Abstract
Background
The escalating global rise in multidrug-resistant gram-negative bacteria presents an increasingly substantial threat to patient safety. Over the past decade, carbapenem-resistant Enterobacterales (CRE) have emerged as one of the most critical pathogens in hospital-acquired infections, notably within intensive care units. Colistin has become one of the last-resort antimicrobial agents utilized to combat infections caused by CRE. However, the use of colistin has been accompanied by a notable increase in the prevalence of colistin-resistant bacteria. This study aimed to investigate plasmid-mediated colistin resistance genes ranging from mcr-1 to mcr-8 among members of the Enterobacterales order.
Materials and methods
This prospective study was conducted in the microbiology laboratory of Afyonkarahisar Health Sciences University Health Research and Practice Center between May 1, 2021 and July 31, 2022. A total of 2,646 Enterobacterales isolates were obtained from all culture-positive clinical samples sent from various clinics. Of these, 79 isolates exhibiting resistance to carbapenem antibiotics were included in the study. Among the 79 isolates, the presence of mcr-1 to mcr-8 genes was investigated in 27 isolates that were shown to be resistant to colistin. The identification of bacteria at the species level and antibiotic susceptibility tests were conducted using the VITEK 2 automated system (bioMérieux, USA). Colistin resistance among Enterobacterales strains exhibiting carbapenem resistance was evaluated using the broth microdilution technique (ComASP™ Colistin, Liofilchem, Italy), in accordance with the manufacturer's instructions.
Results
In our in vitro investigations, the minimum inhibitory concentration (MIC) values for meropenem were determined to be >8 µg/ml, whereas for colistin, the MIC50 value was >16 µg/ml and the MIC90 value was 8 µg/ml. A total of 27 colistin-resistant strains were identified among the 79 carbapenem-resistant Enterobacterales strains analyzed. The most prevalent agent among colistin-resistant strains was Klebsiella pneumoniae (K. pneumoniae), representing 66.7% of the isolates. This was followed by Proteus mirabilis (P. mirabilis) with 29.6% and Escherichia coli (E. coli) with 3.7%. The colistin resistance rate among carbapenem-resistant strains was found to be 34.2%, with colistin MIC values in strains tested by the broth microdilution method ranging from 4 to >16 µg/ml concentrations. In polymerase chain reaction (PCR) studies, the mcr-1 gene region was successfully detected by real-time PCR in the positive control isolate. Nevertheless, none of the gene regions from mcr-1 to mcr-8 were identified in our study investigating the presence of plasmid-mediated genes using a multiplex PCR kit.
Conclusion
Although our study demonstrated the presence of increased colistin resistance rates in carbapenem-resistant Enterobacterales isolates, it resulted in the failure to detect genes from mcr-1 to mcr-8 by the multiplex PCR method. Therefore, it is concluded that the colistin resistance observed in Enterobacteriaceae isolates in our region is not due to the mcr genes screened, but to different resistance development mechanisms.
Keywords: multiplex pcr, mcr gene, broth microdilution, colistin, klebsiella pneumoniae, escherichia coli, carbapenem-resistant enterobacterales
Introduction
The significant increase in multidrug-resistant (MDR) microorganisms today, particularly the rapid rise of gram-negative bacteria resistant to the carbapenem group of antibiotics, has led to the reintroduction and last-resort clinical use of some older antimicrobials that had previously fallen out of use. However, the emergence of a new plasmid-mediated colistin resistance gene, named mcr-1, in November 2015, has raised concerns about the clinical efficacy of colistin. Since its initial identification, the mcr-1 gene has been detected in a variety of bacterial isolates belonging to the Enterobacterales, including those recovered from humans, animal food products, and environmental samples. This resistance gene has spread to over 40 countries across five continents. Since the discovery of the first mcr-1 gene, nine more mcr gene variants (mcr-2 to mcr-10) have been identified [1].
Colistin resistance is primarily attributed to phosphoethanolamine (pEA) transferases, which catalyze the addition of phosphoethanolamine (pEtN) to lipid A, thereby reducing the electrostatic attraction between colistin and the gram negative outer membrane [2]. On the other hand, the detection of mcr-9 in colistin-sensitive strains has revealed that strains carrying mcr genes might not phenotypically exhibit colistin resistance due to low levels of gene expression [3].
Plasmids carrying the mcr-1 gene not only have the ability to conjugate and transfer but also enhance the persistence of colistin resistance. To date, the mcr-1 gene and its variants have been reported in many countries, with a total of 113 variants identified within 10 families of the mcr gene [4].
These plasmid-mediated resistances can quickly spread cross-species through horizontal gene transfer, leading to the emergence of MDR superbugs, which poses a significant challenge for clinicians [5]. The coexistence of mcr genes with other drug-resistant genes (blaNDM-13, blaTEM, blaSHV, tetA, floR, aac-3-IV, aadA1, fosA, and aac(6_)-lb) increases the likelihood of the emergence of drug-resistant super microorganisms [6,7]. The prevalence of multidrug resistance leads to an increase in hospital-acquired infections with limited treatment options, longer hospital stays, higher mortality rates, and increased costs [8].
In addition, it has been recently reported that the coexistence of mcr-1 and carbapenemase genes has increased following the clinical reintroduction of colistin [9]. Therefore, there is an urgent need to develop new strategies to eradicate the spread of mcr genes and prolong the use of colistin as a last-resort antibiotic against carbapenem-resistant bacteria carrying the mcr gene. This study aims to investigate the plasmid-mediated resistance genes from mcr-1 to mcr-8 in members of the Enterobacterales.
Materials and methods
This prospective observational study was conducted between May 1, 2021 and July 31, 2022 in the microbiology laboratory of the Afyonkarahisar Health Sciences University Health Research and Practice Center. The hospital is a tertiary university hospital located in western Turkey with a total of 655 beds, including 103 intensive care unit beds in three levels of acuity. The study was conducted with the approval of the Clinical Research Ethics Committee at Afyonkarahisar Health Sciences University (Decision: 2021/227).
Collection of bacterial strains
A total of 2,646 Enterobacterales isolates were identified from all clinical samples sent to the laboratory during the study period. Of these, 79 isolates that were determined to be resistant to carbapenem group antibiotics were included in the study. Of 79 isolates, 27 were resistant to colistin. The presence of genes from mcr-1 to mcr-8 was investigated in these strains.
Identification of bacterial strains and antibiotic susceptibility testing
Clinical samples such as blood, cerebrospinal fluid, urine, sputum, and wound swabs sent to the laboratory were cultured on blood agar, chocolate agar, and EMB agar media and incubated at 37°C for 24 hours. After incubation, pure cultures of the bacteria were obtained by subculturing. Species-level identification of the bacteria and antibiotic susceptibility testing were performed using the VITEK 2 automated system (bioMérieux, USA). Resistant strains were confirmed using the gradient diffusion test method. Standard strains E. coli ATCC 25922, E. coli NTCC 13846 (resistant), and K. pneumoniae ATCC 700603 were used in all phenotypic susceptibility tests. Strains were stored in tryptic soy broth with 15% glycerol at -80°C until molecular testing was performed. Antibiogram results were evaluated according to the recommendations of the European Committee on Antimicrobial Susceptibility Testing (EUCAST) [10].
Determination of colistin resistance by the broth microdilution method
Colistin resistance in Enterobacterales strains with carbapenem resistance was tested using the broth microdilution method (ComASP™ Colistin, Liofilchem, Italy) according to the manufacturer's recommended protocol. The ComASP™ Colistin test comprises seven wells containing lyophilized colistin concentrations that increase twofold (0.25-16 μg/mL). In accordance with the manufacturer's instructions, 10 μl of the bacterial inoculum, adjusted to 0.5 McFarland, was transferred to cation-adjusted Mueller-Hinton broth, which was commercially provided by the manufacturer. Subsequently, 50 μl of the aforementioned broth was distributed into the wells of the microplate. The microplate was then covered with a transparent plastic film and incubated at 37°C for 24 hours, after which it was evaluated.
Investigation of the molecular basis of resistance
Nucleic acid isolation was performed using the Pure Gene DNA Isolation Kit (Thermo Scientific, USA). Molecular detection of mcr-1 to mcr-8 genes in isolates found resistant to colistin by the broth microdilution method was investigated by multiplex PCR using the Bio-Speedy Colistin Resistance qPCR kit (Bio-Speedy, Turkey) in accordance with the manufacturer's recommendations. The specific primers utilized for the amplification of the mcr genes are presented in Table 1.
Table 1. Primers used for the detection of mcr genes.
| Primer Name | Sequence (5ʹ-3ʹ) | Target Gene | Size (bp) |
| mcr-1_205F | TCCAAAATGCCCTACAGACC | mcr-1 | 205 |
| mcr-1_205R | GCCACCACAGGCAGTAAAAT | ||
| mcr-2_279F | CCTTTTGTGCTGATGGGTTT | mcr-2 | 279 |
| mcr-2_279R | ATTTTGGAGCATGGTGGTGT | ||
| mcr-3_347F | CTTGCTGAACCAATCCCATT | mcr-3 | 347 |
| mcr-3_347R | CCATCGTTCTCCTTCCAAAA | ||
| mcr-4_426F | GATCCGAAGCTGTGTTCTG | mcr-4 | 426 |
| mcr-4_426R | GCCAGCATTGGTACGCTAGT | ||
| mcr-5_522F | GGTTGGCCGAGAAGATAACA | mcr-5 | 522 |
| mcr-5_522R | ATGTTGCCAGAAGGTCCAAC | ||
| mcr-7_791F | GTCAGTTACGCCATGCTCAA | mcr-7 | 791 |
| mcr-7_791R | TTCTTGTCGCAGAACTGTGG | ||
| mcr-8_943F | AAACTGAACCCGGTACAACG | mcr-8 | 943 |
| mcr-8_943R | GCCATAGCACCTCAACACCT |
E. coli NTCC 13846 strain carrying mcr-1 gene was used as a positive control strain in the molecular studies. Amplification was performed on a Bio-Rad CFX 96 (Bio-Rad, USA) real-time PCR device. The multiplex PCR protocol for the mcr-1 to mcr-8 gene regions is provided in Table 2. The multiplex PCR kit used is for rapid diagnostic purposes and is used to screen genes from mcr-1 to mcr-8. In case of positive result detection, PCR amplification using standard primers and identification by sequence analysis were planned.
Table 2. Multiplex PCR protocol for mcr-1 to mcr-8 genes.
| Cycle count | Temperature | Duration |
| 1 | 52°C | 5 min |
| 1 | 95°C | 10 sec |
| 40 | 95°C | 1 sec |
| 55°C | 1 sec |
Statistical analysis
The statistical analysis of the study was conducted using the IBM SPSS Statistics for Windows, Version 20.0 (released 2011, IBM Corp., Armonk, NY). Descriptive statistics were expressed as number and percentage values. Whether there was a statistically significant difference between meropenem-sensitive and resistant isolates in colistin-resistant strains was investigated using the chi-square test, and a p-value less than 0.05 was considered significant.
Results
During the study period, a total of 2,646 Enterobacterales isolates were identified among the infectious agents isolated from clinical specimens sent to the laboratory. Of all the isolates identified at the species level by the VITEK 2 automated system and subjected to antibiotic susceptibility testing with MIC value detection, 79 isolates were found to be carbapenem resistant, and there were no repeated samples from the same patient. The carbapenem resistance detected by the automated system in all these samples was confirmed by gradient testing.
According to the results of the colistin broth microdilution test of carbapenem-resistant Enterobacterales strains, colistin resistance was detected in a total of 27 samples and included in the molecular part of the study.
Colistin-resistant strains were most frequently isolated from wound (7, 26%), tracheal aspirate (6, 22.2%), and urine (6, 22.2%) samples. More rarely, they were also isolated from sputum, bronchoalveolar lavage, blood, and sterile body fluids. The distribution of isolates with detected colistin resistant according to clinical specimens is presented in Figure 1. There was no gender difference between the growths; 15 (55.5%) of these bacteria were obtained from male patients and 12 (44.5%) from female patients.
Figure 1. Distribution of isolates with detected colistin resistance according to clinical specimens.
The distribution of isolates included in the study according to the clinics to which they were sent is shown in Table 3. When the samples were evaluated on a clinical basis, the most common isolates were sent from anesthesia intensive care and general surgery services with a rate of 18.5%. It is noteworthy that, as expected, the majority of samples came from intensive care units and all samples belonged to inpatients.
Table 3. Distribution of services from which colistin-resistant strains were sent.
| Clinics | Number of Samples | % |
| Anesthesiology and Reanimation Intensive Care Unit | 5 | 18.5 |
| General Surgery | 5 | 18.5 |
| Internal Medicine Intensive Care Unit | 4 | 14.8 |
| Neonatal Intensive Care Unit | 4 | 14.8 |
| Pulmonology | 3 | 11.2 |
| Other | 6 | 22.2 |
| Total | 27 | 100 |
The study revealed that K. pneumoniae was the most prevalent pathogen among Enterobacterales isolates exhibiting colistin resistance, with a prevalence of 66.7% and 18 strains. Proteus mirabilis was the second most common, with eight strains (29.6%), and Escherichia coli had only one strain (3.7%).
The MIC values of colistin for carbapenem-resistant Enterobacterales strains investigated in this study are presented in Table 4. When comparing meropenem-sensitive and resistant isolates in colistin-resistant strains, no significant difference was detected between the two groups (p > 0.05). In our in vitro studies, the MIC50 and MIC90 values for meropenem were found to be >8 µg/ml, whereas for colistin, the MIC50 value was >16 and the MIC90 value was 8 µg/ml. Within the scope of the study, colistin resistance rate was determined as 34.1% in carbapenem-resistant Enterobacterales isolates.
Table 4. Colistin MIC values for carbapenem-resistant Enterobacterales strains.
*R: resistant, MIC: minimum inhibitory concentration
| Sample (n=27) | Isolates | Meropenem (Vitek 2) | Colistin (Microdilution Method) | ||
| MIC (µg/ml) | Comment | MIC (µg/ml) | Comment | ||
| 1 | Proteus mirabilis | >8 | R* | >16 | R |
| 2 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 3 | Proteus mirabilis | >8 | R | >16 | R |
| 4 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 5 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 6 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 7 | Klebsiella pneumoniae | >8 | R | 8 | R |
| 8 | Proteus mirabilis | 4 | R | >16 | R |
| 9 | Klebsiella pneumoniae | >8 | R | 4 | R |
| 10 | Klebsiella pneumoniae | >8 | R | 4 | R |
| 11 | Proteus mirabilis | >8 | R | >16 | R |
| 12 | Klebsiella pneumoniae | >8 | R | 8 | R |
| 13 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 14 | Proteus mirabilis | >8 | R | >16 | R |
| 15 | Klebsiella pneumoniae | >8 | R | 8 | R |
| 16 | Proteus mirabilis | >8 | R | >16 | R |
| 17 | Klebsiella pneumoniae | >8 | R | 4 | R |
| 18 | Proteus mirabilis | >8 | R | >16 | R |
| 19 | Klebsiella pneumoniae | 8 | R | >16 | R |
| 20 | Klebsiella pneumoniae | >8 | R | 4 | R |
| 21 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 22 | Escherichia coli | >8 | R | 4 | R |
| 23 | Klebsiella pneumoniae | >8 | R | 8 | R |
| 24 | Proteus mirabilis | >8 | R | >16 | R |
| 25 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 26 | Klebsiella pneumoniae | >8 | R | >16 | R |
| 27 | Klebsiella pneumoniae | >8 | R | 8 | R |
The antibiotic susceptibility profile of colistin-resistant isolates included in the study are presented in Figure 2. In terms of resistance rates, amikacin was the most effective agent with a resistance rate of 77.8%, followed by gentamicin with 85.2%.
Figure 2. Antimicrobial resistance rates of colistin-resistant isolates.
The multiplex PCR study conducted to ascertain the prevalence of plasmid-mediated colistin resistance genes in enterobacterales isolates did not yield any positive results for genes mcr-1 to mcr-8. Figure 3 illustrates the amplifications observed with the positive control in the multiplex qPCR study. In multiplex PCR, data acquisition is performed in the FAM (green/target region) and HEX (blue/internal control) fluorescence channels. The simultaneous amplification curve in the FAM (cycle threshold (ct) = 23.32) and HEX (ct = 21.68) channels in Figure 3 indicates that the sample carries the target mcr1-8 gene region.
Figure 3. PCR analysis of E. coli NCTC 13846, a positive control strain for mcr-1.
Discussion
Given the rapid emergence and dissemination of antibiotic resistance, it is imperative to monitor antibiotic usage and implement appropriate treatment strategies to minimize indiscriminate and incorrect antibiotic use [11]. Colistin, also referred to as polymyxin E, is a polypeptide antibiotic. Its utilization was ceased in the mid-1980s due to neurotoxic and nephrotoxic side effects. However, colistin, an antiquated class of antimicrobials, has resurfaced in clinical settings as a last-resort therapy for infections caused by multidrug-resistant and carbapenem-resistant bacteria. Colistin functions by targeting the outer membrane lipopolysaccharide (LPS) of gram-negative bacteria. Its binding to LPS enhances bacterial membrane permeability, resulting in the leakage of cytoplasmic contents and eventual cell death [12].
Recent escalation in the clinical usage of colistin and the growing demand for it have underscored the significance of colistin susceptibility testing. Studies have illuminated challenges in accurately determining colistin susceptibility. The European Committee on Antimicrobial Susceptibility Testing (EUCAST) advocates for the broth microdilution method using only sulfate salt, sans the addition of surfactants, for ascertaining colistin susceptibility, and discourages the use of disk diffusion and gradient tests. Moreover, the EUCAST recommends employing E. coli ATCC 25922 (susceptible) and mcr-1-positive E. coli NCTC 13846 (resistant) strains for quality control purposes. In our investigation, colistin resistance was assessed using the broth microdilution method in adherence to the EUCAST guidelines. The EUCAST established breakpoints for colistin for Enterobacterales isolates with a susceptible breakpoint of ≤2 mg/liter and a resistant breakpoint of >2 mg/liter [13].
Moreover, the escalating proliferation of resistance within Enterobacterales species presents a substantial concern, limiting therapeutic options. Isolates demonstrating carbapenem resistance exhibit in vitro resistance to all beta-lactam antibiotics and frequently manifest resistance to quinolones as well. Consequently, colistin is employed as a last-resort therapeutic option. Nevertheless, the extensive utilization of colistin in carbapenem-resistant enteric bacteria has precipitated critical levels of colistin resistance in Enterobacterales strains [14]. Colistin resistance can emerge through diverse mechanisms, including chromosomal mutations and plasmid-mediated resistance [4].
Various studies utilizing different reference methods worldwide have reported disparate results. In their study, Rojas et al. investigated colistin susceptibility among patients infected or colonized with K. pneumoniae between 2011 and 2014, identifying colistin resistance in 13% of 246 patients. In addition, it was observed that colistin-resistant K. pneumoniae infections were associated with high mortality rates [14].
In their study, Özkul Koçak et al. determined colistin resistance in 81 isolates using the microdilution method, finding a resistance rate of 39.5%. Furthermore, the colistin MIC value ranged from <0.0625 to >64 µg/ml using the broth microdilution method [15].
In our study, a total of 27 colistin-resistant strains were identified among 79 carbapenem-resistant Enterobacterales isolates. The most frequently isolated agent in colistin-resistant strains was K. pneumoniae at a rate of 66.7%, followed by P. mirabilis at 29.6% and E. coli at 3.7%. The colistin resistance rate among carbapenem-resistant strains in our study was found to be 30.4%. The colistin MIC value ranged from 4 to >16 µg/ml in strains tested using the broth microdilution method, and our colistin resistance rates were found to be consistent with the literature (Table 4).
Investigating genes responsible for resistance to different antibiotics in bacteria, including plasmid-mediated genes, such as mcr genes, is of paramount importance for public health [16]. At present, mcr genes have proliferated globally, imperiling the effectiveness of treatments against drug-resistant bacteria unresponsive to conventional antibiotics. The "One Health" paradigm recognizes the interconnectedness of human health with that of animals and the environment, particularly concerning antimicrobial resistance genes. Notably, mcr genes pose a significant risk to human health due to their widespread dissemination potential originating from animal breeding, production, international animal trade, and food consumption. Moreover, they pollute our environment through the intricate food chain. Research has elucidated that mcr genes can be sourced from diverse origins, spanning animals, food items, human reservoirs, and environmental habitats, involving a spectrum of pathogens like E. coli, K. pneumoniae, Salmonella enterica, Cronobacter sakazakii, Raoultella ornithinolytica, Aeromonas, and Enterobacter spp. Predominantly, isolates harboring mcr genes belong to the Enterobacterales isolates, prevalent in both animal and human populations [12]. In a retrospective analysis conducted by Shen and colleagues, it was revealed that the mcr-1 gene was present in E. coli strains derived from poultry in China as early as the 1980s. This implies a plausible correlation between the inception of mcr genes and the utilization of colistin within the poultry sector. The earliest detection of the mcr gene (specifically mcr-1) in humans occurred in a Shigella sonnei strain isolated from a pediatric patient hospitalized in Vietnam in 2008 [17,18]. Out of the 10 known variants of mcr genes discovered thus far (mcr-1 through mcr-10), mcr-1 is recognized as the predominant and extensively spread lineage, with mcr-3 following closely behind [19]. Since 2010, there has been a notable rise in mcr-positive isolates identified in both animal and human populations. While all mcr genes have been detected in animal specimens, mcr-6 and mcr-7 have yet to be reported in human samples [12].
The dissemination of mcr genes is possible across bacterial strains derived from animals, humans, and environmental sources. On the other hand, since only human samples were studied, positivity may not be detected at the rates stated in the literature. Multiple bacterial species might possess genetic elements spanning from mcr-1 to mcr-9, facilitating the transfer of these genes across diverse ecosystems, including terrestrial, aquatic, wildlife, and botanical habitats, via horizontal gene transfer mechanisms [20].
Numerous studies have introduced diverse methodologies for identifying the mcr gene family, encompassing standard PCR, multiplex PCR spanning from mcr-1 to mcr-9, SYBR green fluorescent qPCR, TaqMan fluorescent qPCR, and alternative approaches [21]. Loop-mediated isothermal amplification (LAMP) assays are accessible for swift identification of genes ranging from mcr-1 to mcr-5 in colistin-resistant bacteria. Notably, LAMP demonstrates heightened sensitivity and specificity relative to conventional PCR. Nevertheless, owing to the heterogeneity of mcr genes, a solitary LAMP assay might fail to capture all intended targets, thus falling short for nucleic acid detection. Instances involving specimens harboring multiple documented mcr genes may challenge the sensitivity and specificity of multiplex LAMP tests [22]. Hu et al. devised a Quad-PCR technique for expedited and dependable detection of prevalent mcr-1, mcr-3, mcr-8, and mcr-10 genes within clinical samples [23].
A recent investigation has introduced a swift, efficient, and precise technique by merging lateral flow dipstick (LFD) identification with recombinase polymerase amplification (RPA). Nevertheless, this approach exclusively targets the mcr-1 gene. However, research suggests that mcr-9 and mcr-10 are progressively surfacing in clinical cohorts and are proliferating globally [24]. These methodologies only capture a subset of the mcr genes, and detecting certain variants entails prolonged efforts. Hence, the development of swift detection methods encompassing the entire spectrum of reported mcr gene variants is imperative. In our study, we utilized a multiplex PCR kit to explore the presence of plasmid-borne gene sequences spanning from mcr-1 to mcr-8.
In their 2018 investigation conducted in Egypt, Zaki MES et al. included 50 Enterobacterales strains and examined the presence of the mcr-1 and mcr-2 genes in isolates exhibiting colistin resistance MIC >2 mg/L. Utilizing PCR analysis, they identified the mcr-1 gene in one E. coli and one K. pneumoniae strain [25].
Dalmolin et al., in their 2018 research conducted in Brazil, focused on studying the KPC-2 gene region in carbapenem-resistant strains. In addition, they investigated the plasmid mediated mcr-1 gene region associated with colistin resistance. They detected the mcr-1 gene in a K. pneumoniae strain. These findings underscore the potential emergence of K. pneumoniae isolates harboring both mcr-1 and KPC-2 genes as a significant challenge to antimicrobial therapy [26].
In contrast to E. coli, where mcr genes and variants have been identified with increasing frequency in isolates from human, animal, and environmental samples worldwide, K. pneumoniae has a lower frequency of mcr. Chen et al. screened genes from mcr-1 to mcr-8 in 47 colistin-resistant K. pneumonia isolates from 2010, 2012, 2014, and 2016 collected under the Taiwan Antimicrobial Resistance Surveillance Program and found no positivity. However, in their retrospective study, they identified mcr-1 in two isolates, mcr-3 in one, and mcr-8 in three among 24 K. pneumoniae isolates, from 2018 collection with colistin MIC values >2 mg/L. Subsequent Sanger sequencing revealed these variants as mcr-1.1, mcr-3.5, and mcr-8.2, respectively. Chen et al. documented that strains containing mcr genes were sourced from various clinical specimens collected from elderly inpatients across different medical facilities. They observed that while these isolates demonstrated resistance to multiple antibiotics, they retained susceptibility to carbapenems and amikacin. They indicated that plasmids carrying either mcr-1, mcr-3, or mcr-8 have spread to clinical K. pneumoniae isolates from different parts of Taiwan, requiring continuous monitoring due to their transferability, potential spread, and association with multiple antimicrobial resistance genes [27].
In our study, the presence of plasmid mediated mcr-1 to mcr-8 gene regions was investigated in 27 colistin-resistant Enterobacterales strains isolated from various clinical specimens. While the mcr-1 gene region was detected in the positive control isolate by real-time PCR, none of the mcr-1 to mcr-8 gene regions were identified in our study where we investigated the presence of plasmid-mediated genes using a multiplex PCR kit.
Limitations
The most significant limitation of our study is the low number of colistin-resistant Enterobacterales strains. The reduction in the number and diversity of inpatients during the pandemic period, when the study was planned, negatively impacted the agent profile isolated during that period.
Another limitation of the study is that although the successful detection of the positive control carrying the mcr-1 gene with the multiplex PCR kit used indicates that there is no study-related problem, demonstrating that the positive controls of different mcr genes also work would enhance the meaningfulness of the results. While the mcr-1 gene region was detected in the positive control isolate by real-time PCR, none of the mcr-1 to mcr-8 gene regions were identified in our study where we investigated the presence of plasmid-mediated genes using a multiplex PCR kit. As a consequence of the failure to detect positivity, it was not possible to proceed with the planned advanced molecular examinations, which constituted another key element of the study.
Conclusions
The development of resistance to colistin, which is used as a last resort, is undesirable where carbapenem resistance among gram negative bacteria is increasingly prevalent. The multiplex PCR method can be used to provide information on the underlying resistance mechanism and to reveal the presence of potentially known mcr genes in isolates that are resistant or borderline susceptible after MIC determination by standard broth microdilution. Although the multiplex PCR method cannot be used to determine which gene is specifically present, it provides valuable information for research and epidemiologic surveillance. The multiplex PCR results will guide the selection of isolates for further studies based on genomic epidemiology, focusing on the characterization of mcr genes, their mobilization mechanisms and the plasmids they harbor.
In summary, the multiplex PCR method, which rapidly detects the mcr-1-8 genes present in Enterobacteriaceae, revealed the absence of these genes in clinical isolates exhibiting colistin resistance. At the current stage, it can be reasonably concluded that the emergence of colistin resistance in our region is not attributable to mcr-1-8 genes. It is also necessary to investigate non-mcr mechanisms in colistin-resistant isolates in our region.
Acknowledgments
This study was supported by Afyonkarahisar Health Sciences University Scientific Research Projects Coordination Unit Project number 21.GENEL.004.
Disclosures
Human subjects: All authors have confirmed that this study did not involve human participants or tissue.
Animal subjects: All authors have confirmed that this study did not involve animal subjects or tissue.
Conflicts of interest: In compliance with the ICMJE uniform disclosure form, all authors declare the following:
Payment/services info: All authors have declared that no financial support was received from any organization for the submitted work.
Financial relationships: All authors have declared that they have no financial relationships at present or within the previous three years with any organizations that might have an interest in the submitted work.
Other relationships: All authors have declared that there are no other relationships or activities that could appear to have influenced the submitted work.
Author Contributions
Concept and design: Melahat Gürbüz, Emek Türkekul Şen
Acquisition, analysis, or interpretation of data: Melahat Gürbüz, Merih Şimşek, Cengiz Demir
Drafting of the manuscript: Melahat Gürbüz, Cengiz Demir
Critical review of the manuscript for important intellectual content: Melahat Gürbüz, Emek Türkekul Şen, Merih Şimşek
Supervision: Melahat Gürbüz, Cengiz Demir
References
- 1.How to: screening for mcr-mediated resistance to colistin. Smelikova E, Tkadlec J, Krutova M. Clin Microbiol Infect. 2022;28:43–50. doi: 10.1016/j.cmi.2021.09.009. [DOI] [PubMed] [Google Scholar]
- 2.Nonribosomal antibacterial peptides that target multidrug-resistant bacteria. Liu Y, Ding S, Shen J, Zhu K. Nat Prod Rep. 2019;36:573–592. doi: 10.1039/c8np00031j. [DOI] [PubMed] [Google Scholar]
- 3.Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible salmonella enterica serotype typhimurium isolate. Carroll LM, Gaballa A, Guldimann C, Sullivan G, Henderson LO, Wiedmann M. mBio. 2019;10 doi: 10.1128/mBio.00853-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Liu YY, Wang Y, Walsh TR, et al. Lancet Infect Dis. 2016;16:161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
- 5.Technologies to address antimicrobial resistance. Baker SJ, Payne DJ, Rappuoli R, De Gregorio E. Proc Natl Acad Sci U S A. 2018;115:12887–12895. doi: 10.1073/pnas.1717160115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Antimicrobial resistance profiles and co-existence of multiple antimicrobial resistance genes in mcr-harbouring colistin-resistant enterobacteriaceae isolates recovered from poultry and poultry meats in Malaysia. Karim MR, Zakaria Z, Hassan L, Mohd Faiz N, Ahmad NI. Antibiotics (Basel) 2023;12 doi: 10.3390/antibiotics12061060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Emergence of a clinical isolate of E. coil ST297 co-carrying bla(NDM-13) and mcr-1.1 in China. Zhang X, Peng L, Ke Y, et al. J Infect Public Health. 2023;16:1813–1820. doi: 10.1016/j.jiph.2023.09.007. [DOI] [PubMed] [Google Scholar]
- 8.A fatal outbreak of neonatal sepsis caused by mcr-10-carrying Enterobacter kobei in a tertiary care hospital in Nepal. Manandhar S, Nguyen Q, Pham DT, et al. J Hosp Infect. 2022;125:60–66. doi: 10.1016/j.jhin.2022.03.015. [DOI] [PubMed] [Google Scholar]
- 9.Colistin-resistance gene mcr in clinical carbapenem-resistant Enterobacteriaceae strains in China, 2014-2019. Huang H, Dong N, Shu L, et al. Emerg Microbes Infect. 2020;9:237–245. doi: 10.1080/22221751.2020.1717380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 11.0. [ Apr; 2023 ]. 2021. https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_11.0_Breakpoint_Tables.pdf https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_11.0_Breakpoint_Tables.pdf
- 11.Synergistic and antagonistic effects of metal nanoparticles in combination with antibiotics against some reference strains of pathogenic microorganisms. Abo-Shama UH, El-Gendy H, Mousa WS, Hamouda RA, Yousuf WE, Hetta HF, Abdeen EE. Infect Drug Resist. 2020;13:351–362. doi: 10.2147/IDR.S234425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Prevalence and transmission of mobilized colistin resistance (mcr) gene in bacteria common to animals and humans. Luo Q, Wang Y, Xiao Y. https://doi.org/10.1016/j.bsheal.2020.05.001 Biosaf Health. 2020;2:71–78. [Google Scholar]
- 13.The European Committee on Antimicrobial Susceptibility Testing Routine internal quality control as recommended by EUCAST. [ Oct; 2023 ]. 2017. http://www.eucast.org http://www.eucast.org
- 14.Colistin resistance in carbapenem-resistant Klebsiella pneumoniae: laboratory detection and impact on mortality. Rojas LJ, Salim M, Cober E, et al. Clin Infect Dis. 2017;64:711–718. doi: 10.1093/cid/ciw805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Colistin resistance in carbapenem-resistant Klebsiella pneumoniae clinical isolates [Article in Turkish] Özkul Koçak C, Hazırolan G. Türk Mikrobiyoloji Cem Derg. 2019;49:17–23. [Google Scholar]
- 16.Antibiogram and genetic characterization of carbapenem-resistant gram-negative pathogens incriminated in healthcare-associated infections. Makharita RR, El-Kholy I, Hetta HF, Abdelaziz MH, Hagagy FI, Ahmed AA, Algammal AM. Infect Drug Resist. 2020;13:3991–4002. doi: 10.2147/IDR.S276975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Inducible colistin resistance via a disrupted plasmid-borne mcr-1 gene in a 2008 Vietnamese Shigella sonnei isolate. Pham Thanh D, Thanh Tuyen H, Nguyen Thi Nguyen T, et al. J Antimicrob Chemother. 2016;71:2314–2317. doi: 10.1093/jac/dkw173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Early emergence of mcr-1 in Escherichia coli from food-producing animals. Shen Z, Wang Y, Shen Y, Shen J, Wu C. Lancet Infect Dis. 2016;16:293. doi: 10.1016/S1473-3099(16)00061-X. [DOI] [PubMed] [Google Scholar]
- 19.A new variant of the colistin resistance gene MCR-1 with co-resistance to β-lactam antibiotics reveals a potential novel antimicrobial peptide. Liang L, Zhong LL, Wang L, et al. PLoS Biol. 2023;21:0. doi: 10.1371/journal.pbio.3002433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Occurrence and characteristics of mobile colistin resistance (mcr) gene-containing isolates from the environment: a review. Anyanwu MU, Jaja IF, Nwobi OC. Int J Environ Res Public Health. 2020;17 doi: 10.3390/ijerph17031028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.A multiplex TaqMan real-time PCR assays for the rapid detection of mobile colistin resistance (mcr-1 to mcr-10) genes. Gong X, Yang G, Liu W, et al. Front Microbiol. 2024;15:1279186. doi: 10.3389/fmicb.2024.1279186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Multiplex loop-mediated isothermal amplification (multi-LAMP) assay for rapid detection of mcr-1 to mcr-5 in colistin-resistant bacteria. Zhong LL, Zhou Q, Tan CY, et al. Infect Drug Resist. 2019;12:1877–1887. doi: 10.2147/IDR.S210226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Novel Quadruplex PCR for detecting and genotyping mobile colistin resistance genes in human samples. Hu S, Lv Z, Wang Y, Shen J, Ke Y. Diagn Microbiol Infect Dis. 2021;101:115419. doi: 10.1016/j.diagmicrobio.2021.115419. [DOI] [PubMed] [Google Scholar]
- 24.Epidemiology of mobile colistin resistance genes mcr-1 to mcr-9. Ling Z, Yin W, Shen Z, Wang Y, Shen J, Walsh TR. J Antimicrob Chemother. 2020;75:3087–3095. doi: 10.1093/jac/dkaa205. [DOI] [PubMed] [Google Scholar]
- 25.Molecular study of colistin resistant clinical isolates of Enterobacteriaceae species. Zaki ME, ElKheir NA, Mofreh M. J Clin Mol Med. 2018;1.1:1–4. [Google Scholar]
- 26.Acquisition of the mcr-1 gene by a high-risk clone of KPC-2-producing Klebsiella pneumoniae ST437/CC258, Brazil. Dalmolin TV, Martins AF, Zavascki AP, de Lima-Morales D, Barth AL. Diagn Microbiol Infect Dis. 2018;90:132–133. doi: 10.1016/j.diagmicrobio.2017.09.016. [DOI] [PubMed] [Google Scholar]
- 27.Emergence of mcr-1, mcr-3 and mcr-8 in clinical Klebsiella pneumoniae isolates in Taiwan. Chen FJ, Lauderdale TL, Huang WC, Shiau YR, Wang HY, Kuo SC. Clin Microbiol Infect. 2021;27:305–307. doi: 10.1016/j.cmi.2020.07.043. [DOI] [PubMed] [Google Scholar]