents in clinical practice.21 In addition to conventional hydration method that has been successfully utilized to avoid CI-AKI, effective treatments for CI-AKI are still very scarce.18 Therefore, there is an urgent need to develop new effective treatment strategies for CI-AKI. Although the pathological mechanism of CI-AKI remains unknown, studies have shown that contrast can accelerate the occurrence and development of CI-AKI by inducing oxidative stress and apoptosis in renal tubular epithelial cells. The current study finds that lnc-HILPDA promotes oxidative stress and cell apoptosis in renal tubular epithelial cells and further accelerate CI-AKI progression by increasing XPO1 expression through interacting with eIF4B.
The key roles of lncRNAs in AKI induced by various etiologies have been widely studied. As proof, lncRNA NEAT1 was overexpressed in hypoxia-treated tubular epithelial cells, and its upregulation promoted the development of human AKI by inducing tubular epithelial cell apoptosis.22 It was also previously reported that LNC_000343 potentially regulated oxidative stress and inflammation by sponging miR-1956-5p in CI-AKI rats.23 In a previous study, high-throughput RNA sequencing results displayed that lnc-HILPDA expression was higher in kidney tissue of CI-AKI rats than in controls.9 Consistently, our results showed that lnc-HILPDA was markedly upregulated in CI-AKI. In addition, our findings showed that lnc-HILPDA knockdown reduced contrast-trigged oxidative stress and apoptosis in HK-2 cells, which was reported for the first time. Meanwhile, our animal experiment results further confirmed that lnc-HILPDA knockdown improved the injury of contrast-induced CI-AKI rats. All these results suggested that lnc-HILPDA knockdown alleviated CI-AKI in vitro and in vivo by reducing oxidative stress and apoptosis.
Accumulated evidence has demonstrated that lncRNA-RBP interactions are key aspects of various cellular processes.24 As proof, lncRNA GMAN facilitated the development of hepatocellular carcinoma through interacting with eIF4B.25 eIF4B is closely related to cell apoptosis, specifically eIF4B silencing inhibits the expression of anti-apoptotic protein in mammalian cells.26 Notably, through RNA sequencing, it was revealed that eIF4B was a key pathophysiologic factor in nephropathy development.11 Nevertheless, the role of eIF4B in CI-AKI remains unclear. Moreover, our findings showed that eIF4B was slightly upregulated in iopromide-treated HK-2 cells and kidney tissue of CI-AKI rats, but there was no statistically significant difference. A previous study showed that the expression of eIF4B, a marker of mTOR pathway, was significantly upregulated in diabetes nephropathy mice.11 Meanwhile, it was previously described that the phosphorylation level of eIF4B in the kidney tissue of HIV transgenic mice significantly increased, while the phosphorylation level of eIF4B significantly decreased after the addition of rapamycin.12 In addition, the phosphorylation level of eIF4B in renal tubular epithelial cells was significantly elevated after HIV treatment, indicating the activation of the mTOR pathway.27 According to these literatures, eIF4B may play an important role in kidney injury or other diseases through being phosphorylated, when it acts as a marker of the downstream mTOR pathway. As evidence, combination therapy with inhibitors targeting the JAK/STAT5/Pim and PI3K/AKT/mTOR signaling pathways can significantly promote apoptosis of acute leukemia cells by reducing eIF4B phosphorylation.28 Therefore, there was no significant change in eIF4B expression in CI-AKI, which may be due to its effect on kidney injury through phosphorylation level. However, the specific content remains to be further explored. In the current research, contrast treatment enhanced the interaction between lnc-HILPDA and eIF4B in HK-2 cells.
It was reported that eIF4B could promote 40S ribosomal subunit recruitment to mRNA with relatively structured 5′UTRs to facilitate translation initiation.29 Our results showed that eIF4B interacted with XPO1 in HK-2 cells, while this interaction was weakened by lnc-HILPDA knockdown. LncRNA can promote the translation of downstream protein through interacting with RBP but does not affect RBP expression. As evidence, lncRNA SNHG16 overexpression promoted RhoU translation by interacting with RBP (EIF4A3) but didn’t affect EIF4A3 expression during the development of oesophageal squamous cell carcinoma.30 In addition, lncRNA H19 enhanced CDK4 translation by interacting with RBP (ILF3) but had no significant effect on ILF3 expression.31 Herein, our results showed that lnc-HILPDA promoted XPO1 protein translation in HK-2 cells by interacting with RBP (eIF4B). It was also turned out that lnc-HILPDA knockdown reduced XPO1 protein level in HK-2 cells, while this effect of sh-lnc-HILPDA was reserved by eIF4B overexpression. This suggests that lnc-HILPDA can promote XPO1 protein translation through binding to eIF4B. Further investigation is needed to determine whether Lnc-HILPDA affects the mRNA stability of XPO1. It was previously described that lncRNA RP11-867G2.8 could increase FUL4 mRNA stability and promote its translation by binding to FUT4 mRNA.32 Meanwhile, lncRNA RP11-867G2.8 could increase FTU4 translation by binding to eIF4B and PABPC1.32 It was suggested that lncRNA could regulate the stability of downstream target protein mRNA, and lncRNA also promoted target protein translation through eIF4B. Further investigation is needed to determine whether lnc-HILPDA affects the mRNA stability of XPO1. XPO1, as a nuclear transporter protein, is a key player in several kidney diseases. For instance, XPO1 inhibition reduced renal tubular epithelial cell growth in autosomal-dominant polycystic kidney disease.33 More importantly, XPO1 silencing ameliorated sepsis-induced AKI.14 Consistently, our results showed that XPO1 expression was markedly increased in kidney tissues of CI-AKI rats, and its overexpression promoted contrast-trigged oxidative stress and apoptosis in HK-2 cells. In summary, lnc-HILPDA promoted oxidative stress and cell apoptosis in renal tubular epithelial cells during CI-AKI by upregulated XPO1 via interacting with eIF4B. Moreover, NF-κB pathway activation induces apoptosis in CI-AKI rats by activating apoptotic proteins.34 Meanwhile, NF-κB pathway inactivation reduced oxidative stress in podocytes during the progression of nephrotoxic drug-induced AKI.35 Herein, NF-κB pathway was discovered to be the downstream route of the lnc-HILPDA/eIF4B/XPO1 axis in promoting oxidative stress and cell apoptosis during CI-AKI development. If future conditions permit, further clinical validation of our conclusion will be conducted. In addition, further study is needed to investigate the role of eIF4B in CI-AKI.
The experimental evidence supported the hypothesis that lnc-HILPDA promoted oxidative stress and cell apoptosis of CI-AKI via upregulating XPO1 through eIF4B to activate NF-κB pathway. Our research may provide novel therapeutic targets for CI-AKI.
Supplementary Material
Contributor Information
Haiyan Wei, Second Department of Coronary Heart Disease, The First People’s Hospital of Kashgar Prefecture, No. 120, Yingbin Avenue, Kashgar, Xinjiang Uyghur Autonomous Region 844000, P.R. China.
Tuersun Tilakezi, Second Department of Coronary Heart Disease, The First People’s Hospital of Kashgar Prefecture, No. 120, Yingbin Avenue, Kashgar, Xinjiang Uyghur Autonomous Region 844000, P.R. China.
Wei Feng, Second Department of Coronary Heart Disease, The First People’s Hospital of Kashgar Prefecture, No. 120, Yingbin Avenue, Kashgar, Xinjiang Uyghur Autonomous Region 844000, P.R. China.
Heyin Yang, Second Department of Coronary Heart Disease, The First People’s Hospital of Kashgar Prefecture, No. 120, Yingbin Avenue, Kashgar, Xinjiang Uyghur Autonomous Region 844000, P.R. China.
Shujun Yang, Department of Geriatric Medicine, Center of Coronary Circulation, Xiangya Hospital, Central South University, No. 87, Xiangya Road, Changsha, Hunan 410008, P.R. China; National Clinical Research Center for Geriatric Disorders, Xiangya Hospital, Central South University, No. 87, Xiangya Road, Changsha, Hunan 410008, P.R. China.
Author contributions
Haiyan Wei, Heyin Yang and Shujun Yang designed this study. Haiyan Wei, Tuersun Tilakezi and Wei Feng collected the materials and performed the experiments. Haiyan Wei analysed the data and wrote the manuscript. Heyin Yang and Shujun Yang revised the manuscript. All authors read and approved the final version of the manuscript.
Funding
This work was supported by Xinjiang Uygur Autonomous Region Natural Science Foundation (Prefecture Foundation, 2021D01F15 and 2022D01F12) and Hunan Province Natural Science Foundation (2023JJ41010).
Conflict of interest statement. All authors agree with the presented findings, have contributed to the work, and declare no conflict of interest.
Ethics approval and consent to participate
All experimental procedures were approved by Xiangya Hospital, Central South University.
Data availability
All data generated or analysed during this study are included in this published article.
References
- 1. Yoshida T. Protect the kidneys against contrast medium. Ren Fail. 2022:44(1):1633–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Lin Q, Li S, Jiang N, Jin H, Shao X, Zhu X, Wu J, Zhang M, Zhang Z, Shen J, et al. Inhibiting NLRP3 inflammasome attenuates apoptosis in contrast-induced acute kidney injury through the upregulation of HIF1A and BNIP3-mediated mitophagy. Autophagy. 2021:17(10):2975–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Li Y, Ren K. The mechanism of contrast-induced acute kidney injury and its association with diabetes mellitus. Contrast Media Mol Imag. 2020:2020:3295176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Cantais A, Hammouda Z, Mory O, Patural H, Stephan JL, Gulyaeva L, Darmon M. Incidence of contrast-induced acute kidney injury in a pediatric setting: a cohort study. Pediatr Nephrol. 2016:31(8):1355–62. [DOI] [PubMed] [Google Scholar]
- 5. Weisbord SD, Gallagher M, Jneid H, Garcia S, Cass A, Thwin SS, Conner TA, Chertow GM, Bhatt DL, Shunk K, et al. Outcomes after angiography with sodium bicarbonate and Acetylcysteine. N Engl J Med. 2018:378(7):603–14. [DOI] [PubMed] [Google Scholar]
- 6. Zhang P, Wu S, He Y, Li X, Zhu Y, Lin X, Chen L, Zhao Y, Niu L, Zhang S, et al. LncRNA-mediated Adipogenesis in different adipocytes. Int J Mol Sci. 2022:23(13):7488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Bao W, Xiao Z, Wang Z, Liu D, Tan P, Huang M. Comprehensive analysis of the long non-coding RNA expression profile and functional roles in a contrast-induced acute kidney injury rat model. Exp Ther Med. 2021:22(1):739. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Luo M, Liu Z, Hu Z, He Q. Quercetin improves contrast-induced acute kidney injury through the HIF-1α/lncRNA NEAT1/HMGB1 pathway. Pharm Biol. 2022:60(1):889–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Chen G, Liu B, Chen S, Li H, Liu J, Mai Z, Chen E, Zhou C, Sun G, Guo Z, et al. Novel biomarkers for post-contrast acute kidney injury identified from long non-coding RNA expression profiles. Int J Biol Sci. 2021:17(3):882–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Yao ZT, Yang YM, Sun MM, He Y, Liao L, Chen KS, Li B. New insights into the interplay between long non-coding RNAs and RNA-binding proteins in cancer. Cancer Commun (Lond). 2022:42(2):117–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Lu X, Li L, Suo L, Huang P, Wang H, Han S, Cao M. Single-cell RNA sequencing profiles identify important pathophysiologic factors in the progression of diabetic nephropathy. Front Cell Dev Biol. 2022:10:798316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kumar D, Konkimalla S, Yadav A, Sataranatarajan K, Kasinath BS, Chander PN, Singhal PC. HIV-associated nephropathy: role of mammalian target of rapamycin pathway. Am J Pathol. 2010:177(2):813–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Azizian NG, Li Y. XPO1-dependent nuclear export as a target for cancer therapy. J Hematol Oncol. 2020:13(1):61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Jin L, Liao W, Zhou X, Wang Y, Qian J. Hydrocortisone alleviates sepsis-induced acute kidney injury through HSF-1-mediated transcriptional suppression of XPO1. Tissue Cell. 2022:79:101915. [DOI] [PubMed] [Google Scholar]
- 15. Bettegazzi B, Sebastian Monasor L, Bellani S, Codazzi F, Restelli LM, Colombo AV, Deigendesch N, Frank S, Saito T, Saido TC, et al. Casein kinase 2 dependent phosphorylation of eIF4B regulates BACE1 expression in Alzheimer's disease. Cell Death Dis. 2021:12(8):769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Csibi A, Lee G, Yoon SO, Tong H, Ilter D, Elia I, Fendt SM, Roberts TM, Blenis J. The mTORC1/S6K1 pathway regulates glutamine metabolism through the eIF4B-dependent control of c-Myc translation. Curr Biol. 2014:24(19):2274–80. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 17. Tan X, Zheng X, Huang Z, Lin J, Xie C, Lin Y. Involvement of S100A8/A9-TLR4-NLRP3 Inflammasome pathway in contrast-induced acute kidney injury. Cell Physiol Biochem. 2017:43(1):209–22. [DOI] [PubMed] [Google Scholar]
- 18. Huang X, Guo X, Yan G, Zhang Y, Yao Y, Qiao Y, Wang D, Chen G, Zhang W, Tang C, et al. Dapagliflozin attenuates contrast-induced acute kidney injury by regulating the HIF-1α/HE4/NF-κB pathway. J Cardiovasc Pharmacol. 2022:79(6):904–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. He J, Ma X. Interaction between LncRNA and UPF1 in Tumors. Front Genet. 2021:12:624905. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Bresson S, Shchepachev V, Spanos C, Turowski TW, Rappsilber J, Tollervey D. Stress-induced translation inhibition through rapid displacement of scanning initiation factors. Mol Cell. 2020:80(3):470–84.e8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Gucun M, Kahyaoglu M, Celik M, Guner A, Akyuz O, Yilmaz Y. Predictive value of post-procedural hyponatremia on contrast-induced nephropathy in patients who underwent coronary angiography or percutaneous coronary intervention. Acta Cardiol. 2022:77(3):215–21. [DOI] [PubMed] [Google Scholar]
- 22. Ma T, Li H, Liu H, Peng Y, Lin T, Deng Z, Jia N, Chen Z, Wang P. Neat1 promotes acute kidney injury to chronic kidney disease by facilitating tubular epithelial cells apoptosis via sequestering miR-129-5p. Mol Ther. 2022:30(10):3313–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Cheng W, Li XW, Xiao YQ, Duan SB. Non-coding RNA-associated ceRNA networks in a new contrast-induced acute kidney injury rat model. Mol Ther Nucleic Acids. 2019:17:102–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Shaath H, Vishnubalaji R, Elango R, Kardousha A, Islam Z, Qureshi R, Alam T, Kolatkar PR, Alajez NM. Long non-coding RNA and RNA-binding protein interactions in cancer: experimental and machine learning approaches. Semin Cancer Biol. 2022:86(Pt 3):325–45. [DOI] [PubMed] [Google Scholar]
- 25. Xu J, Lu Y, Liu Q, Xia A, Zhao J, Xu X, Sun Q, Qi F, Sun B. Long noncoding RNA GMAN promotes hepatocellular carcinoma progression by interacting with eIF4B. Cancer Lett. 2020:473:1–12. [DOI] [PubMed] [Google Scholar]
- 26. Shahbazian D, Parsyan A, Petroulakis E, Topisirovic I, Martineau Y, Gibbs BF, Svitkin Y, Sonenberg N. Control of cell survival and proliferation by mammalian eukaryotic initiation factor 4B. Mol Cell Biol. 2010:30(6):1478–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Vesely Z, Müller A, Schmitz GG, Kaluza K, Jarsch M, Kessler C. RleAI: a novel class-IIS restriction endonuclease from rhizobium leguminosarum recognizing 5'-CCCACA(N)12-3′ 3′-GGGTGT(N)9-5′. Gene. 1990:95(1):129–31. [DOI] [PubMed] [Google Scholar]
- 28. Ma Y, Li T, Feng R, Guo G, Pan Q, Li J, Chen J. Sheng Wu Gong Cheng Xue Bao. 2020:36(11):2413–23. [DOI] [PubMed] [Google Scholar]
- 29. Mondal S, Rousseau S, Talenton V, Thiam CAB, Aznauryan M, Mackereth CD. Backbone resonance assignments of the C-terminal region of human translation initiation factor eIF4B. Biomol NMR Assign. 2023:17(2):199–203. [DOI] [PubMed] [Google Scholar]
- 30. Ren L, Fang X, Shrestha SM, Ji Q, Ye H, Liang Y, Liu Y, Feng Y, Dong J, Shi R. LncRNA SNHG16 promotes development of oesophageal squamous cell carcinoma by interacting with EIF4A3 and modulating RhoU mRNA stability. Cell Mol Biol Lett. 2022:27(1):89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Wang DD, Zhang LZ, Pang CJ, Ye JZ. Astragaloside IV promotes keratinocyte proliferation and migration through upregulating lncRNA H19 recruited ILF3 to enhance the stability of CDK4 mRNA. Kaohsiung J Med Sci. 2023:39(8):811–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Yang M, Liu SC, Hao DJ, Yan L, Liu ZK, Yin XH. RP11-867G2.8 promotes EMT and chordoma malignant phenotypes by enhancing FUT4 mRNA stability and translation. Am J Cancer Res. 2022:12(3):1264–81. [PMC free article] [PubMed] [Google Scholar]
- 33. Tan M, Wettersten HI, Chu K, Huso DL, Watnick T, Friedlander S, Landesman Y, Weiss RH. Novel inhibitors of nuclear transport cause cell cycle arrest and decrease cyst growth in ADPKD associated with decreased CDK4 levels. Am J Physiol Renal Physiol. 2014:307(11):F1179–F1186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Wan J, Wang Y, Cai G, Liang J, Yue C, Wang F, Song J, Wang J, Liu M, Luo J, et al. Elevated serum concentrations of HE4 as a novel biomarker of disease severity and renal fibrosis in kidney disease. Oncotarget. 2016:7(42):67748–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Zhu MM, Wang L, Yang D, Li C, Pang ST, Li XH, Li R, Yang B, Lian YP, Ma L, et al. Wedelolactone alleviates doxorubicin-induced inflammation and oxidative stress damage of podocytes by IκK/IκB/NF-κB pathway. Biomed Pharmacother. 2019:117:109088. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analysed during this study are included in this published article.