Abstract
Purpose
Low-grade gliomas (LGG) are common brain tumors with high mortality rates. Cancer cell invasion is a significant factor in tumor metastasis. Novel biomarkers are urgently needed to predict LGG prognosis effectively.
Methods
The data for LGG were obtained from the Bioinformatics database. A consensus clustering analysis was performed to identify molecular subtypes linked with invasion in LGG. Differential expression analysis was performed to identify differentially expressed genes (DEGs) between the identified clusters. Enrichment analyses were then conducted to explore the function for DEGs. Prognostic signatures were placed, and their predictive power was assessed. Furthermore, the invasion-related prognostic signature was validated using the CGGA dataset. Subsequently, clinical specimens were procured in order to validate the expression levels of the distinct genes examined in this research, and to further explore the impact of these genes on the glioma cell line LN229 and HS-683.
Results
Two invasion-related molecular subtypes of LGG were identified, and we sifted 163 DEGs between them. The enrichment analyses indicated that DEGs are mainly related to pattern specification process. Subsequently, 10 signature genes (IGF2BP2, SRY, CHI3L1, IGF2BP3, MEOX2, ABCC3, HOXC4, OTP, METTL7B, and EMILIN3) were sifted out to construct a risk model. Besides, the survival (OS) in the high-risk group was lower. The performance of the risk model was verified. Furthermore, a highly reliable nomogram was generated. Cellular experiments revealed the ability to promote cell viability, value-addedness, migratory ability, invasive ability, and colony-forming ability of the glioma cell line LN229 and HS-683. The qRT-PCR analysis of clinical glioma samples showed that these 10 genes were expressed at higher levels in high-grade gliomas than in low-grade gliomas, suggesting that these genes are associated with poor prognosis of gliomas.
Conclusion
Our study sifted out ten invasion-related biomarkers of LGG, providing a reference for treatments and prognostic prediction in LGG.
Keywords: LGG, prognosis, invasion, overall survival, EMILIN3
Introduction
Approximately 30% of primary CNS tumours and 80% of CNS malignancies are gliomas, the most common and malignant primary tumour in adults.1 These brain glial cell tumours have a high recurrence, short survival, and high fatality rate.2 Histopathological malignancy criteria classify gliomas as grades I–IV. Even after full surgical resection, radiation, and chemotherapy, high-grade gliomas (HGGs) survive 4–6 weeks and 12–18 months.3 About 22% of adult brain malignancies are slow-growing, infiltrative, intermittent low-grade gliomas (LGG).4 LGG has an overall survival (OS) of 85% at five years but a progression-free survival (PFS) of 40%, which is poor compared to HGGs.5,6 Additionally, 70% of LGG patients will advance within ten years, worsening their prognosis.7 Thus, new predictive biomarkers with specificity and utility are needed to improve LGG diagnosis, therapy, and prediction.
Aggressive LGG has poor prognosis and high treatment resistance.8 Primary invasion by glioma cells occurs in the perivascular space and brain parenchyma.9 Several mechanisms contribute to LGG tumour invasion and migration, including EMT, hypoxia, angiogenesis, and the TME.10 EMT transforms epithelial cells into mesenchymal cells with altered marker expression.11,12 HIF-1a-regulated hypoxia causes tumour adaptability, progression, and therapeutic resistance, increasing aggressiveness.13,14 Solid tumour growth requires angiogenesis, which LGG migration and invasion are connected to.15 Certain microRNAs affect LGG aggressiveness and angiogenesis during glioma formation.16 The M2 TAMs enhance glioma development and invasion.17,18 LGG migration and invasion are affected by cancer cell metabolism and adhesion molecules.19,20 The identification of invasion-related molecular characteristics and markers in LGG may improve prognosis, survival, and treatment.21,22
This paper used a consistent clustering approach in the TCGA-LGG transcriptome dataset based on the invasion-related gene set to divide the LGG samples into two subclasses. We obtained differentially expressed genes between the subclasses. Then, using one-way Cox regression analysis and the LASSO algorithm, we screened ten genes and calculated risk scores to divide the LGG samples into high and low-risk groups. Next, we explored the differences in infiltration levels of immune infiltrating cells, ESTIMATE scores, and immune checkpoints between risk groups, constructed ceRNA networks to explore their upstream and downstream regulatory mechanisms, and finally built a predictive model. PCR testing of clinical samples and EMILIN3 gene function experiments validated our analyses. In summary, these findings provide some theoretical basis for the prognostic assessment of LGG, the development of new therapeutic tools, and the further elucidation of molecular mechanisms associated with invasion. In addition, the genes that make up the risk score can be used as the basis and direction for further research. We analyse the flowchart and some of the results of the article analysis as a study process map (Figure 1).
Figure 1.
Study process map. This study involved the development of a low-grade glioma aggressiveness model by bioinformatics analysis of the TCGA and CGGA databases. After evaluating 10 markers associated with invasiveness in low-grade gliomas by various methods, we selected the EMILIN3 gene for further investigation. Our cell function experiments indicated that the EMILIN3 gene could potentially serve as a novel biological marker for invasiveness in low-grade gliomas.
Materials and Methods
Data Source
The training set included transcriptome and survival data from 529 LGG samples from the TCGA database (https://portal.gdc.cancer.gv/). Furthermore, an external validation set of 284 LGG samples was collected from the CGGA database (http://www.cgga.org.cn/). A total of 97 invasion-related genes (IRGs) were retrieved from the CancerSEA database (http://biocc.hrbmu.edu.cn/CancerSEA/) (Supplementary Table 1).23
Identification of DEGs Between Invasion-Related Molecular Subtypes
Based on 97 IRGs, we explored the potential invasion-related molecular subtypes of LGG samples in training set by consensus clustering using the “Consensus Cluster Plus” package (version 1.58.0).24 Then, the survival analysis of invasion-related molecular clusters was performed using the R package “survival” (version 3.3.1).25 The differentially expressed genes (DEGs) between the different invasion-related molecular subtypes of LGG were identified using the “DESeq2” R package (version 1.34.0)26 with adj. p<0.05 and |Log2FC|>2.5. The analysis findings were displayed using volcano plots and heatmaps created using the “ggplot2” (version 3.3.5) and “pheatmap” (version 1.0.12) R tools. The “clusterProfiler” (version 4.2.2) program was also used to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses for DEGs.27
Establishment and Validation of the Risk Model
Based on the DEGs, the OS-related DEGs were identified using univariate Cox analysis (HR≠1, P<0.01) and further filtered using the LASSO algorithm. This process yielded signature genes for constructing a risk model using the “glmnet” package (version 4.1.3). The risk model was generated using the formula:
, and LGG samples were divided into high- and low-risk groups based on the median risk score. Survival curves were plotted using the “survival” and “survminer” (version 0.4.9) packages. The model’s predictability was evaluated using ROC curves at 1-, 3-, and 5-year time points with the “survival ROC” R package (version 1.0.3). The validation set was used to verify the results. In addition, the risk scores were compared across various clinicopathological parameters, including Gender, Age, Grade, Isocitrate Dehydrogenase 1 (IDH1) gene mutation, and Histological Type.
Additionally, we analyzed the differences in the subgroup signature genes among various clinicopathological parameters. A p-value <0.05 indicated a significant difference.
Nomogram Establishment
Based on the above-mentioned 6 clinicopathological parameters, this study applied univariate/multivariate Cox analyses and Proportional Hazards (PH) assumption test to sift independent predictors for constructing a nomogram (1-, 3-, and 5-year) to predict the OS. Then, the performance of it was evaluated by the calibration plot.
Tumor Immune Microenvironment and Immune Checkpoint Analyses
We applied the “ESTIMATE” package to calculate the immune score, ESTIMATE score, tumor purity, and stromal score and compared them between risk groups. Then, the CIBERSORT algorithm28 was applied to detect immune cells in risk groups, and we compared the immune checkpoints` expression between the risk groups (p<0.05). Boxplot was generated to visualize the differences.
Regulation Network Construction
We predicted miRNAs and lncRNAs applying miRNet database29 (https://www.mirnet.ca). Firstly, in training set, differentially expressed miRNA (DEmiRNA, p<0.05 and |Log2FC|>1) and differentially expressed lncRNA (DElncRNA, adj. p<0.05 and |Log2FC|>0.5) between the different invasion-related molecular subtypes of LGG samples were screened using the “DEseq2”. Then, miRNet database was employed to predict the miRNA targeting signature genes, and predict the lncRNAs targeting DEmiRNA. Then, DEmiRNA intersected with these predicted miRNAs to procure the final miRNAs. DElncRNA intersected with these predicted lncRNAs to procure final lncRNAs. Importantly, the ceRNA network was constructed eventually.
RNA Extraction and Validate the Hub Genes
According to the World Health Organization’s classification of central nervous system tumours, gliomas may be classified as either low-grade (grades I–II) or high-grade. The isolation of total RNA was performed on a sample set consisting of 20 gliomas, including both 10 high-grade and10 low-grade tumours. The Steady Pure Rapid RNA Extraction Kit (D7168M, Beyotime, China) was used for the experiment. The AG11706 Reverse Transcription Kit, manufactured in China, was used to perform reverse transcription on the extracted RNA samples. The cDNA was amplified using a SYBR premixed Ex Taq kit (AG11718, AG, China). The amplification of cDNA used 3-phosphoglyceraldehyde dehydrogenase as an internal reference. The assessment of mRNA expression was performed using the 2 (-Delta CT) method. Table 1 lists all the primers in the study.
Table 1.
Primers for RT-PCR
| Gene | FORWARD Primer (5’-3’) | Reverse Primer (5’-3’) |
|---|---|---|
| IGF2BP2 | AGCTAAGCGGGCATCAGTTTG | CCGCAGCGGGAAATCAATCT |
| SRY | AGAGAATCCCAGAATGCGAAAC | CTTCCGACGAGGTCGATACTT |
| CHI3L1 | GTGAAGGCGTCTCAAACAGG | GAAGCGGTCAAGGGCATCT |
| IGF2BP3 | ACGAAATATCCCGCCTCATTTAC | GCAGTTTCCGAGTCAGTGTTCA |
| MEOX2 | GGCAAGAGGAAAAGCGACAG | ATCTCGTATCGCCTCAGTCTG |
| ABCC3 | CACCAACTCAGTCAAACGTGC | GCAAGACCATGAAAGCGACTC |
| HOXC4 | GAGCGCCAGTATAGCTGCAC | GCGACTGTGATTTCTCGGGG |
| OTP | GCACAGCTCAACGAGTTGGA | GTCAGCCCGATACGCAGTG |
| METTL7B | GCAACCGCAAGATGGAGAG | GATTTGGGTCTAGGCAGGTGA |
| EMILIN3 | GGGGATGAGCTTACGAGGC | ATGTCCAACCTCAGACAGCAT |
Reasons for Selecting the EMILIN3 Gene for Study
By searching the ten genes we pre-screened in PUBMED, we found that most of the genes are available in the literature in gliomas, but the literature of EMILIN3 gene in gliomas is less, so we chose this gene for the experimental validation.
In vitro Validation of the HUB Gene
Cell Culture and Cell Transfection
The LN229 and HS-683 human glioma cell line were purchased from iCell Bioscience Inc, and grown in DMEM media (Gibco, USA) with 10% foetal bovine serum (BI, USA) and 1g/mL penicillin/streptomycin (Hyclone, USA) at 37 degrees Celsius and 5% carbon dioxide. HASMC were transfected with a lentiviral expression vector containing the full-length EMILIN3 (Shanghai Genechem Co., Ltd, China) and the impact of transfection was measured using quantitative real-time polymerase chain reaction (qRT-PCR).
CCK-8 Detection of Cell Proliferation Capacity
Cells in the logarithmic growth phase were chosen and then digested using trypsin to create a cell suspension. The 1000 cells were put to 96-well plates, 10ul CCK-8 solution was added to each well at 0, 24, and 48h, incubated in the incubator for 0.5h, and enzyme markers were used to measure absorbance at 450 nm in each well.
Cell Viability Analysis
The cell viability of the LN-229 and HS-683 cell line in a high-fat media were evaluated using the Live/Dead Cell Kit manufactured by Biogradetech, a company based in China. Live cells were stained using calcein-AM, while dead cells were stained using propidium iodide. The fluorescence images were acquired using an OLYMPUS fluorescence microscope from Japan.
Cell Migration Capability in Wound-Healing Assay
Cells in the logarithmic growth phase that were in a healthy state were chosen. These cells were then treated with trypsin to break them down and transformed into a cell suspension. Following cell counting, the cells were introduced into sterile six-well plates with a density of 50,000 cells per well. Subsequently, the plates were placed in an incubator set at a temperature of 37°C and a CO2 concentration of 5% for overnight incubation. Once the cells were evenly distributed across the well plates, perpendicular scratches were created on the bottom of the well plates using a sterile gun tip. The process of cell migration was captured using microscopic imaging at both the initial time point (0 hours) and after a 24-hour period. The Wound Healing Assay is used to assess the migratory ability of cells, as has been shown in earlier literature.30
Transwell Assay for Cell Invasiveness
Transwell chambers were coated with 60 μL of 1 mg/mL matrigel (Corning, USA) to ensure equal distribution. Cells in the logarithmic growth phase that were in a healthy state were chosen. These cells were then digested using trypsin and transformed into a cell suspension using a medium that does not contain serum. After performing cell counting, a volume of 100 μL was extracted from a cell density of 5×10^5 cells/mL and evenly introduced into the lower chamber. Subsequently, the whole medium was added to the bottom chamber. The 24-well plate was then placed in an incubator set at a temperature of 37°C with a carbon dioxide concentration of 5% for a total incubation period of 72 hours. The cells were dyed with a 0.1% solution of crystal violet and examined using an inverted microscope.31
Clone Formation Experiments
The clonogenicity of LN-229 and HS-683 cells were tested using colony formation tests. 1500 uniformly dispersed cells were on six-well plates with medium changes for three days. A Biosharp (China) 4% paraformaldehyde solution fixed the cells after two weeks. The cells were stained with Solarbio (China) crystal violet. After three rounds of washing, the colonies were photographed.
Statistical Analysis
The biological experiments were analyzed using SPSS 25 software with at least three replications, and comparisons between the two groups were made using the independent samples t-test, with a p-value of less than 0.05 considered statistically significant.
Results
DEGs Identification Between Two Invasion-Related Molecular Subtypes
Two invasion-related molecular subtypes of LGG, cluster 1 and cluster 2, were identified at k = 2 (Figure 2A and B). A significant survival difference was detected between these two clusters, in which the patients in Cluster 1 had a poorer survival (p <0.0001, Figure 2C). Then, we screened out 163 DEGs (Cluster 1 VS Cluster 2) (Figure 2D and E) to conduct Enrichment analyses. GO analysis identified that DEGs were involved in the “pattern specification process”, “regionalization”, “ion channel complex”, “transmembrane transporter complex”, etc (Figure 3A and B). As shown in Figure 3C and D, KEGG results contained “transcriptional misregulation in cancer” and “nicotine addiction.”
Figure 2.
Cluster analysis based on invasion-related genes. (A and B) Cluster analysis revealed that the 529 LGG samples in the TCGA may be separated into two categories. (C) Survival analysis of clusters 1 and 2. (D) Volcanic map of differential genes between two clusters. (E) Heat map of differential genes.
Figure 3.
GO and KEGG. Significantly enriched GO terms and KEGG pathways of DEGs (adjusted P < 0.05). (A-B) Significantly enriched GO terms of DEGs. (C-D) Significantly enriched KEGG pathways of DEGs.
Risk Model Construction and Validation
Based on the 163 DEGs, Figure 4A indicated that 101 DEGs were significantly correlated with OS (p < 0.01). Then, we put the selected 101 genes into Lasso regression analysis, 10 signature genes were screened (Figure 4B and C). Risk scores were calculated as: Risk Score= 0.0885* expression (IGF2BP2) + 0.5225* expression (SRY)+0.0369* expression (CHI3L1) + 0.1577* expression (IGF2BP3) +0.0902* expression (MEOX2) +0.07772* expression (ABCC3) +0.0814*expression (HOXC4) + 0.0750* expression (OTP) + 0.1278*expression (METTL7B) + 0.0653* expression (EMILIN3). Based on the median risk score, samples were allocated into high-/low-risk groups. Their distribution and survival status implied that there were more dead with a risk score increase (Figure 4D and E), and we found that the high-risk group had a worse OS (p<0.0001) (Figure 4F). The AUC values determined by ROC curve analysis were 0.86, 0.86, and 0.78, suggesting a great outcome (Figure 4G). The samples in the validation set were examined using the same procedures as the training set, according to the formula developed by the TCGA cohort, and the findings were consistent (Figure 4H-K).
Figure 4.
Building and validating the invasion-associated signature. (A) Univariable Cox regression. (B-C) Lasso regression analysis. (D) Distribution of patients’ risk scores. (E) Survival times of patients plotted against their risk scores. (F) Overall survival (OS) differed significantly between the high-risk and low-risk groups. (G) The AUC curves of the signature for 1, 3, and 5 years in the TCGA cohort. (H-K) Validation of the invasion-related signature in the CGGA database.
Nomogram Construction
Univariate analysis based on the training set showed that risk score, age, grade, IDH1 mutation, and histological type with survival correlations (p<0.05) (Figure 5A). Then, we found that risk score, age, grade, and IDH1 mutation, were still remarkably related to prognosis by multivariate Cox analysis (Figure 5B, Supplementary Table 2). As a result, we create the nomogram by combining the risk score, age, grade, and IDH1 mutation (Figure 5C), which is validated by the calibration curve (Figure 5D).
Figure 5.
Evaluation of prognostic signature to predict the OS of LGG patients. (A) Univariate Cox regression. (B) Multivariate Cox regression. (C) In LGG patients, a nomogram was developed to predict 1-, 3-, and 5-year OS. (D) Calibration curves for the clinicopathologic invasion nomogram.
Risk Score in Different Clinicopathological Traits
In the present study, results of the Wilcoxon test demonstrated that risk scores were significantly different in age (<40, >40), grade (G2, G3), and IDH1 mutation (YES, NO) (Figure 6A-C). Kruskal–Wallis test demonstrated that risk scores are significantly different in histological types (anaplastic, astrocytoma, mixed glioma, NOS, oligodendroglioma, astrocytoma, anaplastic, and oligodendroglioma) (Figure 6D). Wilcoxon test demonstrated that the risk score was not significantly different between gender (female, male) (Figure 6E).
Figure 6.
Evaluation of the risk model and clinical indicators in LGG patients. Comparison of the risk score in TGCA-LGG patients with varying degrees of various clinical factors (A) Age (B) Grade (C) IDH1 mutation (D) histological type (E) Gender.
Furthermore, ABCC3, CHI3L1, IGF2BP3, MEOX2, METTL7B, and OTP showed significantly higher expression in the age > 40 subgroups (Figure 7A). Most of the significant genes exhibited significantly high expression in the G3 subgroups of Grade, except for MEOX2 and SRY (Figure 7B). Similarly, most of the significant genes showed significantly high expression in the YES subgroups of IDH1 mutation, except for EMILIN3 and MEOX2 (Figure 7C). Only SRY had significantly higher expression in the male subgroups of Gender (Figure 7D).
Figure 7.
Evaluation of the prognostic signature genes and clinical indicators in LGG patients. Comparison of the expression of 10 signature genes in different clinic factor subgroups (A) Age (B) Grade (C) IDH1 mutation (D) Gender.
Tumor Immune Microenvironment and Immune Checkpoint Analyses
Figure 8A demonstrates that the high-risk group exhibited elevated immune, stromal, and ESTIMATE scores based on our data. Significant differences in 13 cell types were observed between the risk groups, as shown in Figure 8B and C. Additionally, we observed higher expression of immune checkpoints (ADORA2A and CD200) in the low-risk group, while the high-risk group displayed increased expression of BTLA, CD160, CD200R1, CD244, and CD27, as depicted in Supplementary Table 3 and Figure 8D.
Figure 8.
The two groups’ tumor-immune microenvironments were examined. (A) In two groups, ESTIMATE score, immune score, stromal score, and tumor purity were calculated. (B) The percentage of immunological cells. (C) Comparison of tumor-infiltrating immune cells in two groups. (D) Comparison of immunological checkpoints in two groups.
Construction of ceRNA Regulatory Network
In brief, the DEseq2 package tested 29 DEmiRNAs and 2411 DElncRNAs. Five miRNAs intersected two hundred two miRNAs predicted by model genes and 29 DEmiRNAs. Then we found 228 DEmiRNA lncRNAs. By taking the intersection of 228 lncRNAs and 2411 DElncRNAs, 11 lncRNAs were found. Finally, a ceRNA network of three lncRNAs, three miRNAs, and five mRNAs was built (Figure 9).
Figure 9.
Construction of ceRNA regulatory network with model genes.
Screening and in vivo Validation of Model Genes
The quantitative real-time polymerase chain reaction (qRT-PCR) findings indicate that the expression levels of HOXC4 (Figure 10A), ABCC3 (Figure 10B), EMILIN3 (Figure 10C), CHI3L1 (Figure 10D), IGF2BP3 (Figure 10E), MEOX2 (Figure 10F), IGF2BP2 (Figure 10G), OTP (Figure 10H), METTL7B (Figure 10I), and SRY (Figure 10J) were considerably higher in high-grade gliomas compared to low-grade gliomas.
Figure 10.
PCR validation of clinical glioma samples. The quantitative real-time polymerase chain reaction (qRT-PCR) findings indicate that the expression levels of HOXC4 (A), ABCC3 (B), EMILIN3 (C), CHI3L1 (D), IGF2BP3 (E), MEOX2 (F), IGF2BP2 (G), OTP (H), METTL7B (I), and SRY (J) were significantly elevated in high-grade gliomas compared to low-grade gliomas.
EMILIN3 Gene Function Experiment
The qRT-PCR indicated LN229 and HS-683 human glioma cells transfected well (Figures 11A and 12A). Live/dead staining and cck8 test demonstrated that overexpression of EMILIN3 gene improved LN229 and HS-683 cell line proliferation and viability (Figure 11B, C,12B and C). viability of LN229 and HS-683 cell line (Figures 11C and 12C); cell scratch assay suggested that overexpression of EMILIN3 gene could improve migration (Figures 11D and 12D); transwell results suggested that overexpression could improve invasion (Figures 11E and 12E); and colony formation assay suggested that could improve colony formation (Figures 11F and 12F).
Figure 11.
EMILIN3 gene function experiment in LN229. qRT-PCR transfected LN229 human glioma cells efficiently (A). The CCK-8 experiment and live/dead staining findings demonstrated that overexpression of the EMILIN3 gene may increase LN229 cell line proliferation and vitality (B and C). Overexpression of the EMILIN3 gene enhances the migration, invasiveness, and colony formation of the LN229 cell line (D-F).
Figure 12.
EMILIN3 gene function experiment in HS-683. qRT-PCR transfected HS-683 human glioma cells efficiently (A). The CCK-8 experiment and live/dead staining findings demonstrated that overexpression of the EMILIN3 gene may increase HS-683 cell line proliferation and vitality (B and C). Overexpression of the EMILIN3 gene enhances the migration, invasiveness, and colony formation of the HS-683 cell line (D-F).
Discussion
LGG is a widely known aggressive, primary intracranial tumor, and the prognosis of patients remains bleak even after they have undergone optimal clinical interventions such as surgical resection, radiotherapy, and chemotherapy to ensure maximum safety.32 The leading cause of this poor prognosis is the diffuse, aggressive growth of glioma cells, which not only prevents complete surgical tumor removal but also promotes resistance of the tumor tissue to chemotherapy and radiotherapy.33 The invasion has a crucial role in the development of LGG. Although there have been many in vitro and in vivo studies on LGG, some mechanisms are unknown due to the complexity of its invasive system.33 Therefore, exploring new targets will provide new insights into the exploration of LGG therapy and its molecular mechanisms.
In LGG, we found two invasion-related molecular subtypes, cluster 1 and cluster 2. Cluster 2 had a worse prognosis. In an enrichment analysis of the differentially expressed genes between these subtypes, we found significant enrichments in GABA-related processes like GABA and GABA-A receptor complexes, GABA-gated chloride channel activity, RNA polymerase II specificity, and nicotine addiction-related entries. GABA, a non-protein amino acid, is a key central nervous system inhibitor. Animals, plants, and microbes naturally contain it.34 Astrocytes facilitate neuronal function by breaking down glutamate and GABA. GABA transaminase and succinate semialdehyde dehydrogenase (SSADH) convert GABA into succinate, which contributes to the TCA cycle.35 Isocitrate dehydrogenase (IDH) mutations cause glioma cells to adaptively drive the TCA cycle, promoting tumour growth. IDH mutations are common in LGG.36,37 RNA polymerase II (Pol II) is essential for eukaryotic cell protein-coding gene transcription.38 In gliomas, abnormal expression of the long non-coding RNA HOTAIR greatly affects malignancy. Its abnormal activation is linked to immunological response, T cells, and Pol II.39 Nicotine increases CYP2B1 expression in glioma tissues, particularly the cerebral cortex and blood vessels.40
We used univariate regression with lasso regression to find eleven characteristic genes that affect glioma. Risk models were created using these genes and displayed in column line graphs. IGF2BP2, an IGF2 mRNA-binding protein, regulates mRNA localization, stability, and translation.41,42 High-grade gliomas are thought to be more malignant and have a worse prognosis. To further validate the role of these 10 model genes in gliomas, we selected 10 high-grade and 10 low-grade cases for qRT-PCR validation. The high level of expression in high-grade gliomas indirectly suggests that these model genes are detrimental to glioma prognosis and have some predictive potential. Pancreatic cancer tumour cell proliferation is increased by IGF2BP2 overexpression via the PI3K/Akt signalling pathway.43 FBXL19-AS1 and tight junction-related protein expression is considerably reduced by nervous system IGF2BP2 knockdown, increasing blood-tumor barrier permeability and decreasing ZNF765 expression through STAU1-mediated mRNA decay.44 LI et al found that IGF2BP2 binds to SUMO1 and regulates the OIP5-AS1/miR-495-3p axis, increasing glioma angiogenesis.Sex-determining region-Y (SRY) genes in the SOX family generate the male phenotype, which female mammals do not express.45,46 SOX-2 protein expression promotes cell invasion in neural and neural crest-origin tumours, including gliomas.47 SOX-2 enhances cancer cell differentiation, and inhibiting it in glioblastoma-implanted cells lowers tumorigenicity and proliferation in immunodeficient animals.48,49 Cancers include breast, colorectal, ovarian, prostate, lung, and glioblastoma have higher serum levels of CHI3L1 (YKL-40), a secreted glycoprotein.50,51 High serum CHI3L1 levels predict glioma grading and poor prognosis.52–56 RNA-binding protein IGF2BP3 is mostly detected in foetal tissues and seldom in adult tissues. Cancers with high IGF2BP3 expression, particularly gliomas, have poor prognoses.57MEOX2, a homologous box transcription factor, is essential for tissue development. Its overexpression causes cell cycle arrest and endothelial cell senescence and is linked to poor glioma prognosis.58–61 ABCC3, a member of the ATP-binding cassette (ABC) protein superfamily, can cause brain drug resistance, especially to cytotoxic and antiviral medicines.62 By affecting eukaryotic transcription factors, HOXC4 affects plant and animal development.63 Overexpression of HOXC4 and other HOX genes is linked to poor survival in radiation and chemotherapy-treated glioma patients.64–66METTL7B, a methyltransferase-like protein, is abundantly expressed in papillary thyroid carcinoma and enhances thyroid cancer cell motility and invasion.67,68 High METTL7B expression in gliomas promotes LGG progression and death.69EMILIN3, a glycoprotein in the extracellular matrix, controls TGF-β ligand activity.70 Heparin and heparan sulphate proteoglycans contribute to glioma formation, which worsens high-risk LGG prognosis.71,72 EMILIN3’s significance in gliomas is unclear, hence more research was done in in vitro cells. In the LN229 and HS-683 human glioma cell line, EMILIN3 stimulated cell viability, proliferation, migration, invasiveness, and colony formation. Signature genes contribute to LGG and related illnesses in many ways. They have theoretical validity and diverse uses as patient prognostic markers.
In LGG, cancer cells utilize self-regulation mechanisms to evade immune cells, promoting immune escape and facilitating tumor progression. Immune checkpoint inhibitors (ICIs) have gained significant interest for their potential to target negative immunomodulatory factors like CTLA-4, PD-1, and PD-L1.73 Our study revealed notable differences in the expression levels of approximately 30 immune checkpoints between the high and low-risk groups. Notably, BLTA and CD160, which share the same ligand, inhibit T-cell function and signaling through phosphorylation and recruitment of SHP1 or SHP2.74,75 CTLA-4, which exhibits higher binding affinity to CD80 and CD86 than CD28, can diminish CD28 signaling by reducing CD80 and CD86 expression on antigen-presenting cells through trans endocytosis when expressed on T cells.76,77 Ongoing clinical Phase I/II studies for glioma immunotherapy involve CD27 inhibitor V sarilumab (CDX-1127), CTLA-4 inhibitors Ipilimumab (MDX-010, MDX-101), and Tremelimumab (ticilimumab, CP-675206).78 Furthermore, we screened for three miRNAs that regulate signature genes and three long non-coding RNAs (lncRNAs) that control these miRNAs. sND1-IT1 has been implicated in various human diseases, including myocardial ischemia/reperfusion injury and laryngeal squamous cell carcinoma.79 Studies have demonstrated its role in promoting TGF-β1-induced epithelial-to-mesenchymal transition in gastric cancer through the miR-124/COL4A1 regulatory axis.80 SNHG3, a well-known oncogenic lncRNA, is significantly upregulated in gliomas, promoting cell proliferation, inhibiting apoptosis, and influencing the cell cycle, thereby facilitating cancer progression.81
Conclusion
Ten invasion-associated signature genes were identified, and a risk model and line graph were developed to predict glioma patients’ prognosis accurately. We performed PCR on clinical tumor samples for all ten genes, and the results were consistent with the predicted trends. We selected the EMILIN3 gene for functional validation and found that this is a new gene that promotes aggressive transformation in gliomas.
Funding Statement
Qilu Sanitation and Health Leading Talent Cultivation Project (to Zhiming Zheng, 2020-2025).
Data Sharing Statement
The datasets used in this study can be accessed from the TCGA count (https://portal.gdc.cancer.gov) and the CGGA database (http://www.cgga.org.cn/). The invasion-related genes were obtained from the CancerSEA database (http://biocc.hrbmu.edu.cn/CancerSEA/). For further details, please refer to the “Availability of data” section in the Materials and Data Policies of the Author’s Guide.
Ethics Statement
Ethical permission for the current investigation was obtained from the Ethics Committee of Liaocheng People’s Hospital (permission No. 2023015). The patients/participants provided their written informed consent to participate in this study. The present study fulfils the requirements of the Declaration of Helsinki.
Disclosure
The authors declare that there is no conflicts of interest.
References
- 1.Mafi A, Rahmati A, Babaei Aghdam Z, et al. Recent insights into the microRNA-dependent modulation of gliomas from pathogenesis to diagnosis and treatment. Cell. Mol. Biol. Lett. 2022;27(1):65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lin D, Wang M, Chen Y, et al. Trends in Intracranial Glioma Incidence and Mortality in the United States, 1975-2018. Front Oncol. 2021;11:748061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Thakkar JP, Dolecek TA, Horbinski C, et al. Epidemiologic and molecular prognostic review of glioblastoma. Cancer Epidemiol Biomarkers Prev. 2014;23(10):1985–1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Schiff D, Van den Bent M, Vogelbaum MA, et al. Recent developments and future directions in adult lower-grade gliomas: society for Neuro-Oncology (SNO) and European Association of Neuro-Oncology (EANO) consensus. Neuro-Oncology. 2019;21(7):837–853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Weller M, van den Bent M, Tonn JC, et al. European Association for Neuro-Oncology (EANO) guideline on the diagnosis and treatment of adult astrocytic and oligodendroglial gliomas. Lancet Oncol. 2017;18(6):e315–e29. [DOI] [PubMed] [Google Scholar]
- 6.Ater JL, Zhou T, Holmes E, et al. Randomized study of two chemotherapy regimens for treatment of low-grade glioma in young children: a report from the Children’s Oncology Group. J clin oncol. 2012;30(21):2641–2647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kiran M, Chatrath A, Tang X, Keenan DM, Dutta A. A Prognostic Signature for Lower Grade Gliomas Based on Expression of Long Non-Coding RNAs. Mol Neurobiol. 2019;56(7):4786–4798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Burger PC, Heinz ER, Shibata T, Kleihues P. Topographic anatomy and CT correlations in the untreated glioblastoma multiforme. J Neurosurg. 1988;68(5):698–704. [DOI] [PubMed] [Google Scholar]
- 9.Cuddapah VA, Robel S, Watkins S, Sontheimer H. A neurocentric perspective on glioma invasion. Nat Rev Neurosci. 2014;15(7):455–465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Guo X, Jiao H, Cao L, Meng F. Biological implications and clinical potential of invasion and migration related miRNAs in glioma. Front Integrative Neurosci. 2022;16:989029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chen W, Huang B, Wang E, Wang X. MiR-145 inhibits EGF-induced epithelial-to-mesenchymal transition via targeting Smad2 in human glioblastoma. Onco Targets Ther. 2019;12:3099–3107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang Q, Li X, Zhu Y, Yang P. MicroRNA-16 suppresses epithelial-mesenchymal transition‑related gene expression in human glioma. Mol Med Rep. 2014;10(6):3310–3314. [DOI] [PubMed] [Google Scholar]
- 13.Valtorta S, Salvatore D, Rainone P, Belloli S, Bertoli G, Moresco RM. Molecular and Cellular Complexity of Glioma. Focus on Tumour Microenvironment and the Use of Molecular and Imaging Biomarkers to Overcome Treatment Resistance. Int J Mol Sci. 2020;21(16):67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pientka FK, Hu J, Schindler SG, et al. Oxygen sensing by the prolyl-4-hydroxylase PHD2 within the nuclear compartment and the influence of compartmentalisation on HIF-1 signalling. J Cell Sci. 2012;125(Pt 21):5168–5176. [DOI] [PubMed] [Google Scholar]
- 15.Dai D, Huang W, Lu Q, Chen H, Liu J, Hong B. miR‑24 regulates angiogenesis in gliomas. Mol Med Rep. 2018;18(1):358–368. [DOI] [PubMed] [Google Scholar]
- 16.Liu S, Yin F, Zhang J, et al. Regulatory roles of miRNA in the human neural stem cell transformation to glioma stem cells. J Cell Biochem. 2014;115(8):1368–1380. [DOI] [PubMed] [Google Scholar]
- 17.Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell. 2010;141(1):39–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hambardzumyan D, Gutmann DH, Kettenmann H. The role of microglia and macrophages in glioma maintenance and progression. Nat Neurosci. 2016;19(1):20–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gatenby RA, Gawlinski ET. The glycolytic phenotype in carcinogenesis and tumor invasion: insights through mathematical models. Cancer Res. 2003;63(14):3847–3854. [PubMed] [Google Scholar]
- 20.Bansal R, Magge S, Winkler S. Specific inhibitor of FGF receptor signaling: FGF-2-mediated effects on proliferation, differentiation, and MAPK activation are inhibited by PD173074 in oligodendrocyte-lineage cells. J Neurosci Res. 2003;74(4):486–493. [DOI] [PubMed] [Google Scholar]
- 21.Wu M, Li X, Liu R, Yuan H, Liu W, Liu Z. Development and validation of a metastasis-related Gene Signature for predicting the Overall Survival in patients with Pancreatic Ductal Adenocarcinoma. J Cancer. 2020;11(21):6299–6318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Liu J, Jiang C, Xu C, et al. Identification and development of a novel invasion-related gene signature for prognosis prediction in colon adenocarcinoma. Can Cell Inter. 2021;21(1):101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Naba A, Clauser KR, Ding H, Whittaker CA, Carr SA, Hynes RO. The extracellular matrix: tools and insights for the “omics” era. Matrix Biol. 2016;49:10–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wilkerson MD, Hayes DN. ConsensusClusterPlus: a class discovery tool with confidence assessments and item tracking. Bioinformatics. 2010;26(12):1572–1573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lei C, Chen W, Wang Y, et al. Prognostic Prediction Model for Glioblastoma: a Metabolic Gene Signature and Independent External Validation. J Cancer. 2021;12(13):3796–3808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics. 2012;16(5):284–287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chen B, Khodadoust MS, Liu CL, Newman AM, Alizadeh AA. Profiling Tumor Infiltrating Immune Cells with CIBERSORT. Methods Mol Biol. 2018;1711:243–259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Fan Y, Xia J. miRNet-Functional Analysis and Visual Exploration of miRNA-Target Interactions in a Network Context. Methods Mol Biol. 2018;1819:215–233. [DOI] [PubMed] [Google Scholar]
- 30.Grada A, Otero-Vinas M, Prieto-Castrillo F, Obagi Z, Falanga V. Research Techniques Made Simple: analysis of Collective Cell Migration Using the Wound Healing Assay. J Investigative Dermatol. 2017;137(2):e11–e6. [DOI] [PubMed] [Google Scholar]
- 31.Wu D, Kang L, Tian J, et al. Exosomes Derived from Bone Mesenchymal Stem Cells with the Stimulation of Fe(3)O(4) Nanoparticles and Static Magnetic Field Enhance Wound Healing Through Upregulated miR-21-5p. Int j Nanomed. 2020;15:7979–7993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.de Gooijer MC, Guillén Navarro M, Bernards R, Wurdinger T, van Tellingen O. An Experimenter’s Guide to Glioblastoma Invasion Pathways. Trends Mol Med. 2018;24(9):763–780. [DOI] [PubMed] [Google Scholar]
- 33.Nakada M, Kita D, Teng L, et al. Receptor Tyrosine Kinases: principles and Functions in Glioma Invasion. Adv Exp Med Biol. 2020;1202:151–178. [DOI] [PubMed] [Google Scholar]
- 34.Krnjević K, Schwartz S. Is gamma-aminobutyric acid an inhibitory transmitter? Nature. 1966;211(5056):1372–1374. [DOI] [PubMed] [Google Scholar]
- 35.Schousboe A, Bak LK, Waagepetersen HS. Astrocytic Control of Biosynthesis and Turnover of the Neurotransmitters Glutamate and GABA. Front Endocrinol. 2013;4:102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Sciacovelli M, Gonçalves E, Johnson TI, et al. Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition. Nature. 2016;537(7621):r67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Hujber Z, Horváth G, Petővári G, et al. GABA, glutamine, glutamate oxidation and succinic semialdehyde dehydrogenase expression in human gliomas. J Exp Clin Cancer Res. 2018;37(1):271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Roeder RG, Rutter WJ. Multiple forms of DNA-dependent RNA polymerase in eukaryotic organisms. Nature. 1969;224(5216):234–237. [DOI] [PubMed] [Google Scholar]
- 39.Wang Y, Yi K, Liu X, et al. HOTAIR Up-Regulation Activates NF-κB to Induce Immunoescape in Gliomas. Front Immunol. 2021;12:785463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Nava-Salazar S, Gómez-Manzo S, Marcial-Quino J, et al. Effect of Nicotine on CYP2B1 Expression in a Glioma Animal Model and Analysis of CYP2B6 Expression in Pediatric Gliomas. Int J Mol Sci. 2018;19(6). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bell JL, Wächter K, Mühleck B, et al. Insulin-like growth factor 2 mRNA-binding proteins (IGF2BPs): post-transcriptional drivers of cancer progression? Cellular and molecular life sciences. CMLS. 2013;70(15):2657–2675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Christiansen J, Kolte AM, Hansen T, Nielsen FC. IGF2 mRNA-binding protein 2: biological function and putative role in type 2 diabetes. J Mol Endocrinol. 2009;43(5):187–195. [DOI] [PubMed] [Google Scholar]
- 43.Xu X, Yu Y, Zong K, Lv P, Gu Y. Up-regulation of IGF2BP2 by multiple mechanisms in pancreatic cancer promotes cancer proliferation by activating the PI3K/Akt signaling pathway. J Exp Clin Cancer Res. 2019;38(1):497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Dahlem C, Barghash A, Puchas P, Haybaeck J, Kessler SM. The Insulin-Like Growth Factor 2 mRNA Binding Protein IMP2/IGF2BP2 is Overexpressed and Correlates with Poor Survival in Pancreatic Cancer. Int J Mol Sci. 2019;20(13). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Li H, Wang D, Yi B, et al. SUMOylation of IGF2BP2 promotes vasculogenic mimicry of glioma via regulating OIP5-AS1/miR-495-3p axis. Int J Bio Sci. 2021;17(11):2912–2930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Capel B. Vertebrate sex determination: evolutionary plasticity of a fundamental switch. Nat Rev Genet. 2017;18(11):675–689. [DOI] [PubMed] [Google Scholar]
- 47.Ikushima H, Todo T, Ino Y, Takahashi M, Miyazawa K, Miyazono K. Autocrine TGF-beta signaling maintains tumorigenicity of glioma-initiating cells through Sry-related HMG-box factors. Cell Stem Cell. 2009;5(5):504–514. [DOI] [PubMed] [Google Scholar]
- 48.Kuo HY, Hsu HT, Chen YC, Chang YW, Liu FT, Wu CW. Galectin-3 modulates the EGFR signalling-mediated regulation of Sox2 expression via c-Myc in lung cancer. Glycobiology. 2016;26(2):155–165. [DOI] [PubMed] [Google Scholar]
- 49.Gangemi RM, Griffero F, Marubbi D, et al. SOX2 silencing in glioblastoma tumor-initiating cells causes stop of proliferation and loss of tumorigenicity. Stem Cells. 2009;27(1):40–48. [DOI] [PubMed] [Google Scholar]
- 50.Cintin C, Johansen JS, Christensen IJ, Price PA, Sørensen S, Nielsen HJ. High serum YKL-40 level after surgery for colorectal carcinoma is related to short survival. Cancer. 2002;95(2):267–274. [DOI] [PubMed] [Google Scholar]
- 51.Diefenbach CS, Shah Z, Iasonos A, et al. Preoperative serum YKL-40 is a marker for detection and prognosis of endometrial cancer. Gynecologic Oncol. 2007;104(2):435–442. [DOI] [PubMed] [Google Scholar]
- 52.Jensen BV, Johansen JS, Price PA. High levels of serum HER-2/neu and YKL-40 independently reflect aggressiveness of metastatic breast cancer. Clin Cancer Res. 2003;9(12):4423–4434. [PubMed] [Google Scholar]
- 53.Johansen JS, Brasso K, Iversen P, et al. Changes of biochemical markers of bone turnover and YKL-40 following hormonal treatment for metastatic prostate cancer are related to survival. Clin Cancer Res. 2007;13(11):3244–3249. [DOI] [PubMed] [Google Scholar]
- 54.Junker N, Johansen JS, Andersen CB, Kristjansen PE. Expression of YKL-40 by peritumoral macrophages in human small cell lung cancer. Lung Cancer. 2005;48(2):223–231. [DOI] [PubMed] [Google Scholar]
- 55.Tanwar MK, Gilbert MR, Holland EC. Gene expression microarray analysis reveals YKL-40 to be a potential serum marker for malignant character in human glioma. Cancer Res. 2002;62(15):4364–4368. [PubMed] [Google Scholar]
- 56.Colin C, Baeza N, Bartoli C, et al. Identification of genes differentially expressed in glioblastoma versus pilocytic astrocytoma using Suppression Subtractive Hybridization. Oncogene. 2006;25(19):2818–2826. [DOI] [PubMed] [Google Scholar]
- 57.Degrauwe N, Suvà ML, Janiszewska M, Riggi N, Stamenkovic I. IMPs: an RNA-binding protein family that provides a link between stem cell maintenance in normal development and cancer. Genes Dev. 2016;30(22):2459–2474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Douville JM, Cheung DY, Herbert KL, Moffatt T, Wigle JT. Mechanisms of MEOX1 and MEOX2 regulation of the cyclin dependent kinase inhibitors p21 and p16 in vascular endothelial cells. PLoS One. 2011;6(12):e29099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Cao G, Huang B, Liu Z, et al. Intronic miR-301 feedback regulates its host gene, ska2, in A549 cells by targeting MEOX2 to affect ERK/CREB pathways. Biochem. Biophys. Res. Commun. 2010;396(4):978–982. [DOI] [PubMed] [Google Scholar]
- 60.Turcan S, Makarov V, Taranda J, et al. Mutant-IDH1-dependent chromatin state reprogramming, reversibility, and persistence. Nature Genet. 2018;50(1):62–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Tachon G, Masliantsev K, Rivet P, et al. Prognostic significance of MEOX2 in gliomas. Modern Pathology. 2019;32(6):774–786. [DOI] [PubMed] [Google Scholar]
- 62.Haimeur A, Conseil G, Deeley RG, Cole SP. The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation. Curr Drug Metab. 2004;5(1):21–53. [DOI] [PubMed] [Google Scholar]
- 63.Holland PW. Evolution of homeobox genes. WIRES Dev Biol. 2013;2(1):31–45. [DOI] [PubMed] [Google Scholar]
- 64.Murat A, Migliavacca E, Gorlia T, et al. Stem cell-related “self-renewal” signature and high epidermal growth factor receptor expression associated with resistance to concomitant chemoradiotherapy in glioblastoma. J clin oncol. 2008;26(18):3015–3024. [DOI] [PubMed] [Google Scholar]
- 65.Duan R, Han L, Wang Q, et al. HOXA13 is a potential GBM diagnostic marker and promotes glioma invasion by activating the Wnt and TGF-β pathways. Oncotarget. 2015;6(29):27778–27793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Li B, McCrudden CM, Yuen HF, et al. CD133 in brain tumor: the prognostic factor. Oncotarget. 2017;8(7):11144–11159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Cai WY, Chen X, Chen LP, Li Q, Du XJ, Zhou YY. Role of differentially expressed genes and long non-coding RNAs in papillary thyroid carcinoma diagnosis, progression, and prognosis. J Cell Biochem. 2018;119(10):8249–8259. [DOI] [PubMed] [Google Scholar]
- 68.Ye D, Jiang Y, Sun Y, et al. METTL7B promotes migration and invasion in thyroid cancer through epithelial-mesenchymal transition. J Mol Endocrinol. 2019;63(1):51–61. [DOI] [PubMed] [Google Scholar]
- 69.Fu R, Luo X, Ding Y, Guo S. Prognostic Potential of METTL7B in Glioma. Neuroimmunomodulation. 2022;29(3):186–201. [DOI] [PubMed] [Google Scholar]
- 70.Schiavinato A, Becker AK, Zanetti M, et al. EMILIN-3, peculiar member of elastin microfibril interface-located protein (EMILIN) family, has distinct expression pattern, forms oligomeric assemblies, and serves as transforming growth factor β (TGF-β) antagonist. J Biol Chem. 2012;287(14):11498–11515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Xiong A, Kundu S, Forsberg-Nilsson K. Heparan sulfate in the regulation of neural differentiation and glioma development. FEBS J. 2014;281(22):4993–5008. [DOI] [PubMed] [Google Scholar]
- 72.Zeng WJ, Yang YL, Liu ZZ, et al. Integrative Analysis of DNA Methylation and Gene Expression Identify a Three-Gene Signature for Predicting Prognosis in Lower-Grade Gliomas. Cell Phys Biochem. 2018;47(1):428–439. [DOI] [PubMed] [Google Scholar]
- 73.Li S, Yu W, Xie F, et al. Neoadjuvant therapy with immune checkpoint blockade, antiangiogenesis, and chemotherapy for locally advanced gastric cancer. Nat Commun. 2023;14(1):8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Watanabe N, Gavrieli M, Sedy JR, et al. BTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1. Nat Immunol. 2003;4(7):670–679. [DOI] [PubMed] [Google Scholar]
- 75.Cai G, Anumanthan A, Brown JA, Greenfield EA, Zhu B, Freeman GJ. CD160 inhibits activation of human CD4+ T cells through interaction with herpesvirus entry mediator. Nat Immunol. 2008;9(2):176–185. [DOI] [PubMed] [Google Scholar]
- 76.van der Merwe PA, Bodian DL, Daenke S, Linsley P, Davis SJ. CD80 (B7-1) binds both CD28 and CTLA-4 with a low affinity and very fast kinetics. J Exp Med. 1997;185(3):393–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Qureshi OS, Zheng Y, Nakamura K, et al. Trans-endocytosis of CD80 and CD86: a molecular basis for the cell-extrinsic function of CTLA-4. Science. 2011;332(6029):6003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Tan AC, Heimberger AB, Khasraw M. Immune Checkpoint Inhibitors in Gliomas. Curr Oncol Rep. 2017;19(4):23. [DOI] [PubMed] [Google Scholar]
- 79.Hui L, Wang J, Zhang J, Long J. lncRNA TMEM51-AS1 and RUSC1-AS1 function as ceRNAs for induction of laryngeal squamous cell carcinoma and prediction of prognosis. PeerJ. 2019;7:e7456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Hu YZ, Hu ZL, Liao TY, Li Y, Pan YL. LncRNA SND1-IT1 facilitates TGF-β1-induced epithelial-to-mesenchymal transition via miR-124/COL4A1 axis in gastric cancer. Cell Death Discovery. 2022;8(1):73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Zhang X, Zheng W, Jiang W, Lin R, Xing C. Long non-coding RNA SNHG3 accelerates progression in glioma by modulating miR-384/HDGF axis. Open Life Sci. 2020;15(1):654–664. [DOI] [PMC free article] [PubMed] [Google Scholar]












