Skip to main content
NCBI home page
Microbial Biotechnology logoLink to Microbial Biotechnology
. 2024 Jul 2;17(7):e14518. doi: 10.1111/1751-7915.14518

Surface display of the COE antigen of porcine epidemic diarrhoea virus on Bacillus subtilis spores

Yanhong Tian 1,2, Zhichao Wang 1,2, Ju Sun 1,2, Jiayun Gu 1,2, Xiaojuan Xu 1,2, Xuwang Cai 1,2,✉
PMCID: PMC11218686  PMID: 38953907

Abstract

Porcine epidemic diarrhoea virus (PEDV) infects pigs of all ages by invading small intestine, causing acute diarrhoea, vomiting, and dehydration with high morbidity and mortality among newborn piglets. However, current PEDV vaccines are not effective to protect the pigs from field epidemic strains because of poor mucosal immune response and strain variation. Therefore, it is indispensable to develop a novel oral vaccine based on epidemic strains. Bacillus subtilis spores are attractive delivery vehicles for oral vaccination on account of the safety, high stability, and low cost. In this study, a chimeric gene CotC‐Linker‐COE (CLE), comprising of the B. subtilis spore coat gene cotC fused to the core neutralizing epitope CO‐26 K equivalent (COE) of the epidemic strain PEDV‐AJ1102 spike protein gene, was constructed. Then recombinant B. subtilis displaying the CLE on the spore surface was developed by homologous recombination. Mice were immunized by oral route with B. subtilis 168‐CLE, B. subtilis 168, or phosphate‐buffered saline (PBS) as control. Results showed that the IgG antibodies and cytokine (IL‐4, IFN‐γ) levels in the B. subtilis 168‐CLE group were significantly higher than the control groups. This study demonstrates that B. subtilis 168‐CLE can generate specific systemic immune and mucosal immune responses and is a potential vaccine candidate against PEDV infection.

Porcine epidemic diarrhoea virus infects pigs of all ages, causing significant economic losses to the swine industry worldwide. This study constructed a recombinant B. subtilis 168‐CLE displaying the PEDV‐COE on the spore surface. It can generate specific systemic immune and mucosal immune responses and is a potential vaccine candidate against PEDV infection.

graphic file with name MBT2-17-e14518-g004.jpg

INTRODUCTION

Diarrhoea is a common concern in pigs, causing significant economic losses to the swine industry worldwide. The etiological agents of diarrhoea are varied, and the most common causal agent is the porcine epidemic diarrhoea virus (PEDV) (Zhang et al., 2013, 2019), resulting in acute diarrhoea, vomiting, dehydration, and high mortality in newborn piglets (Jung et al., 2020). Classical PEDV was first discovered in England (Wood, 1977) and Belgium (Pensaert & de Bouck, 1978) in the late 1970s, and it later spread to Asia (Dai et al., 2018; Sun et al., 2016). In late 2010, the re‐emergence of highly virulent PEDV caused large outbreaks in which suckling piglets had a high mortality (Sun et al., 2012). PEDV is transmitted primarily via faecal‐oral routes (Alonso et al., 2014), and the excrement and/or vomit of sick pigs, as well as transport vehicles (Lowe et al., 2014) and feed (Dee et al., 2014) may serve as the transmission vectors. Therefore, it is easy to cause an epidemic spread in the whole farm.

PEDV is a member of the genus Alphacoronavirus, family Coronaviridae, order Nidovirales, and has a single‐stranded positive‐sense RNA genome of about 28 kb that codes for 16 nonstructural proteins (Nsp1–Nsp16), an accessory protein ORF3, and four structural proteins known as spike (S), envelope (E), membrane (M), and nucleocapsid (N) proteins (Kocherhans et al., 2001). The S protein is located on the outer surface of the virion, forms trimers (Gallagher & Buchmeier, 2001), and consists of two subunits: S1 [amino acids (aa) 1–726 based on PEDV CV777] and S2 (aa 727–1386) (Jung et al., 2020). The N‐terminal region of the S1 domain recognizes the pAPN receptor (Li et al., 2016, 2017) and is often considered as a vaccine antigen (Makadiya et al., 2016; Thavorasak et al., 2022). Previous reports have demonstrated that the CO‐26K equivalent (COE) region (aa 499–638) of the PEDV spike protein contains the main neutralizing epitope of the virus (Bae et al., 2003; Chang et al., 2002). Recently, the use of biological vectors to express or display COE to develop a PEDV vaccine is an area of interest (Hou et al., 2018; Wang et al., 2017, 2018, 2019; Yu et al., 2017).

Epidemic PEDV strains have high intestinal pathogenicity and can infect the whole intestinal villus epithelial cells of piglets, causing the damage to intestinal epithelium barrier (Jung et al., 2015). Therefore, vaccines that trigger effective mucosal immune response can defend against PEDV infection (Hou et al., 2018). However, parenterally administered live attenuated/inactivated vaccines do not induce effective mucosal immunity against PEDV (Song et al., 2007, 2015), and commercialized PEDV vaccines derived from classical PEDV are ineffective against epidemic strains (Tseng et al., 2021). In addition, the way of injection immunization increases pain associated with vaccination (Rosales‐Mendoza & Angulo, 2015), which raises the possibility of diarrhoea in pigs. As a result, it is necessary to develop a new oral, needle‐free vaccine based on epidemic PEDV strains.

It is often difficult to develop an effective oral vaccine due to unfavourable physicochemical properties of protein antigens, which usually degrade in the gastrointestinal tract and cause poor transport across the intestinal tract (Rosales‐Mendoza & Angulo, 2015). Fortunately, B. subtilis spores are apposite delivery vehicles to protect antigens from extreme environment in gut. B. subtilis spores offer several advantages in anchoring heterologous proteins to develop an oral vaccine: (i) spores are safe because B. subtilis is used as a probiotic for both human and animal consumption and has been granted generally recognized as safe (GRAS) status by the United States Food and Drug Administration (Rosales‐Mendoza et al., 2016); (ii) the strong resistance of the spores improves the stability of the fused protein in complex environments (Chen et al., 2015); (iii) spores can be produced at low cost and do not require refrigerated storage and transport (Rosales‐Mendoza & Angulo, 2015); (iv) needle‐free vaccines are convenient, painless and can boost immune responses on the mucosa as well as the systemic levels (Belyakov & Ahlers, 2009); (v) In light of the poor immunogenicity of some orally administered antigens, it is of special importance that spores exert adjuvant activity (Barnes et al., 2007; Trombert, 2015). In addition, B. subtilis has no conspicuous codon bias.

In this study, we constructed a recombinant B. subtilis which displays the PEDV COE protein on the surface of its spores, verified by Western blot with anti‐His antibodies and anti‐spike protein of PEDV monoclonal antibodies. Our results showed that recombinant B. subtilis can effectively stimulate humoral and adaptive immunity to generate specific antibodies and cytokines secretion in mice, indicating the vaccine potential of recombinant strains.

EXPERIMENTAL PROCEDURES

Strains, plasmids, PEDV cDNA and primers

B. subtilis 168 strain was kindly provided by Prof. Wubei Dong at Huazhong Agricultural University. PEDV AJ1102 cDNA and monoclonal antibody against PEDV spike protein (from mouse) were kindly provided by Prof. Liurong Fang (College of Veterinary Medicine, Huazhong Agricultural University, China). Recombinant strain B. subtilis 168‐CLE was constructed in the present study and was a derivative of strain B. subtilis 168. Plasmid pDG364 was purchased from Zeqiong Biotechnology Co., Ltd. (Changsha, Hunan, China). The PEDV AJ1102 sequence was obtained from GenBank (No. JX188454.1). Primers used in this study are shown in Table 1.

TABLE 1.

Gene‐specific primers used in this study.

Primers Sequence (5′–3′) Description
CotC‐F CGGGATCCTGTAGGATAAATCGTTTGGGCC To amplify cotC from the genome of B. subtilis 168
CotC‐R TTTGCTGCTGCTTCTCCTCCTCCGTAGTGTTTTTTATGCTTTTTATACTC
COE‐F GAGAAGCAGCAGCAAAAGGAGGAGGAGTTACTTTGCCATCATTTAATGAT To amplify COE from the PEDV AJ1102 cDNA
COE‐R CGGAATTCTCAGTGATGATGATGATGATGAACGTCCGTAACACCT
CotC‐F2 ATGGGTTATTACAAAAAATACAAAGAAGAG To detect whether the CLE was transcribed successfully
COE‐R2 TCAGTGATGATGATGATGATGAACG
JD‐F AAATTGGCAACCGTTACTTAGG To identify whether the CLE was cloned into pDG364
JD‐R CTTACTTGTCTGCTTTCTTCATTAG
ycgB‐F ATTGATTTGTATTCACTCTGC To verify the presence of a double‐crossover event
ictE‐R CATTGCTTTTTCTTTATTTACATC
Open in a new tab

Note: The underlined letters indicate the introduction of restriction sites.

Construction of recombinant plasmid pDG364‐CLE and recombinant B. subtilis

CLE was fused by cotC amplified from B. subtilis 168 genome using CotC‐F/R as primers and COE amplified from PEDV AJ1102 cDNA using COE‐F/R as primers. Then CLE was cloned into the BamHI/EcoRI digested pDG364, yielding plasmid pDG364‐CLE (Figure 1A), which was identified by polymerase chain reaction (PCR) using JD‐F/R as primers. Finally, pDG364‐CLE linearized by digestion with SacI was transformed into B. subtilis 168 through the two‐step method (SpI/SpII).

FIGURE 1.

FIGURE 1

Open in a new tab

The constitution of pDG364‐CLE plasmid and recombinant Bacillus subtilis. (A) Schematic diagram showing the construction of CLE and recombinant plasmid pDG364‐CLE. CLE was constructed by fusing cotC with its natural promoter amplified from B. subtilis 168 genome and COE amplified from PEDV AJ1102 cDNA. The linker is in the middle and the His‐tag is in the 3′ end. CLE was ligated into the pDG364 via BamHI and EcoRI. (B) Identification of pDG364‐CLE by PCR. The PCR production of pDG364 is 614 bp and the production of pDG364‐CLE is 1453 bp. (C) Schematic representation of the construction of the recombinant B. subtilis. CLE and chloramphenicol resistance gene cat were integrated into the amylase gene amyE loci by homologous recombination, yielding B. s‐168‐CLE. (D) Identification of B. s‐168‐CLE by PCR. PCR production of B. s‐168 is 2473 bp and production of B. s‐168‐CLE is 4361 bp. The negative controls in B and D are sterile water. Amylase activity analysis before (E) and after (F) being stained by iodine. Because B. s‐168‐CLE no longer secretes amylase, the medium under its colonies on the LB plate containing 1% soluble starch turned blue after stained by iodine. On the contrary, there are transparent circles around B. s‐168 colonies.

Preparation of recombinant spores and RNA extraction

B. subtilis 168 and recombinant B. subtilis 168‐CLE were cultivated in Difco sporulation medium (DSM) for 48 h at 37°C to induce sporulation by the depletion method as mentioned before (Nicholson & Setlow, 1990). When cultured for 24 h, 1 mL bacterial liquid was separated to extract RNA using the HiPure Bacterial RNA Kit (Magen, Shanghai, China) to detect CLE transcription. Sporulation was verified by microscopy and spores were collected and purified as described elsewhere (Nicholson & Setlow, 1990). Briefly, pellets were washed with 1 M KC1, 0.5 M NaCl and incubated at 37°C for 1 h in quarter volume of 50 mM Tris–HCl (pH 7.2) containing 50 μg/mL lysozyme to kill the residual propagules. After centrifugation (10,000 × g, 10 min), spores were washed with 1 M NaCl, sterile deionized water, 0.05% sodium dodecyl sulfate (SDS), TEP buffer (50 mM Tris–HCl buffer that contains 10 mM ethylenediaminetetraacetic acid (EDTA), 2 mM phenylmethanesulfonyl fluoride (PMSF), pH 7.2), and three times of sterile deionized water separately. Finally, spores were counted and stored in deionized water at 4°C.

Indirect immunofluorescence

Immunofluorescence microscopy was used to determine whether CLE was successfully displayed on the surface of purified spores. Spores were washed three times with PBS buffer and blocked with 5% bovine serum albumin (BSA) for 12 h at 4°C. Phosphate‐buffered saline with Tween 20 (PBST) buffer was used to wash the spores five times, followed by overnight incubation with rabbit anti‐His‐Tag pAb (AE068) (ABclonal, Wuhan, Hubei, China) (1:50) at 4°C. Then the spores were washed five times and incubated with Cy3 goat anti‐rabbit IgG (H + L) (AS007) (1:100) for 2 h at 37°C in the dark. After five washes, the spores were resuspended in PBS and air‐dried on glass slides. At last, samples were photographed under a positive fluorescence microscope (Olympus BX53, Tokyo, Japan) in dark. Images were edited with Olympus OlyVIA.

Spore coats extraction and Western blot analysis

Spore coats were extracted from 5 × 109 spores/mL using an ST solution (1% (w/v) SDS and 50 mM dithiothreitol) incubating at 70°C for 30 min. Then the supernatant fluid was saved after centrifugation for analysis. Spore coat proteins were examined by a 12.5% sodium dodecyl sulfate polyacrylamide gel and Western blot with rabbit anti‐His antibody (1:5000) (ABclonal, Wuhan, Hubei, China) or monoclonal antibody (1:1000) against PEDV spike protein.

Oral immunization of mice and sample collection

Specific pathogen‐free female BALB/c mice (6 weeks old) were utilized to examine immune responses and produce antibodies. Schematic of the immunization and sample collection is shown in Figure 3A. In a nutshell, 45 mice were separated into three groups randomly, with each group including 15 mice. Group A and group B were first dosed on days 1–3 and were boosted on days 14–16 and 28–30 with a dose of 5 × 109 B. subtilis 168 spores or B. subtilis 168‐CLE spores (0.1 mL), respectively. Group C was orally administered fresh phosphate‐buffered saline (PBS) with an equal volume. The spores have been purified as described above. All immunizations were oral gavage using a metal needle.

FIGURE 3.

FIGURE 3

Open in a new tab

Specific antibodies and cytokine responses in immunized mice. (A) Schematic of the immunization and sample collection. Red arrows indicate the time points of prime and boost oral immunization. Black arrows indicate the time points of collecting serum, intestinal contents and spleen samples. The experiment lasted from day 0 to day 36. Detection of specific IgG (B) and IgA (C) antibodies in sera and intestinal contents from spore‐treated or control mice by ELISA assay. (D) Determination of cytokine responses in spleen lymphocytes of immunized mice on day 36. ****p < 0.0001, **p < 0.005. n = 3. Data are compared by two‐way ANOVA using GraphPad Prism ver. 8.01 (San Diego, CA, USA).

As shown in Figure 3A, specimen collection was performed on days 0, 17, 31, and 36, and three mice were randomly selected at each time point. Blood was collected from the venous sinus, centrifuged, and separated, and the sera were stored at −20°C. After collecting the blood samples, mice were euthanized and the intestinal contents were squeezed from small intestinal tract and added PBS containing 1 mM PMSF and 1% BSA at a rate of 0.1 g/0.3 mL. After quiescence for 16 h at 4°C and centrifugation for 15 min (12,000 × g, 4°C), the supernatant of mixture was collected and stored at −20°C for ELISA. Spleen was collected aseptically on days 0 and 36 after the mice were euthanized and sterilized by alcohol soaking for 5 min. After rinsing with PBS and RPMI‐1640 medium, spleen was grinded and resuspended in NH4Cl (8.3 g/L) solution for at least 5 min to lyse erythrocyte. Then spleen lymphocytes were centrifuged and resuspended in RPMI‐1640 containing 20% fetal bovine serum (FBS), 5 × 106 cells/mL.

The animal study was reviewed and consented to by the Ethics Committee of the Faculty of Veterinary Medicine of the Huazhong Agricultural University (HZAUMO‐2023‐0033).

Serum IgG and intestinal content IgA detection

ELISA was carried out to assess the production of IgG and IgA against recombinant B. subtilis 168‐CLE displaying COE on the surface. Briefly, purified COE protein was coated on the 96‐well plates (1 μg/well) via carbonate buffer solution (CBS) buffer (100 μL) overnight at 4°C. After washing with PBST, the wells were blocked with 5% skim milk at 37°C for 2 h. After washing the plates three times with PBST, the sera or the supernatant of intestinal contents mixture (diluted 1:25 in PBS) was added and incubated at 37°C for 1 h. Next, plates were washed three times and treated with horseradish peroxidase (HRP)‐conjugated goat anti‐mouse IgG (ABclonal, Wuhan, Hubei, China) or IgA (Proteintech, Rosemont, IL, USA) antibodies in PBS at 37°C for 30 min. Subsequently, plates were washed and developed using tetramethyl benzidine (TMB) substrate at room temperature in the dark. After stopping of reactions, optical densities (ODs) were read at 630 nm.

Cytokine responses detection

Lymphocytes were seeded in 96‐well plates (5 × 105 cells/well, 100 μL) and Concanavalin A (ConA) was added to lymphocyte wells and blank control wells (medium) to a final concentration of 10 μg/mL. Negative control wells (lymphocytes) were added with an equal volume of fresh PBS. After culturing with 5% (vol/vol) CO2 at 37°C for 72 h, the supernatant was separated for cytokine detection. ELISA kit (Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) was used to measure the levels of cytokines IL‐4 and IFN‐γ according to the manufacturer's instructions.

Statistical analysis

Data were compared by two‐way ANOVA using GraphPad Prism ver. 8.01 (San Diego, CA, USA). *p < 0.05 was considered statistically significant.

RESULTS

Construction of pDG364‐CLE and recombinant B. subtilis

To obtain recombinant B. subtilis surface displaying COE, a coat protein of spore surface, CotC, was used as a carrier to locate COE on spore surface. As shown in Figure 1A, cotC with its natural B. subtilis promoter and COE were fused, yielding CotC‐Linker‐COE (CLE) with linker peptide gene (5′‐GGAGGAGGAGAAGCAGCAGCAAAAGGAGGAGGA‐3′) between cotC and COE to guarantee correct folding of either protein and with His‐tag in the end. Figure 1B shows that CLE had been inserted into pDG364 successfully.

Stable constructs of B. subtilis expressing COE were created by integration of the CLE fragment coding sequence into the bacterial chromosomal amyE loci by homologous recombination (Figure 1C). Recombinant B. subtilis can grow on the Luria‐Bertani (LB) medium supplemented with 5 μg/mL chloramphenicol. The presence of a double‐crossover event was verified by PCR using primers ycgB‐F/ictE‐R (Figure 1D), and the absence of α‐amylase activity was observed by a starch‐plate assay (Figure 1E,F).

RT‐PCR analysis of CLE transcribed in B. subtilis

To detect whether the CLE was transcribed successfully, B. subtilis 168‐CLE RNA was extracted and reverse transcribed to cDNA after 24 h of growth when sporulation was in process. Primers CotC‐F2/COE‐R2 were used to amplify CLE. As shown in Figure 2A, CLE (672 bp) could be amplified from B. subtilis 168‐CLE cDNA likewise from B. subtilis 168‐CLE genome, illustrating that CLE was transcribed successfully.

FIGURE 2.

FIGURE 2

Open in a new tab

Identification of CLE expression on Bacillus subtilis 168‐CLE spores. (A) RT‐PCR detection of CLE transcription. CLE (672 bp) can be amplified from B. s‐168‐CLE cDNA and the genome (positive control). B. s‐168‐CLE RNA as a template was used as a negative control to prove no genome remains in the extracted RNA. Western blot analysis of CLE with anti‐His antibody (1:5000) (B) and monoclonal antibody (1:1000) against PEDV spike protein (C). B. s‐168 was the negative control. (D) Indirect immunofluorescence assay of the sporulated B. s‐168‐CLE and B. s‐168. All images are magnified at 10 × 100. Scale bars: 5 μm. The results show that only the B. s‐168‐CLE spores emits fluorescent signal which identified as orange‐red.

Western blot analysis of CLE expressed on B. subtilis spores

The coat proteins of B. subtilis 168‐CLE spores were extracted and probed with anti‐His antibody (1:5000) (Figure 2B) or monoclonal antibody (1:1000) against PEDV spike protein (Figure 2C) to confirm expression of the CLE protein via Western blot. CLE revealed a band of about 25 kDa, indicating that CLE was expressed on the surface of the B. subtilis 168‐CLE spores. The fusion protein on the spore surface has no detrimental effect on the spore heat resistance (Figure S1).

Immunofluorescence test of CLE displayed on the spore surface

Immunofluorescence was utilized to further verify the display of CLE on the spore surface. The results revealed an obvious fluorescent signal, which was identified as displaying orange‐red around purified B. subtilis 168‐CLE spores, while the wild type was negative (Figure 2D).

Specific IgG and IgA antibodies produced in immunized mice

Specific IgG and IgA antibodies produced in immunized mice were detected by enzyme‐linked immunosorbent assay (ELISA) to determine whether immunized mice develop humoral and mucosal immunity. Compared to the phosphate‐buffered saline (PBS) group and the B. subtilis 168 group, significant (p < 0.05) levels of IgG and IgA were detected in the sera and intestinal contents of animals dosed with B. subtilis 168‐CLE spores on day 17, respectively. Meanwhile, levels of IgG and IgA in the B. subtilis 168‐CLE group gradually increased from day 0 to day 36 and were significantly (p < 0.0001) higher than the control groups on day 31 and day 36 (Figure 3B,C). All the above results showed that COE displayed on the surface of B. subtilis 168‐CLE spores can stimulate humoral and mucosal immunity in mice and boost immunization can amplify this effect.

Cytokine responses in immunized mice

The humoral and cellular immune responses induced by B. subtilis 168‐CLE were evaluated by measuring IL‐4 and IFN‐γ levels. As shown in Figure 3D, the concentration of IL‐4 and IFN‐γ in the B. subtilis 168‐CLE group was significantly (p < 0.0001) higher than that in the B. subtilis 168 and the PBS groups, which revealed that CLE on the surface of B. subtilis 168‐CLE could stimulate cytokines release to mediate intercellular communication of immune system. Meanwhile, the levels of IL‐4 and IFN‐γ of B. subtilis 168 group were significantly higher (p < 0.005) than the PBS group, indicating that B. subtilis 168 spores possess adjuvant properties.

DISCUSSION

The porcine epidemic diarrhoea virus severely reduces swine productivity by causing acute diarrhoea, vomiting, dehydration, and high mortality in newborn piglets (Jung et al., 2020). PEDs must be controlled and eradicated, however, effective and secure vaccinations are currently lacking (Hou et al., 2019). PEDV primarily targets small intestine. Infected small intestinal villous enterocytes suffer acute necrosis and exfoliation, resulting in marked villous atrophy or fusion (Li et al., 2018). Induction of localized immune responses is essential for protecting against these mucosal infections. Localized secretory IgA (sIgA) antibodies prevent attachment and invasion by infectious agents and neutralize toxins (Chattha et al., 2015). PEDV traditional vaccines in China are mainly whole virus vaccines such as inactivated vaccines and live attenuated vaccines (Li et al., 2020). Nevertheless, these vaccines cannot effectively stimulate mucosal immunity against PEDV infection. Therefore, it would be of great significance to develop new vaccines that induce a mucosal immune response against PEDV, particularly if they are safe, easy to use, inexpensive, and effective (Yu et al., 2017). It is enteric vaccines that induce mucosal cellular immune responses to control intracellular viral infections (Chattha et al., 2015). However, after enzymatic or chemical degradation in the gastrointestinal tract, protein antigens delivered by oral immunization are poorly immunogenic (Dai et al., 2018). It is interesting to note that B. subtilis, a Gram‐positive bacterium, has a special resistance to severe heat, drying, and exposure to solvents and other toxic chemicals (Nicholson et al., 2000). Due to their special properties, spores are a desirable carrier for delivering bioactive molecules or heterologous antigens to harsh conditions such as the gastrointestinal system (Mauriello et al., 2004).

In this study, we constructed a recombinant B. subtilis displaying PEDV‐AJ1102 COE region of spike protein on the spore surface, which could be used as a good candidate oral vaccine against PEDV infection. PEDV strain AJ1102 was isolated from a suckling piglet with acute diarrhoea in 2011 and was identified as the epidemic PEDV in China based on whole‐genome sequencing (Bi et al., 2012). In addition, a bivalent vaccine developed from TGEV WH‐1 and PEDV AJ1102 has been launched on the market (http://www.kqbio.com/view/130.html).

Gut‐associated lymphoid tissue (GALT), the body's biggest immunological tissue, is constantly in touch with a wide range of intestinal microbes (both symbiotic and pathogenic), as well as food antigens (Chattha et al., 2015). There are several types of organized lymphoid structures in GALTs, including Peyer's patches (PPs) and isolated lymphoid tissue (ILF), which are rich in B cells and T cells and are important in the initiation and induction of intestinal IgA responses respectively (Kunisawa et al., 2012). Besides IgA, serum‐derived IgG can also play an important role in immune defence and prevent systemic spread of the pathogens (Holmgren & Czerkinsky, 2005). As a result, intestinal IgA and serum IgG of immunized mice were also detected. The results showed that the IgA and IgG levels of the B. subtilis 168‐CLE group were significantly (p < 0.0001) higher than other groups, suggesting that COE displayed on the spore surface exhibits the capacity of stimulating mucosal immunity and B cell to produce and secrete more antigen‐specific antibodies, based on the immunogenicity of COE and its resistance to the gut environment. The antibodies produced against COE in the B. subtilis 168 vaccinated animals represent background.

In view of the production of specific cytokines, there are two major subsets of T‐helper cells, type I helper T (Th1) cells and type II helper T (Th2) cells (Hou et al., 2018). IL‐4, which is secreted by Th2 cells, can stimulate and activate B and T lymphocyte proliferation (Crotty, 2015), and the differentiation of CD4+ T cells into Th2 cells (Zhou et al., 2009). IFN‐γ produced by Th1 cells and NK cells is an important activator of macrophages and can prime the maturity of monocytes into macrophages (Wynn, 2015). IFN‐γ also influences B cells during class switching to produce targeted antibodies (Fang et al., 2020). Therefore, IL‐4 and IFN‐γ can reflect the situation of innate and adaptive immune responses. In this study, IL‐4 and IFN‐γ in the mice immunized with B. subtilis 168‐CLE were significantly (p < 0.0001) higher than that of the B. subtilis 168 and the PBS groups, which is consistent with other studies (Wang et al., 2017, 2018). Previous data suggest that B. subtilis spores can itself act as an adjuvant, increasing antibody and CD4+ and CD8+ T cell responses to antigens (Barnes et al., 2007). In this study, the IL‐4 and IFN‐γ of the B. subtilis 168 group were significantly higher (p < 0.005) than those of the PBS group, which also suggests the adjuvant properties of the spores.

Collectively, our results demonstrate that B. subtilis 168‐CLE can generate specific systemic and mucosal immune responses that could be a promising candidate vaccine against PEDV infection.

AUTHOR CONTRIBUTIONS

Yanhong Tian: Data curation; formal analysis; investigation; methodology; project administration; software; writing – original draft; writing – review and editing. Zhichao Wang: Data curation; software; validation; visualization; writing – review and editing. Ju Sun: Methodology; writing – review and editing. Jiayun Gu: Methodology; writing – review and editing. Xiaojuan Xu: Funding acquisition. Xuwang Cai: Funding acquisition; investigation; resources.

CONFLICT OF INTEREST STATEMENT

This manuscript has been reviewed and approved by all authors. There are no commercial or financial relationships that would lead to a potential conflict of interest.

Supporting information

FIGURE S1. The proportion of survival spores of B.s‐168 and B.s‐168‐CLE after incubation at 60°C, 70°C, 80°C, 90°C, or 100°C for 10 min.

MBT2-17-e14518-s001.docx (256.1KB, docx)

ACKNOWLEDGEMENTS

The authors are thankful to Prof. Wubei Dong at the College of Plant Science & Technology for the providing of B. subtilis strain 168, and we also thank Prof. Liurong Fang at the College of Veterinary Medicine for the PEDV AJ1102 cDNA and the monoclonal antibody against PEDV spike protein. This work was supported by the China Agriculture Research System of the MOF and MARA (No. CARS‐35).

Tian, Y. , Wang, Z. , Sun, J. , Gu, J. , Xu, X. & Cai, X. (2024) Surface display of the COE antigen of porcine epidemic diarrhoea virus on Bacillus subtilis spores. Microbial Biotechnology, 17, e14518. Available from: 10.1111/1751-7915.14518

DATA AVAILABILITY STATEMENT

Data supporting the conclusions of this article will be made available without undue reservation by the authors.

REFERENCES

  1. Alonso, C. , Goede, D.P. , Morrison, R.B. , Davies, P.R. , Rovira, A. , Marthaler, D.G. et al. (2014) Evidence of infectivity of airborne porcine epidemic diarrhea virus and detection of airborne viral RNA at long distances from infected herds. Veterinary Research, 45, 73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bae, J.L. , Lee, J.G. , Kang, T.J. , Jang, H.S. , Jang, Y.S. & Yang, M.S. (2003) Induction of antigen‐specific systemic and mucosal immune responses by feeding animals transgenic plants expressing the antigen. Vaccine, 21, 4052–4058. [DOI] [PubMed] [Google Scholar]
  3. Barnes, A.G. , Cerovic, V. , Hobson, P.S. & Klavinskis, L.S. (2007) Bacillus subtilis spores: a novel microparticle adjuvant which can instruct a balanced Th1 and Th2 immune response to specific antigen. European Journal of Immunology, 37, 1538–1547. [DOI] [PubMed] [Google Scholar]
  4. Belyakov, I.M. & Ahlers, J.D. (2009) What role does the route of immunization play in the generation of protective immunity against mucosal pathogens? Journal of Immunology, 183, 6883–6892. [DOI] [PubMed] [Google Scholar]
  5. Bi, J. , Zeng, S. , Xiao, S. , Chen, H. & Fang, L. (2012) Complete genome sequence of porcine epidemic diarrhea virus strain AJ1102 isolated from a suckling piglet with acute diarrhea in China. Journal of Virology, 86, 10910–10911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chang, S.H. , Bae, J.L. , Kang, T.J. , Kim, J. , Chung, G.H. , Lim, C.W. et al. (2002) Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Molecules and Cells, 14, 295–299. [PubMed] [Google Scholar]
  7. Chattha, K.S. , Roth, J.A. & Saif, L.J. (2015) Strategies for design and application of enteric viral vaccines. Annual Review of Animal Biosciences, 3, 375–395. [DOI] [PubMed] [Google Scholar]
  8. Chen, H. , Zhang, T. , Jia, J. , Vastermark, A. , Tian, R. , Ni, Z. et al. (2015) Expression and display of a novel thermostable esterase from Clostridium thermocellum on the surface of Bacillus subtilis using the CotB anchor protein. Journal of Industrial Microbiology & Biotechnology, 42, 1439–1448. [DOI] [PubMed] [Google Scholar]
  9. Crotty, S. (2015) A brief history of T cell help to B cells. Nature Reviews. Immunology, 15, 185–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dai, X. , Liu, M. , Pan, K. & Yang, J. (2018) Surface display of OmpC of Salmonella serovar Pullorum on Bacillus subtilis spores. PLoS One, 13, e0191627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dee, S. , Clement, T. , Schelkopf, A. , Nerem, J. , Knudsen, D. , Christopher‐Hennings, J. et al. (2014) An evaluation of contaminated complete feed as a vehicle for porcine epidemic diarrhea virus infection of naive pigs following consumption via natural feeding behavior: proof of concept. BMC Veterinary Research, 10, 176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fang, H. , Li, Q. & Wang, G. (2020) The role of T cells in pemphigus vulgaris and bullous pemphigoid. Autoimmunity Reviews, 19, 102661. [DOI] [PubMed] [Google Scholar]
  13. Gallagher, T.M. & Buchmeier, M.J. (2001) Coronavirus spike proteins in viral entry and pathogenesis. Virology, 279, 371–374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Holmgren, J. & Czerkinsky, C. (2005) Mucosal immunity and vaccines. Nature Medicine, 11, S45–S53. [DOI] [PubMed] [Google Scholar]
  15. Hou, X. , Jiang, X. , Jiang, Y. , Tang, L. , Xu, Y. , Qiao, X. et al. (2018) Oral immunization against PEDV with recombinant Lactobacillus casei expressing dendritic cell‐targeting peptide fusing COE protein of PEDV in piglets. Viruses, 10, 106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hou, Y. , Ke, H. , Kim, J. , Yoo, D. , Su, Y. , Boley, P. et al. (2019) Engineering a live attenuated porcine epidemic diarrhea virus vaccine candidate via inactivation of the viral 2'‐O‐methyltransferase and the endocytosis signal of the spike protein. Journal of Virology, 93, e00406–e00419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jung, K. , Eyerly, B. , Annamalai, T. , Lu, Z. & Saif, L.J. (2015) Structural alteration of tight and adherens junctions in villous and crypt epithelium of the small and large intestine of conventional nursing piglets infected with porcine epidemic diarrhea virus. Veterinary Microbiology, 177, 373–378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jung, K. , Saif, L.J. & Wang, Q. (2020) Porcine epidemic diarrhea virus (PEDV): an update on etiology, transmission, pathogenesis, and prevention and control. Virus Research, 286, 198045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kocherhans, R. , Bridgen, A. , Ackermann, M. & Tobler, K. (2001) Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes, 23, 137–144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kunisawa, J. , Kurashima, Y. & Kiyono, H. (2012) Gut‐associated lymphoid tissues for the development of oral vaccines. Advanced Drug Delivery Reviews, 64, 523–530. [DOI] [PubMed] [Google Scholar]
  21. Li, C. , Li, W. , Lucio de Esesarte, E. , Guo, H. , van den Elzen, P. , Aarts, E. et al. (2017) Cell attachment domains of the porcine epidemic diarrhea virus spike protein are key targets of neutralizing antibodies. Journal of Virology, 91, e00273‐17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li, W. , Hulswit, R.J.G. , Kenney, S.P. , Widjaja, I. , Jung, K. , Alhamo, M.A. et al. (2018) Broad receptor engagement of an emerging global coronavirus may potentiate its diverse cross‐species transmissibility. Proceedings of the National Academy of Sciences of the United States of America, 115, E5135–E5143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li, W. , van Kuppeveld, F.J.M. , He, Q. , Rottier, P.J.M. & Bosch, B.J. (2016) Cellular entry of the porcine epidemic diarrhea virus. Virus Research, 226, 117–127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li, Z. , Ma, Z. , Li, Y. , Gao, S. & Xiao, S. (2020) Porcine epidemic diarrhea virus: molecular mechanisms of attenuation and vaccines. Microbial Pathogenesis, 149, 104553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lowe, J. , Gauger, P. , Harmon, K. , Zhang, J. , Connor, J. , Yeske, P. et al. (2014) Role of transportation in spread of porcine epidemic diarrhea virus infection, United States. Emerging Infectious Diseases, 20, 872–874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Makadiya, N. , Brownlie, R. , van den Hurk, J. , Berube, N. , Allan, B. , Gerdts, V. et al. (2016) S1 domain of the porcine epidemic diarrhea virus spike protein as a vaccine antigen. Virology Journal, 13, 57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mauriello, E.M. , Duc le, H. , Isticato, R. , Cangiano, G. , Hong, H.A. , De Felice, M. et al. (2004) Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner. Vaccine, 22, 1177–1187. [DOI] [PubMed] [Google Scholar]
  28. Nicholson, W.L. , Munakata, N. , Horneck, G. , Melosh, H.J. & Setlow, P. (2000) Resistance of bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiology and Molecular Biology Reviews, 64, 548–572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nicholson, W.L. & Setlow, P. (1990) Sporulation, germination and outgrowth in molecular biological methods for Bacillus .
  30. Pensaert, M.B. & de Bouck, P. (1978) A new coronavirus‐like particle associated with diarrhea in swine. Archives of Virology, 58, 243–247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rosales‐Mendoza, S. & Angulo, C. (2015) Bacillus subtilis comes of age as a vaccine production host and delivery vehicle. Expert Review of Vaccines, 14, 1135–1148. [DOI] [PubMed] [Google Scholar]
  32. Rosales‐Mendoza, S. , Angulo, C. & Meza, B. (2016) Food‐grade organisms as vaccine biofactories and oral delivery vehicles. Trends in Biotechnology, 34, 124–136. [DOI] [PubMed] [Google Scholar]
  33. Song, D. , Moon, H. & Kang, B. (2015) Porcine epidemic diarrhea: a review of current epidemiology and available vaccines. Clinical and Experimental Vaccine Research, 4, 166–176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Song, D.S. , Oh, J.S. , Kang, B.K. , Yang, J.S. , Moon, H.J. , Yoo, H.S. et al. (2007) Oral efficacy of Vero cell attenuated porcine epidemic diarrhea virus DR13 strain. Research in Veterinary Science, 82, 134–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sun, D. , Wang, X. , Wei, S. , Chen, J. & Feng, L. (2016) Epidemiology and vaccine of porcine epidemic diarrhea virus in China: a mini‐review. The Journal of Veterinary Medical Science, 78, 355–363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sun, R.Q. , Cai, R.J. , Chen, Y.Q. , Liang, P.S. , Chen, D.K. & Song, C.X. (2012) Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerging Infectious Diseases, 18, 161–163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Thavorasak, T. , Chulanetra, M. , Glab‐Ampai, K. , Mahasongkram, K. , Sae‐Lim, N. , Teeranitayatarn, K. et al. (2022) Enhancing epitope of PEDV spike protein. Frontiers in Microbiology, 13, 933249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Trombert, A. (2015) Recombinant lactic acid bacteria as delivery vectors of heterologous antigens: the future of vaccination? Beneficial Microbes, 6, 313–324. [DOI] [PubMed] [Google Scholar]
  39. Tseng, Y.Y. , Liao, G.R. , Lien, A. & Hsu, W.L. (2021) Current concepts in the development of therapeutics against human and animal coronavirus diseases by targeting NP. Computational and Structural Biotechnology Journal, 19, 1072–1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wang, J. , Huang, L. , Mou, C. , Zhang, E. , Wang, Y. , Cao, Y. et al. (2019) Mucosal immune responses induced by oral administration recombinant Bacillus subtilis expressing the COE antigen of PEDV in newborn piglets. Bioscience Reports, 39, BSR20182028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Wang, X. , Wang, L. , Huang, X. , Ma, S. , Yu, M. , Shi, W. et al. (2017) Oral delivery of probiotics expressing dendritic cell‐targeting peptide fused with porcine epidemic diarrhea virus COE antigen: a promising vaccine strategy against PEDV. Viruses, 9, 312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Wang, X.N. , Wang, L. , Zheng, D.Z. , Chen, S. , Shi, W. , Qiao, X.Y. et al. (2018) Oral immunization with a Lactobacillus casei‐based anti‐porcine epidemic diarrhoea virus (PEDV) vaccine expressing microfold cell‐targeting peptide Co1 fused with the COE antigen of PEDV. Journal of Applied Microbiology, 124, 368–378. [DOI] [PubMed] [Google Scholar]
  43. Wood, E.N. (1977) An apparently new syndrome of porcine epidemic diarrhoea. The Veterinary Record, 100, 243–244. [DOI] [PubMed] [Google Scholar]
  44. Wynn, T.A. (2015) Type 2 cytokines: mechanisms and therapeutic strategies. Nature Reviews. Immunology, 15, 271–282. [DOI] [PubMed] [Google Scholar]
  45. Yu, M. , Wang, L. , Ma, S. , Wang, X. , Wang, Y. , Xiao, Y. et al. (2017) Immunogenicity of eGFP‐marked recombinant lactobacillus casei against transmissible gastroenteritis virus and porcine epidemic diarrhea virus. Viruses, 9, 274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang, F. , Luo, S. , Gu, J. , Li, Z. , Li, K. , Yuan, W. et al. (2019) Prevalence and phylogenetic analysis of porcine diarrhea associated viruses in southern China from 2012 to 2018. BMC Veterinary Research, 15, 470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang, Q. , Hu, R. , Tang, X. , Wu, C. , He, Q. , Zhao, Z. et al. (2013) Occurrence and investigation of enteric viral infections in pigs with diarrhea in China. Archives of Virology, 158, 1631–1636. [DOI] [PubMed] [Google Scholar]
  48. Zhou, L. , Chong, M.M. & Littman, D.R. (2009) Plasticity of CD4+ T cell lineage differentiation. Immunity, 30, 646–655. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FIGURE S1. The proportion of survival spores of B.s‐168 and B.s‐168‐CLE after incubation at 60°C, 70°C, 80°C, 90°C, or 100°C for 10 min.

MBT2-17-e14518-s001.docx (256.1KB, docx)

Data Availability Statement

Data supporting the conclusions of this article will be made available without undue reservation by the authors.

Articles from Microbial Biotechnology are provided here courtesy of Wiley

RESOURCES