In vivo evaluation of mebendazole and Ran GTPase inhibition in breast cancer model system

Abstract

Aim: To investigate the therapeutic potential of mebendazole (MBZ)-loaded nanostructured lipid carriers (NLCs). Methodology: NLC-MBZ was prepared and characterized to evaluate the in vitro and in vivo anticancer effects and the inhibitory effect on RanGTP and its potential as an antimetastatic treatment in vivo. Results: NLC-MBZ exhibited a size and charge of 155 ± 20 nm and -27 ± 0.5 mV, respectively, with 90.7% encapsulation. Free MBZ and NLC-MBZ had a 50% inhibitory concentration of 610 and 305 nM, respectively, against MDA-MB-231 cell lines. NLC-MBZ decreased tumor size, suppressed tumor lung metastases, and lowered the expression of CDC25A, SKP2, RbX1 and Cullin1 while boosting the Rb proteins. Conclusion: NLC-MBZ displayed antiangiogenic potential and resulted in a reduced rate of lung metastasis in vivo.

Graphical abstract

Plain language summary

Summary points.

• In this study, we developed and characterized nanostructured lipid carriers (NLCs) loaded with mebendazole (MBZ; NLC-MBZ).

• NLC-MBZ was prepared to investigate its in vitro and in vivo anticancer effects.

• NLC-MBZ was explored for its inhibitory impact on RanGTP and its potential as an antimetastatic agent in mouse models.

• NLC-MBZ displayed a size of 155 ± 20 nm with a -27 ± 0.5-mV charge and 90.7% encapsulation efficiency.

• After 48 h of exposure, the IC₅₀ for free MBZ and NLC-MBZ was 610 and 305 nM, respectively, against MDA-MB-231 breast cancer cell lines.

• Moreover, NLC-MBZ reduced the size of the primary tumor and inhibited the development of lung metastases.

• NLC-MBZ reduced the expression CDC25A, SKP2, RbX1 and Cullin1 while increasing the expression of Rb proteins.

• NLC-MBZ showed antiangiogenic potential that resulted in a reduced rate of lung metastasis in vivo.

Cancer, a multifaceted disease driven by genetic mutations influencing the regulation of cell cycle proteins, plays a central role in both its initiation and progression [1]. As cancer advances, metastasis, characterized by the spread of tumor cells from the primary site, represents a critical turning point [2]. These cells infiltrate the bloodstream or lymphatic system, ultimately forming micro- and macro-metastases in distant organs [3]. Breast cancer, the second leading cause of cancer-associated mortality in women worldwide [4], frequently exhibits metastatic tendencies, particularly in stage 4, where conventional treatments encounter formidable challenges. This necessitates the development of prompt and targeted therapeutic strategies [5,6].

Within the expansive domain of cancer biology, the Ras superfamily, notably the Ras proto-oncogenes, assumes a central role in orchestrating cellular processes that contribute to the intricate landscape of oncogenesis [7]. In tandem, the Ran GTPase, which is a small GTP binding protein involved in the transport of RNA and protein across the nucleus [8,9], emerges as another pivotal player in the complex narrative of cancer initiation and progression. Its overexpression in various malignancies positions it as a promising therapeutic target, offering potential avenues for intervening in cancer-related processes [10]. Strong evidence has suggested that Ran may be a key cellular protein involved in the metastatic progression of cancer [8].

The evolving resistance of tumors to conventional treatments underscores the urgent need to decipher essential regulatory pathways, enabling precise targeting of cancer cells while minimizing harm to healthy cells and combating drug resistance [11]. In the pursuit of effective anticancer strategies, our attention has turned to mebendazole (MBZ), originally developed as an anthelmintic agent [12]. However, MBZ has transcended its initial purpose and demonstrated multifaceted potential as an anticancer agent. Its mechanisms involve disrupting tubulin dynamics, a common target of chemotherapy drugs and influencing critical pathways such as angiogenesis and apoptosis. These actions collectively form the basis for MBZ's efficacy against a spectrum of cancer types [13,14]. MBZ is a Biopharmaceutical Classification System BCS II drug with very high daily doses of ≈100–500 mg. It has low pH-dependent water solubility and low bioavailability (17–20%) owing to inadequate absorption and a significant first-pass effect. Unfortunately, its clinical application is limited by its extremely low solubility and bioavailability. Therefore, MBZ needs to be reformulated using the advantages of nanotechnology that can specifically deliver the drug to the desired site of action, prevent first-pass metabolism, and improve drug efficacy [9,15].

In the realm of advanced drug-delivery systems, nanostructured lipid carriers (NLCs) stand out as a new generation by utilizing a lipid and oil matrix [16,17]. NLCs possess the unique ability to finely modulate drug accumulation in cancerous tissues, thereby enhancing the effectiveness of the loaded active agents. In comparison to other carriers such as solid lipid nanoparticles, liposomes, and polymeric nanoparticles, NLCs offer distinct advantages, including maximal drug loading, minimal drug expulsion, heightened stability and favorable biocompatibility [18–23].

This study aims to assess the in vivo anticancer effects of this innovative delivery system and its potential in mitigating adverse reactions. In addition, it seeks to evaluate the in vitro anticancer activity of free MBZ and NLC-MBZ. Furthermore, our research investigates whether MBZ-loaded NLCs (MBZ-NLC) exhibit inhibitory effects on Ran GTP and explores its impact as an anticancer/antimetastatic mouse model system in vivo.

Materials & methods

Materials

MBZ was purchased from Sigma Aldrich (MA, USA). Oleic acid (OA), stearic acid (SA), PEG-400 and Tween 80 were obtained from TCI (Japan). 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyl tetrazolium bromide (MTT) was purchased from Promega (USA) and polyethylene glycol from Avanti Polar Lipids (AL, USA). High-performance liquid chromatography (HPLC)-grade organic solvents were obtained from Scharlab (Spain) and used without further treatment.

Preparation of NLC-MBZ

In our exploration of lipid-based nanocarriers for delivering MBZ to inhibit a breast cancer model system, we formulated these carriers using a combination of solid lipids, including SA and OA, along with liquid lipids represented by Polysorbate 80 (Tween 80) and PEG-400. We followed a precise protocol for the synthesis of NLC-MBZ: we accurately weighed and combined OA (0.010 g), SA (0.010 g) and MBZ (0.001 g) in Eppendorf tube 1, followed by vigorous vortexing and heating in a water bath at 70°C. Concurrently, we dissolved Tween 80 (30 μl) and PEG-400 (30 μl) in deionized water within Eppendorf tube 2. Subsequently, we combined these two mixtures, subjected them to further vortexing, and continued the heating process. The next step involved the application of pulsating ultrasound shockwaves, followed by controlled cooling of the resulting mixture.

Characterization of NLCs

The NLC sample underwent a comprehensive characterization process using dynamic light scattering, enabling the determination of critical parameters such as average size, polydispersity index and zeta potential to assess stability [24]. To ensure uniform sample distribution, meticulous preparation was carried out within an Eppendorf tube, followed by a 60-s vortexing step to achieve homogeneity. Subsequent measurements involved diluting the concentrated sample with 1 ml of deionized water and 1 μl of the original sample. Zeta potential measurements followed a similar procedure using a zeta potential-measuring cuvette.

The experimental conditions included specifying the material type (emulsion), diluent (water), a 120-s equilibration period, 12 runs per sample, dispersant viscosity (0.8872 cP), refractive index (1.332) and a temperature of 25°C. Analysis of particle size and zeta potential was conducted using Zeta-sizer software from Malvern Instruments. This entire procedure was meticulously executed in triplicate to ensure precision and reliability, resulting in a comprehensive and accurate characterization of the NLC sample's properties.

MBZ encapsulation efficiency

Quantification of drug encapsulation within NLCs was performed using a Shimadzu HPLC system. The mobile phase was prepared by blending HPLC-grade Methanol, HPLC-grade Acetonitrile, and a buffer solution. The buffer solution was formulated from monobasic sodium phosphate and adjusted to a pH of 5.5 using diluted phosphoric acid. Following sonication and heating, the mobile phase underwent vacuum filtration. Encapsulation efficiency (EE%) was determined using Equation (1) to ascertain the drug content in the NLCs [25]:

$$\text{EE}(\%)=\frac{\left(\text{Amount of drug encapsulated in NLCs}\right)}{\left(\text{Amount of total drug added in the preparation}\right)}\times 100\%$$ (Equation 1)

Cell culture & cell viability assessment

The primary medium for cultivating the MDA-MB-231 cell line was Dulbecco's modified eagle medium [26]. The cell culture process involved the utilization of fetal bovine serum, phenol red gelatin solution and fibroblast basal medium. Various components such as phosphate-buffered saline, trypsin enzyme solution, streptomycin, and gentamicin solutions played pivotal roles at different stages of cell culture. A laminar flow hood was employed to ensure sterility throughout the cell-culturing procedures [27]. Both MDA-MB-231 and fibroblast cell cultures were separately seeded into 96-well culture plates at a density of 10 × 10³ cells/well. After a 24-h incubation period, treatments involving different concentrations (2400, 1200, 600, 300, 150, 75 and 37.5 nM) of MBZ, NLC and NLC-MBZ were dissolved in the culture medium and introduced into the respective wells. Subsequently, the cells were incubated for 48 h. Following the incubation period, the media was aspirated, and a mixture of 5 ml Dulbecco's modified eagle medium and 5 ml MTT reagent was added to each well. This mixture was incubated for 3 h, and after removal of the contents, 150 µl of the ab211091 MTT solvent was added to all wells. The plates were then placed on a shaker for 1–1.5 h. An ELISA reader was utilized to measure absorbance at 590 and 630 nm wavelengths for each well, and IC₅₀ values were calculated using GraphPad Prism 8 software through concentration–viability curve analysis [28]. Cell viability was determined using Equation 2:

$$\text{Cell viability}\%=\frac{\text{Sample absorbance}-\text{Blank absorbance}}{\text{Control absorbance}-\text{Blank absorbance}}\times 100\%$$ (Equation 2)

Migration assay

The effects of different concentrations of NLC-MBZ (610, 305 and 153 nM) and free MBZ (1220, 610 and 305 nM) on the migration of MDA-MB-231 cells using a wound-healing assay were investigated. Approximately 15 × 10⁴ cells were seeded and cultured for 24 h in each well of 12-well plates. After this incubation period, a controlled scratch wound was created in the cell monolayer using a needle. Subsequently, both NLC-MBZ and free MBZ were introduced post-wound generation. The Incucyte Live-Cell Imaging System, along with dedicated software, was employed to meticulously observe the progression of wound closure and cellular migration. Photographic documentation occurred at the experiment's start (0 h) and conclusion (48 h). The assessment relied on mean relative wound density, measured across three independent replicates for each experimental condition [29].

Angiogenesis

NLC-MBZ and MBZ concentrations were determined by twice calculating the IC₅₀ value and subsequently halving it. This calculation yielded concentrations of 280, 140 and 70 nM, with 140 nM corresponding to the IC₅₀ value.

For the experimental setup, fertilized eggs obtained from nearby hatcheries were carefully incubated, undergoing hourly rotations at 37°C and 70% humidity until reaching day 5 of incubation. On day 6, an air pocket was established within the egg, albumin was aspirated, and a small window was created. At the site of the blood vessel, serially diluted solutions of NLC-MBZ, free MBZ and a control were applied [30,31].

NLC-MBZ preparation for in vivo study

To investigate the anti-breast cancer effects of NLC-MBZ, we administered two different doses of MBZ to mice: 5 and 10 mg/kg, which corresponded to 0.1 and 0.2 mg of MBZ, respectively. These doses were delivered via 0.1- and 0.2-ml injections of a 1-mg/ml MBZ solution.

The preparation of NLC-MBZ involved a formulation containing OA, SA, Tween 80, MBZ, PEG-400 and deionized water. In addition, a blank NLC was prepared using the same components as NLC-MBZ, except for the exclusion of MBZ. A free MBZ solution was prepared using a 1% DMSO solution, and various concentrations were obtained through dilution [32].

Animals

Animal experiments were conducted in strict accordance with ethical standards and received approval from the Institutional Review Board (IRB) and ethical issues committee of Al-Ahliyya Amman University (IRB no.: AAU/2/6/2022-2023), that adheres to Helsinki Declaration of 21 and 23 protocols of the Scientific Requirements and Research Protocols and Research Ethics Committees.

A total of 20 female BALB/C mice aged 7–8 weeks and weighing approximately 20 ± 5 g were used. They were divided into four groups of five and kept in conventional mouse laboratory cages. These mice underwent a 10-day acclimatization period in a controlled environment, maintaining regulated temperature, humidity and lighting conditions. Throughout the study, they were given unrestricted access to standard food and water, ensuring their overall well-being and ethical treatment, thereby upholding the fundamental principles of ethical conduct in animal research [33]. All procedures were performed according to a protocol approved by the Faculty of Allied Medical Sciences and Pharmacy, Al-Ahliyya Amman University, and designed by the Animal Care and Use Committee.

Mouse monitoring & tumor growth measurement

Daily measurements of mouse weight were conducted using a digital balance, along with vigilant monitoring of their behavior and health. This approach enabled accurate tracking of changes in body weight and the development of tumors throughout the study.

Breast cancer model system

The 4T1 cell line was cultured using RPMI 1640 medium, which was supplemented with fetal bovine serum, phenol red gelatin solution, and various solutions including phosphate-buffered saline, trypsin, streptomycin and gentamicin. A sterile environment during cell culturing was maintained using a laminar flow hood, with monitoring and examination facilitated by an inverted microscope and an automated cell counter. Optimal growth conditions were upheld in a CO₂ incubator, and essential equipment such as a centrifuge, cell culture flasks and serological pipettes were utilized for cell-line preparation [34].

In subsequent stages, a thawed Matrigel solution was incorporated into the culture, and a 100-μl portion of the cell/Matrigel mixture containing 2 × 10⁵ cells was injected into the left mammary gland of each mouse using an insulin syringe.

Tumor-bearing mouse grouping & therapeutic approaches

Following the injection of 4T1 cells, visible tumors manifested in all mice within a span of 12 days. Once their tumor volumes reached a range of 21–37 mm³ in the second week post-4T1 cell injection, 18 mice with established tumors were separated into two major categories of 6 mice and 12 mice for 10- and 5-mg/kg doses, respectively. Each category was divided into 3 groups for MBZ, NLC-MBZ and NLC oral treatments.

The 10-mg/kg category comprised 6 mice, distributed across 3 groups, each containing 2 mice. Meanwhile, the 5-mg/kg category comprised 12 mice, subdivided into 3 groups, each with 4 mice, ensuring equal distribution among each subgroup.

The treatment regimen consisted of a 5-day treatment period followed by a 2-day break, which was repeated for 2 weeks [35]. Tumor growth was consistently monitored throughout the treatment period and tumor volumes were calculated using Equation 3:

$$\text{Tumor volume}\left({\text{mm}}^3\right)=0.52\times \text{length}\times {\text{width}}^2$$ (Equation 3)

At the conclusion of the 2-week treatment period, the mice were humanely euthanized, and their tumors and lungs were preserved in a 10% formalin solution for subsequent analysis.

Metastatic tumor staining assay using India ink

The India ink staining technique was employed to count metastatic 4T1 tumor nodules. In this method, an India ink solution was injected through the trachea, filling the lungs for a duration of 5 min. Subsequently, the lungs were extracted and preserved in Fekete's solution, which comprised 70% ethanol, 10% formalin and 5% acetic acid. During this process, normal lung tissue stained black, while the tumor nodules remained white. This contrast occurred because the tumor nodules did not absorb the India ink, as described by Hong et al. in 2009 [36].

Histological examination on tumor tissues

On day 15, tumor tissues were gathered, fixed in 10% formalin and then embedded in paraffin for histological examination. For hematoxylin-eosin staining, sections with a thickness of 5 µm were prepared [37].

Semiquantitative RT-PCR analysis

Tumor tissue was subjected to RNA extraction using the Quick-RNA Miniprep Kit, and its concentration was assessed by measuring the A260/A280 ratio. Subsequently, cDNA synthesis was carried out using the PrimeScript RT Master Mix, followed by qPCR using specific primers (Table 1) and a SYBR Green-based PCR Master Mix. Data analysis was performed using the DDCt method with efficiency correction following the Pfaffl technique, and normalization was conducted relative to the β2M housekeeping gene.

Table 1.

Mouse primer sequences for real-time-polymerase chain reaction.

Gene	Forward primer	Reverse primer
CDC25A	TTGCGGGCTGTTTGACTCC	GGGTCACTGTCCAAAATGTTCT
Cullin 1	AGTGGGAAGATTACCGATTCTCC	CACGGCGAACCCAATGTCTA
Skp2	GCCTCTCGCTCGATGAGTC	AAGCGCACAGTCACGTCTG
Rbx1 E3 ligase	GTCAGCTACTTCCGAAGAGTGT	TTGAGCCATCGAGAGATGCAG
Rb protein	TCGATACCAGTACCAAGGTTGA	ACACGTCCGTTCTAATTTGCTG
β2M	ACCCGCCTCACATTGAAATCC	GGCGTATGTATCAGTCTCAGTG

Statistical analysis

Results for in vitro and in vivo experiments were determined as mean ± standard deviation. The level of significance was evaluated statistically using a one-way ANOVA and Tukey's multiple, variance (ANOVA) and Dunnett's test of multiple comparisons, t-test. p < 0.05 was statistically significant for both in vitro and in vivo experiments.

Results

Characterization of NLCs

Efficiently incorporating nanoparticles into a lipid matrix containing tween80, PEG-400, SA, OA and distilled water was essential to optimize passive targeted cancer treatment. Our study placed significant emphasis on particle size as a critical parameter, taking advantage of the enhanced permeability and retention effect facilitated by irregularities in the tumor vasculature. The nanocarriers utilized in this study displayed submicron dimensions (ranging from 135 to 175 nm), greatly enhancing their potential for precise targeting of tumors (Figure 1A). Despite the expected reduction in particle size due to the presence of PEG-400, the formulation remained stable. The polydispersity indices (ranging from 0.125 to 0.275) indicated varying degrees of particle size uniformity, with lower values (<0.3) signifying more desirable monodisperse systems. Zeta potential values consistently maintained a negative charge and remained below 20 mV, confirming the stability of the NLC (Figure 1B).

Figure 1.

Characterization of nanostructured lipid carriers and mebendazole-loaded nanostructured lipid carriers inhibits cell proliferation.

(A) Average particle size of NLC-MBZ. (B) Average zeta potential of NLC-MBZ. (B1) The encapsulation efficiency of the best NLC formula. (C & D) Cell viability against MDA-MB-231 breast cancer cell lines and fibroblast cells treated for 48 h with NLC-MBZ, NLC and MBZ. Results are presented as mean standard deviation (n = 3). Statistical evaluation using one-way ANOVA and Tukey's multiple.

****p < 0.0001 in MDA-MB-231 cell line; **p < 0.002 in fibroblast cell line.

MBZ: Mebendazole; NLC: Nanostructured lipid carrier; NLC-MBZ: Mebendazole-loaded nanostructured lipid carrier.

In the subsequent phase, the prepared solution underwent analysis for drug content, which was compared with the standard calibration curve for free MBZ. Clear sample solutions with a theoretical concentration of 0.5 mg/ml and a volume of 0.5 ml were subjected to HPLC, and the area under the curve (AUC) obtained from the results represented the sample concentration.

EE% was calculated using Equation 1.

For the NLC-MBZ formula, EE% was calculated as follows: (3,824,677/4,213,877) × 100% = 90.7%

In vitro cytotoxicity of NLC-MBZ

The cytotoxic effects of various drug treatments on both MDA-MB-231 breast cancer cells and fibroblast cell lines were evaluated using the MTT assay 48 h after treatment (Figure 1C & D). These cell lines served as a valuable model for assessing the impact of NLC-MBZ, as well as NLC and MBZ resistance. It is worth noting that blank NLC showed no cytotoxicity towards either cell line. In contrast, treatment with NLC-MBZ and MBZ (at a concentration of 1200 nM) led to a significant decrease in cell viability compared with NLC alone (with p-values of <0.0001 and <0.002) in both MDA-MB-231 and fibroblast cell lines, respectively.

Impact of NLC-MBZ on cell migration & angiogenesis

Our investigation utilizing the scratch assay unveiled substantial hindrances of the migratory capacity of MDA-MB-231 cells due to NLC-MBZ and MBZ treatments. NLC-MBZ exhibited noteworthy inhibitory effects at various concentrations, resulting in inhibition rates of 91, 78 and 44% observed after 48 h. Free MBZ also exhibited a significant reduction in cell migration, displaying inhibition levels of 80, 60 and 40% at the same time intervals (Figure 2A–F).

Figure 2.

Mebendazole-loaded nanostructured lipid carriers suppress the migration of breast cancer cells and inhibits the expression of angiogenesis in chick embryos.

(A) Area of IC₅₀ [NLC-MBZ] in μm² at day 0 (before treatment) and day 2 (after 48 h of treatment). (B) Area of control (media) in μm² at day 0 (before treatment) and day 2 (after 48 h of treatment). (C) Percent of wound closure for NLC-MBZ-treated cells where 2*IC₅₀, IC₅₀, 0.5*IC₅₀. Results are expressed as mean ± standard deviation (n = 3). Statistical ANOVA and Dunnett's test of multiple comparisons. (D) Area of IC₅₀ (free MBZ) in μm² at day 0 (before treatment) and day 2 (after 48 h of treatment). (E) Area of control (media + DMSO) in μm² at day 0 (before treatment) and day 2 (after 48 h of treatment). (F) Percent of wound closure for free MBZ-treated cells where 2*IC₅₀, IC₅₀, 0.5*IC₅₀ and media and DMSO. Results are expressed as mean ± standard deviation (n = 3). Statistical ANOVA and Dunnett's test of multiple comparisons. (G) Vascular responses of the chorioallantoic membrane (CAM) assay after 72-h application treatment of free MBZ, NLC-MBZ and control (normal saline). (H) Effects of NLC-MBZ and MBZ on CAM vessel survival and growth in, in vivo cultured chick embryos. NLC-MBZ and MBZ doses of 70, 140 and 280 nM were applied topically to the base of the umbilical artery early on day 5 post-insemination. Changes in posterior and inferior CAM vessel length as a function of NLC-MBZ and MBZ doses on days 5 and 8 after fertilization.

****p < 0.0001; ****p < 0.0001; ****p < 0.0001 in the MDA-MB-231 breast cancer cell lines.

CAM: Chorioallantoic membrane; DMSO: Dimethylsulfoxide; MBZ: Mebendazole; NLC: Nanostructured lipid carrier; NLC-MBZ: Mebendazole-loaded nanostructured lipid carrier.

In our exploration of angiogenesis, a pivotal process in tumor progression, we employed the chorioallantoic membrane (CAM) assay [38], with groups treated with NLC-MBZ, MBZ and control (distilled water). Figure 2G visually portrays the potent antiangiogenic effects of NLC-MBZ within 72 h, surpassing the impact of MBZ and the control group, which promoted angiogenesis. Subsequent quantitative analysis in Figure 2H corroborated a significant reduction in blood vessels following NLC-MBZ treatment. Conversely, MBZ showed partial suppression of angiogenesis, while the control group facilitated increased vessel formation. This dual experimental approach underscores the multifaceted potential of NLC-MBZ in inhibiting both cancer cell migration and angiogenesis, which are pivotal aspects of tumor progression.

In a concentration dose-dependent manner, NLC-MBZ and MBZ significantly reduced the density of CAM blood vessels compared with the control. In addition, NLC-MBZ significantly suppressed CAM's VEGF-induced vessel development. NLC-MBZ significantly reduced the density of CAM blood vessels compared with MBZ. These findings showed that NLC-MBZ dramatically reduces angiogenesis during chick embryo development.

In vivo antitumor efficacy

In this study, we sought to explore the anticancer potential of newly developed nanodrug delivery systems using a BALB/C mouse model with induced breast cancer. The mice were divided into two main groups, each further divided into subgroups receiving different treatments, including control (NLC), NLC-MBZ and free MBZ, at varying dosage levels (Figure 3A–E).

Figure 3.

Mebendazole-loaded nanostructured lipid carriers reduce tumor, cell proliferation and the number of lung metastases in a BALB/C mice xenograft model system.

(A) Mice before S.C 4T1. (B) Mice after S.C 4T1 and mice before OG drugs. (C) Mice during OG NLC-MBZ, NLC and MBZ drug treatment. (D) Mice during tumor excretion. (E) Tumor induced by 4T1 cells in both NLC and MBZ groups after treatment. (F) An examination of how medical interventions affect breast cancer cells' capacity to colonize the lungs.

MBZ: Mebendazole; NLC: Nanostructured lipid carrier; NLC-MBZ: Mebendazole-loaded nanostructured lipid carrier; OG: Oral gavage; S.C: Subcutaneous.

We documented the weight data for the three groups (Figure 4A) and monitored changes in tumor volume over a span of 2 weeks (Figure 4B). This analysis revealed tumor growth in the NLC group, whereas the NLC-MBZ and MBZ groups exhibited inhibition of tumor growth. Remarkably, the NLC-MBZ group displayed a more rapid and effective reduction in tumors, achieving a 100% response rate, while the MBZ group showed an 85% response rate. In contrast, the NLC group experienced significant tumor growth.

Figure 4.

Mebendazole-loaded nanostructured lipid carriers reduce tumor, cell proliferation, and the number of lung metastases in a BALB/C mouse xenograft model system.

(A) Average weight evaluation of all groups' post-injection of 4T1 cells. The mean values in each group had different values due to the various weights within each group. The average weight of the mice in the three groups varied between 23 and 25 g during the first 4 days after injection; the average weight of the NLC-MBZ group was 27 g. The average weight of the MBZ and NLC groups increased to 25 g during this time. The average weight of the NLC-MBZ group dropped significantly by the fifth day to 25 g. The average weight in the MBZ and NLC groups stayed at or near 25 g. The average weight in the MBZ group gradually increased from day 5 to day 12 until it reached 26 g, while the average weight in the NLC and NLC-MBZ groups varied between 25 and 25.8 g. (B) Average tumor volume (mm³) during treatment of the NLC-MBZ, NLC and MBZ groups. In the group treated with NLC-MBZ, the start of tumor disappearance commenced on day 7 of treatment, and upon reaching day 14, there were no indications of the presence of the tumor, while in the group treated with MBZ, the tumor gradually decreased until day 14 was reached, and only a small part remained compared with the group treated with NLC, where the tumor gradually increased until day 14 of the experiment, with a tumor size of 100 mm³. Results are expressed as mean ± standard deviation (n = 2). Statistical ANOVA and Dunnett's test of multiple comparisons compared with NLC. (C) An examination of how medical interventions affect breast cancer cells' capacity to colonize the lungs. Statistical evaluation using one-way ANOVA and Tukey's multiple assay.

**p < 0.02; ****p < 0.0001; ****p < 0.0001.

MBZ: Mebendazole; NLC: Nanostructured lipid carrier; NLC-MBZ: Mebendazole-loaded nanostructured lipid carrier.

Upon postmortem examination of the mouse lungs stained with India ink and Fekete's solution for metastatic tumor nodules, it was evident that the NLC group had twice as many nodules as the NLC-MBZ and MBZ groups (with a significance level of p < 0.02). Although not statistically significant, the NLC-MBZ group displayed a lower average of lung tumor nodules compared with the MBZ group, which could possibly be attributed to the surface-focused nature of the staining assay (Figures 4C & 3F).

Histological examination of tumor tissues

Metastasis represents the foremost contributor to cancer-related mortality, as disseminated colonies, particularly in vital organs such as the lungs, disrupt normal function and trigger organ failure. To meticulously evaluate the impact of NLC-MBZ on metastasis formation, we employed H&E sections to quantify metastatic colonies in the lungs of tumor-bearing mice at the 27-day mark post-tumor cell injection (Figure 5). Upon histological analysis, a notable (p < 0.005) reduction in the formation of lung metastatic colonies was evident in both NLC-MBZ- and MBZ-treated mice when compared to the control (NLC) groups (Figure 5A–E). Crucially, mice subjected to NLC-MBZ and MBZ treatments demonstrated the ability to suppress breast tumors. However, in one mouse from the MBZ-treated group, small breast cancer cells were observed. In contrast, the control group treated with NLC displayed a substantial breast tumor (Figure 5F & G). These nuanced findings underscore the potential of NLC-MBZ and MBZ not only in inhibiting the formation of metastatic colonies in the lungs but also in mitigating the development of breast tumors.

Figure 5.

Histological examination of tumor tissues.

(A) Normal lung of a mouse. (B & C) Representative histology from the 4T1 group with nanostructured lipid carrier (NLC) treatment, the field shows large metastatic growths, inflammation (neutrophils, eosinophils, lymphocytes, and plasma) and limited normal tissue. (D) Representative histology of 4T1 injected mice treated with mebendazole (MBZ), The field shows no metastatic growth, with significant areas of normal alveolar structure and inflammation (lymphocytes, and plasma). (E) Representative histology of 4T1 injected mice treated with mebendazole-loaded nanostructured lipid carrier (NLC-MBZ); the field shows no metastatic growth and very low lymphocytes, with significant areas of normal alveolar structure. All samples were collected 24 hours after the end of a two-week treatment period. Results are expressed as mean ± standard deviation (n = 3). Statistical analysis of variance (ANOVA) and Dunnett's test of multiple comparisons. **p < 0.0053; **p < 0.0054 and **p < 0.0053 compared to NLC. (F) Breast cancer treated with NLC has a 4T1 proliferation rate of 86% as seen in the photomicrograph (hematoxylin & eosin stain). (G) A 30% 4T1 proliferation rate reveals breast cancer response to MBZ therapy. (F & G) The field shows breast cancer invasion in muscles. Neutrophils and lymphocytes around the tissue. Results are expressed as mean ± standard deviation (n = 1). Statistical analysis using a paired t-test.

**p < 0.0019.

Quantitative real-time PCR analysis

To unravel the impact of NLC-MBZ on Ran in an in vivo setting, we employed qRT-PCR to delve into the effects of NLC-MBZ, NLC and MBZ on the expression of genes associated with Ran (including CDC25A, SKP2, RbX1, Rb and Cullin1). The data underwent meticulous analysis using ANOVA and Dunnett's test for multiple comparisons within Graph Pad Prism 8. Figure 6 provides a comprehensive illustration of the expression levels of these genes in breast and lung tumor tissues following treatments with NLC-MBZ, NLC and MBZ.

Figure 6.

Gene expressions in breast cancer and lung metastases.

(A) Percentage of gene expression at the 10-mg/kg dose. Value is mean ± SD for n = 2; **p < 0.0063 and **p < 0.0030 compared with NLC. (B) Percentage of gene expression at the 5-mg/kg dose. Value is mean ± SD for n = 3; *p < 0.0433; *p < 0.0441 and *p < 0.0.0183 compared with NLC. (C) Percentage of gene expression at the 10-mg/kg dose. Values for n = 3 are mean SD; **p < 0.0020; **p < 0.0038 and **p < 0.0024 when compared with NLC. (D) Percentage of gene expressions at a dose of 5 mg/kg. Values are mean ± SD for n = 3; **p < 0.0030; **p < 0.0018 and **p < 0.0014 in comparison to NLC.

MBZ: Mebendazole; NLC: Nanostructured lipid carrier; SD: Standard deviation.

In the group with lung metastases treated with doses of 10 and 5 mg/kg of NLC-MBZ, NLC and MBZ for a duration of 2 weeks, we observed distinct modulations in mRNA expression. The 10-mg/kg NLC-MBZ group (Figure 6C) exhibited downregulation of CDC25A, SKP2 and RbX1, coupled with an upregulation in Rb expression, indicative of inhibited tumor proliferation. In addition, Cullin1 expression decreased, suggesting concurrent inhibition of tumor migration and invasion. The 5-mg/kg NLC-MBZ group (Figure 6D) displayed similar trends, albeit with milder reductions in CDC25A, SKP2, RbX1 and Cullin1 expression, and a reduced increase in Rb expression compared with the 10-mg/kg dose.

In the MBZ-treated group, at both 10- and 5-mg/kg doses, we observed reductions in CDC25A, SKP2, RbX1 and Cullin1 expression, indicating limited tumor presence. A slight increase in Rb protein expression was noted. Notably, the 10-mg/kg MBZ group (Figure 6C) showed greater reductions in CDC25A, SKP2, RbX1 and Cullin1 expression than the 5 mg/kg group (Figure 6D), with a corresponding higher increase in Rb expression.

In the NLC-treated group at both 10- and 5-mg/kg doses (Figure 6C & D), consistent and remarkably elevated expressions of CDC25A, SKP2, RbX1 and Cullin1 were observed, signifying high cancer levels and widespread dissemination. However, Rb expression was substantially low.

Comparing NLC-MBZ and MBZ with the NLC group underscored the superior efficacy of both drugs in inhibiting tumor growth compared with NLC, with NLC-MBZ demonstrating exceptionally high efficacy, surpassing MBZ. In breast tissue, relative to the control (NLC) treatment, MBZ treatment led to downregulation of CDC25A, SKP2, RbX1 and Cullin1 mRNA expression. Complete tumor removal occurred following treatment with NLC-MBZ. Rb expression was upregulated in MBZ compared with the control treated with 10 mg/kg. At a dose of 5 mg/kg, CDC25A, SKP2, RbX1 and Cullin1 mRNA expression were downregulated in NLC-MBZ and MBZ compared with the control (NLC) treatment. Rb mRNA expression increased when compared with control (Figure 6A & B).

Discussion

Chaudhary et al. previously explored the encapsulation of silymarin and its implications [39]. Upon encapsulation within NLCs, the drug exhibited significant in vivo accumulation, indicative of enhanced targeting facilitated by these carriers. The primary goal of such a formulation is to mitigate drug-related side effects by reducing the required dosage, which can be attributed to a lowered IC₅₀ and improved absorption. The sustained release of the drug from these lipidic nanocarriers, driven by the drug's lipophilic properties, resulted in a continuous 48-h duration of action, potentially contributing to a reduction in dosing frequency. Consistent with findings from other studies, the use of NLCs demonstrated an enhancement in drug targeting. As a result, formulating MBZ within these nanocarriers led to a significant reduction in IC₅₀, particularly against the MDA-MB-231 breast cancer cell line, as evidenced in adipogenic cell culture and highly positive MTT assays. These findings underscore the potential of NLCs to optimize drug delivery, enhance efficacy and minimize side effects, contributing to advancements in cancer treatment strategies.

In our study, breast cancer cell lines, specifically MDA-MB-231, were subjected to assessment to gauge the impact of NLC-MBZ and MBZ on cell survival, resulting in IC₅₀ values of 305 and 610 nM, respectively. These findings align with previously reported IC₅₀ values for MDA-MB-231 cells, highlighting the consistency of IC₅₀ values across various cancer types. Importantly, this consistency extends to thyroid, glioblastoma, breast and colon cancer cell lines, as documented by Zhang et al. [12]. The uniformity in IC₅₀ values underscores the broad applicability of NLC-MBZ and MBZ in targeting and inhibiting cancer cell survival across diverse cancer types, showcasing their potential as versatile therapeutic agents.

Northcott et al. employed the dorsal air sac method to investigate the impact of MBZ on inhibiting angiogenesis in vivo, revealing a significant reduction in both the number and size of blood vessels in treated mice [40]. Our study echoes these findings, utilizing the CAM assay method to assess how NLC-MBZ and MBZ influence angiogenesis inhibition in eggs. In comparison to the control group, both NLC-MBZ and MBZ effectively curtailed blood vessel growth in eggs, with NLC-MBZ exhibiting a more potent inhibitory effect than MBZ. This concurrence between our results and the findings of Northcott et al. [40] underscores the robust antiangiogenic potential of both NLC-MBZ and MBZ, with NLC-MBZ demonstrating enhanced efficacy in impeding blood vessel development.

In our current model, we successfully demonstrated that the injection of 4T1 breast tumor cells led to rapid tumor development in the lungs of mice within a brief period of 12 days. Both histological staining and our micrometastasis cell culture assay corroborated that animals treated with NLC-MBZ and MBZ exhibited a diminished rate of lung metastasis. Notably, the expression levels of certain components within the Rbx1 pathway, particularly Skp2, were found to be reduced. This observation provides insight into the potential mechanism by which NLC-MBZ effectively curtails the spread of 4T1 cells to the lungs. Consistent with the study by Wang et al. [41], our investigation unveiled that treatment with MBZ significantly lowered expression of the cyclin D1 gene, resulting in the effective inhibition of cellular proliferation in mice afflicted with hepatocellular carcinoma. The inhibitory impact on cellular proliferation, coupled with the pronounced reduction in cyclin D1 expression – especially evident in combination therapy – highlighted MBZ's substantial augmentation therapeutic effects. Remarkably, the observed decline in cyclin D1 expression is likely attributable to inhibition of the RAS/RAF/MEK/ERK pathway, as cyclin D1 is known to be expressed and activated through ERK phosphorylation [42]. Our study suggests that NLC-MBZ holds the potential to induce cell cycle arrest in the G1/S phase through an increase in Rb levels resulting from a reduction in cyclin D1 protein. This, in turn, leads to a decreased level of SKP2, proposing an alternative mechanism that activates the Rb and p53 pathways, ultimately resulting in a decreased level of the SCF complex (comprising Skp1, Cullin1, Skp2 and RbX1).

Preclinical research has lately suggested that MBZ may also be beneficial in treating pancreatic, colorectal, lung, thyroid and breast cancer, and meningioma and meningioma of brain malignancies. The efficacy of MBZ against cancer is rooted in its antitubulin polymerization mechanism. However, a comprehensive understanding of its anticancer actions remains incomplete, as studies indicate varied action points contingent on the structural features of MBZ [43]. In the context of breast cancer, mice have been observed to exhibit overexpression of Cullin 1, Rbx1 and Skp2, factors that promote the growth, migration, metastasis and drug resistance of breast cancer cells. Breast cancer treatment, specifically with NLC-MBZ, involves the inhibition of Skp2, thereby reducing Cullin1 and RBX1 levels, and counteracting Rb-E2F loss [44].

In summary, our study provides compelling evidence for the potential of NLC-MBZ as a promising therapeutic approach in cancer treatment. The enhanced drug delivery, efficient tumor targeting, antiangiogenic effects, and the ability to inhibit metastasis and cell proliferation collectively position NLC-MBZ as a versatile and potent candidate for further investigation in cancer therapy.

However, lower bioavailability and the poor solubility of MBZ are the biggest obstacles to its clinical development. Further research and clinical trials are warranted to explore the full potential of this repurposed drug-delivery formula and optimize its use in treating various cancer types. Repurposing approved drugs can speed up identifying effective treatments and improve patient outcomes in a cost-effective manner. Moreover, approved drugs can rapidly proceed for phase II clinical trials. Therefore, our interest is more and more focused on this strategy owing to lower costs and less time for developing new uses for old drugs.

Further research into the molecular mechanisms underlying its actions and potential combination therapies could yield valuable insights for advancing cancer treatment strategies.

Conclusion

This study highlights the potential of NLC-MBZ as a novel therapeutic approach for cancer treatment. NLC-MBZ exhibited improved drug delivery, leading to substantial in vivo drug accumulation. Moreover, NLC-MBZ demonstrated a significant reduction in IC₅₀ against MDA-MB-231 breast cancer cells, suggesting its efficacy in inhibiting cancer cell survival. In addition, NLC-MBZ and MBZ effectively inhibited angiogenesis and showed enhanced efficacy in impeding blood vessel development compared with MBZ, emphasizing its robust antiangiogenic potential. Furthermore, NLC-MBZ and MBZ treatments resulted in a reduced rate of lung metastasis in mouse models and downregulated certain components within the Rbx1 pathway, particularly Skp2, which provides insight into a potential mechanism for this effect. NLC-MBZ may induce cell cycle arrest in the G1/S phase through an increase in Rb levels, leading to decreased levels of SKP2 and ultimately impacting the SCF complex. While MBZ's precise anticancer mechanisms are still under investigation, our findings support its potential to inhibit key pathways involved in cancer growth, proliferation and metastasis. Further investigation into the molecular mechanisms underlying its actions and potential combination therapies may yield valuable insights that could contribute to the advancement of cancer treatment strategies.

Author contributions

B Abu-Hdaib and H Nsairat wrote the research proposal and designed the preparation and characterization experiments along with writing the first draft of the manuscript. M El-Tanani, I Al-deeb and N Hasasna performed the in vitro and in vivo assays and revised the final manuscript draft.

Financial disclosure

The authors have no financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.

Competing interests disclosure

The authors have no competing interests or relevant affiliations with any organization or entity with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.

Writing disclosure

No writing assistance was utilized in the production of this manuscript.

Ethical conduct of research

Animal experiments were conducted in strict accordance with ethical standards and received approval from the institutional review board (IRB) and ethical issues committee of Al-Ahliyya Amman University (IRB no.: AAU/2/6/2022-2023), which adheres to Helsinki Declaration 21 and 23 protocols of the Scientific Requirements and Research Protocols and Research Ethics Committees.