Skip to main content
Biomedical Journal logoLink to Biomedical Journal
. 2023 Aug 9;47(3):100651. doi: 10.1016/j.bj.2023.100651

Long noncoding RNA TUG1 promotes malignant progression of osteosarcoma by enhancing ZBTB7C expression

Xueying An a,1, Wenshu Wu a,1, Pu Wang a,b, Abdurahman Mahmut a,b, Junxia Guo c, Jian Dong a,b, Wang Gong a,b, Bin Liu a,b, Lin Yang c, Yuze Ma a,b, Xingquan Xu a,∗∗, Jianmei Chen d,∗∗∗, Wangsen Cao e,f,∗∗∗∗, Qing Jiang a,b,2,
PMCID: PMC11225834  PMID: 37562773

Abstract

Background

Dysregulation of long non-coding RNAs (lncRNAs) is an important component of tumorigenesis. Aberrant expression of lncRNA taurine upregulated gene 1 (lncTUG1) has been reported in various tumors; however, its precise role and key targets critically involved in osteosarcoma (OS) progression remain unclear.

Methods

The expression profiles of lncRNAs and their regulated miRNAs related to OS progression were assessed by bioinformatics analysis and confirmed by qRT-PCR of OS cells. The miRNA targets were identified by transcriptome sequencing and verified by luciferase reporter and RNA pull-down assays. Several in vivo and in vitro approaches, including CCK8 assay, western blot, qRT-PCR, lentiviral transduction and OS cell xenograft mouse model were established to validate the effects of lncTUG1 regulation of miRNA and the downstream target genes on OS cell growth, apoptosis and progression.

Results

We found that lncTUG1 and miR-26a-5p were inversely up or down-regulated in OS cells, and siRNA-mediated lncTUG1 knockdown reversed the miR-26a-5p down-regulation and suppressed proliferation and enhanced apoptosis of OS cells. Further, we identified that an oncoprotein ZBTB7C was also upregulated in OS cells that were subjected to lncTUG1/miR-26a-5p regulation. More importantly, ZBTB7C knockdown reduced the ZBTB7C upregulation and ZBTB7C overexpression diminished the anti-OS effects of lncTUG1 knockdown in the OS xenograft model.

Conclusions

Our data suggest that lncTUG1 acts as a miR-26a-5p sponge and promotes OS progression via up-regulating ZBTB7C, and targeting lncTUG1 might be an effective strategy to treat OS.

Keywords: Osteosarcoma, LncTUG1, miR-26a-5p, ZBTB7C, Apoptosis

Graphical abstract

Image 1


At a glance commentary.

Scientific background on the subject

Osteosarcoma (OS) is the most common malignancy, which occurs in children and young adults. Although various targeted therapies have been explored in OS, the identification of new molecule targets is urgently needed for improving the clinical approaches and outcomes of OS treatment.

What this study adds to the field

This study elaborated an important network controlled by lncTUG1 critically involved in OS progression, and identified ZBTB7C as a novel gene target of the LncTUG1/miR-26a-5p axis. Relevant therapeutic strategies targeting this regulatory axis are potentially effective for OS treatments.

Osteosarcoma (OS), the most common malignancy, occurs in children and young adults aged 10–30 years with a peak incidence during the adolescent growth spurt [1,2]. OS typically occurs at the distal femur, proximal tibia, and proximal humerus [3,4]. The 5-year survival rate of primary OS is about 65–75%, and of metastatic OS is less than 30% [5]. Surgical resection and chemotherapy are currently the standard therapeutics for OS [[6], [7], [8]], but chemotherapy resistance and systemic damage limit the efficacies. Although various targeted therapies have been explored, OS still remains high mortality due to its extremely heterogeneous genetic etiology, which is not well understood. Thus, the identification of new molecule targets is urgently needed for improving the clinical approaches and outcomes of OS treatment.

Long non-coding RNAs (lncRNAs) consisting of over two hundred nucleotides and having no or limited protein-coding potentials play multiple roles in tumorigenesis. LncRNAs can directly or indirectly regulate microRNAs (miRNAs), transcription factors, ribonucleoproteins, and numerous functional proteins [9], thereby affecting gene expression, chromatin and cellular substructures, RNA maturation/transport, and protein synthesis. lncRNAs can act as guide molecules, scaffold proteins, or function as “sponges “/“decoys” to compete for miRNA binding, therefore reducing the regulatory effects of miRNAs on target gene mRNAs [10]. Accumulating evidence has confirmed that abnormal expression of lncRNAs confers cancer cell proliferation, metastasis, and drug resistance in OS [11,12], and it is postulated that lncRNAs are the potential intervention targets for OS therapy.

LncTUG1, a 7.1-kb lncRNA, was first identified in a genomic scan for genes upregulated by taurine treatment in developing mouse retinal cells [13]. Subsequent research demonstrated that lncTUG1 was highly expressed and participated in the progression of diverse malignant tumors, either by acting as a potential tumor suppressor or oncogene [[14], [15], [16]]. LncTUG1 elevation reportedly regulated Ezrin expression through miR-377–3p [17] and hypoxia-inducible factor-1 (HIF-1α) through miR-143–5p to promote OS cell metastasis [18], and activated SRY (sex determining region Y)-box 4 (SOX4) expression to inhibit OS apoptosis by sponging miR-132–3p [19], suggesting that lncTUG1 is a multifunctional OS-associated lncRNA.

In this study, we explored the precise role and the signaling pathway of lncTUG1 in OS in more exclusive approaches. We combined bioinformatics analysis and multiple advanced techniques and demonstrated that lncTUG1 upregulation in OS cells suppressed miR-26a-5p, which in turn incurred aberrant elevation of an oncoprotein ZBTB7C, resulting in enhanced OS growth. Thus, our study elaborated an important network controlled by lncTUG1 critically involved in OS progression.

Material and methods

Cell lines

The human MNNG/HOS (HOS) and MG63 cell lines were obtained from Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. hFOB 1.19 (hFOB) and LO2 cell lines were purchased from Shanghai Yubo Biotechnology Co., Ltd. MG63 cell line was purchased from Otwo Biotech Inc. (Shenzhen, China). HOS cells and hFOB cells were cultured in a-modified essential medium (MEM) and DMEM/F12 medium with G418 (Beyotime, Shanghai, China), respectively (Hyclone, Logan, Utah, USA). LO2 and MG63 cells were cultured and maintained in RPMI 1640 medium (Hyclone, Logan, Utah, USA). All the above-mentioned media were supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific, Shanghai, China) and 1% antibiotics (penicillin and streptomycin). All the cell lines were incubated at 37 °C in a humidified incubator with 5% CO2.

Human tissue specimens

OS samples of 2 male and 3 female patients (age: 11–17 years, median age: 13 years) were collected and the diagnosed-normal bone marrows (Normal) served as controls. The study was approved by the Ethics Committee of the Nanjing Drum Tower Hospital.

Plasmids and RNA knockdown

A plasmid overexpressing ZBTB7C (NM_001318841.2) was purchased from Shanghai Genechem Co., LTD. siRNA targeting lncTUG1 (siLn-1:5′-GGAUAUAGCCAGAGAA CAATT-3′, siLn-2:5′-GUGCAGAAGCCCAGA GUAATT-3′) and siRNA-targeting ZBTB7C (siZB-1:5′-ACGCCAAGUUCGUGCACA ATT-3′, siZB-2:5′-GCAGCAAG UACUUCAAGAATT-3′, siZB-3:5′-AGAUCAAGG AGGAGGAGAATT-3′) were gained from GENERAL BIOL (Anhui, China). hsa-miR-26a-5p mimics were purchased from RIBOBIO (Guangzhou, China). Negative vector, si-NC, and miR-NC were the corresponding control groups. HOS cells were plated in 24-well or 6-well plates 24 h prior to plasmid, siRNA, or miR mimic transfection at 50–60% confluence and then mixed with Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Shanghai, China) according to the instruction manual.

Lentiviral transduction for stable cell lines

The pCDH-CMV-MCS-EF1-copGFP-T2A-Puro vector (GENERAL BIOL, Anhui, China) was used to construct a ZBTB7C-overexpressing lentivirus (ZBTB7C-OE). siLncTUG1 was constructed using pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO RNAi lentiviral vector (Genomeditech). The target sequence of LncTUG1 was 5′-GUGCAGAAGCCCAGAGU AATT-3’. HOS cells were transduced by the above lentiviruses with polybrene (6 μg/ml, MedChemExpress, Shanghai, China).

Cell proliferation assay

Cell viability and proliferation were determined with a Cell Counting Kit-8 (CCK8; MedChemExpress, Shanghai, China) according to the manufacturer's recommendations. The HOS cells under different treatment conditions were treated with 10 μL dye solution at 24 h, 48 h and 72 h, respectively. After incubation at 37 °C for 1–4 h, the absorbance was read at 450 nm with a microplate reader (Molecular Devices M3, Molecular Devices, USA).

Live & dead staining assay

A Live & Dead Viability/Cytotoxicity Assay Kit (KeyGEN BioTech, Nanjing, China) was used to stain live/dead HOS cells under various treatments (Calcein-AM stains live cells and PI stains the dead cells) according to the user's manual. The stained cells were imaged with a fluorescence microscope (Nikon, Tokyo, Japan).

RNA extraction and real-time quantitative PCR (RT-qPCR)

Total RNA was isolated from HOS cells by RNA isolater Total RNA Extraction Reagent (R401-01, Vazyme, China). Complementary DNA (cDNA) was synthesized by NovoNGS® Second-Strand cDNA Synthesis Kit (Novoprotein, Shanghai, China) with total RNA and random primers. qPCR was performed with ChamQTM SYBR Color qPCR Master Mix (Vazyme, Nanjing, China) with gene-specific primers on a viiA7 Fast Real-time PCR System (Applied Biosystems, Waltham, Massachusetts, USA). The β-actin gene was the control. The primers are shown as follows: TUG1-F: TAGCAGTTCCCCAATCCTTG and TUG1-R: CACAAATTCCCAT CATTCCC; MALAT1-F: CCCCACAAGCAACTTCTCTG and MALAT1-R: TCCAA GCTACTGGCTGCATC; ZBTB7C–F: TCCGATGTACTACCAAG GAGG and ZBTB7C–R: TTTTTGCAGTCCACCCCTCT; ACTB-F: CACCATTGGCAATG AGCGGTTC and ACTB-R: AGGTCTTTGCGGATGTCCACGT.

Western blot

Western blot was performed essentially as before [20]. The following primary antibodies were used: anti-BCL2 (Proteintech, Cat No:26593-1-AP), anti-BAX (Proteintech, Cat No:16837-1-AP), anti-Caspase1/p20/p10 (Proteintech, Cat No:22915-1-AP), anti-Cleaved Caspase-3 (Asp175) (Cl.Cas3, Cell Signaling Technology, Cat No:9661), anti-beta Actin (AiFang biological, Cat No: AF300014), and anti-ZBTB7C (Millipore, Cat No: AV32872). Immunodetection was performed using an ECL detection reagent (Thermo Scientific, Shanghai, China). Densitometric quantification was performed with the β-actin control by Fiji [21].

TUNEL assay

A TUNEL assay kit was purchased from KeyGen Biotech Co. Ltd (Nanjing, China) and the assay was performed according to the instruction manual. Briefly, HOS cells were fixed with 4% paraformaldehyde for 30 min, then incubated with pre-prepared detection solution for 60 min at 37 °C in the dark, and then imaged at an excitation wavelength range of 450–500 nm by using a fluorescence microscope (Nikon, Tokyo, Japan).

Luciferase reporter assay

Cells seeded in 12-well plates were co-transfected with a rellina luciferase reporter control and the luciferase-wild-type or mutated ZBTB7C-3′UTR reporter plasmid, respectively, plus hsa-miR-26a-5p mimics or miR-NC. After incubation for 48 h, a dual-luciferase reporter assay system (Promega, Beijing, China) was used to detect the activities of firefly luciferase and Renilla luciferase in each well. The luciferase-related reporter gene vector was constructed by Genechem Co., Ltd (Shanghai, China) for this study.

RNA-sequencing

Total cellular RNAs from HOS cells transfected with mimic-miR-26a-5p or NC (control) were isolated by Trizol reagent (Sigma Aldrich). Transcriptome sequencing libraries were constructed by the VAHTS Universal V6 RNA-sequencing Library Prep Kit. The cluster generation and sequencing were performed on the Novaseq 6000 S4 platform, by NovaSeq 6000 S4 Reagent kit V1.5. The differentially expressed gene (DEG) sets (|fold change (FC) > 2 and p < 0.05) were analyzed and identified using Gene Ontology (GO, http://geneontology.org/), Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.kegg.jp/), and differential genes mapped for protein interaction network analysis (http://string-db.org/). Transcriptome sequencing and analysis were performed using the Annoroad Gene Tech (Beijing) Co., Ltd.

Bioinformatic analysis

OS-related lncRNAs were obtained through the Lnc2cancer 3.0 database [22]. The lncRNAs and count statistics (count> 3) are shown as follows: TUG1 (13), MALAT1 (13), XIST (7), NEAT1 (5), ANRIL (4), HOTAIR (4), PVT1 (4), SNHG12 (4), and ZFAS1 (4). OS-associated miRNAs via the miRcancer database [23] and the miRNAs were site-validated for lncTUG1 targeting by the ENCORI database. The expression correlation analysis of lncTUG1 and miRNAs was performed through ENCORI database [24]. The survival curve of patients with high and low expression of lncTUG1 was analyzed through the GEPIA2 database [25]. miR-26a-5p-targeted genes were analyzed by the TargetScan database [26].

Mice and in vivo OS xenograft assay

BALB/c nude female mice (4 weeks old) were purchased from Model Animal Research Center of Nanjing University. Mice were maintained in a specific pathogen-free environment with freely available water and enough mouse chow. All animal feeding and experiments were approved by the Ethics Committee and the Institutional Animal Care and Use Committee of Drum Tower Hospital, Nanjing University Medical School.

Mice were randomly assigned to four groups (n = 5 per group) for subcutaneous implantation of HOS cells stably transfected with lentivirus (1) NC (NC si + NC OE), (2) ZBTB7C OE (NC si + OE-ZBTB7C), (3) siLncTUG1 (siLnTUG1 + NC OE), and (4) ZBTB7C OE + siLncTUG1. Equal amounts of cells (2 × 106 per mouse) from different groups were injected subcutaneously to establish an OS xenograft model. After 27 days treatment, the mice were sacrificed, and the xenografted tumors were used for hematoxylin-eosin (H&E) and immunohistochemistry (IHC) staining.

Histology, immunohistochemistry and immunofluorescence (IF) staining

OS xenograft tumors were fixed with 4% paraformaldehyde for 24 h, fixed tissues were embedded with paraffin and cut into 3 μm tissue pieces, and then stained with H&E, and CD31, Ki-67, and Cl. Cas3 (cleaved-caspase 3) by IHC, separately. Alternatively, the human samples were stained with ZBTB7C by IF. Finally, tumor sections were photographed by a virtual slide microscope (Olympus VS120, Japan) and analyzed by Fiji (Center for Open Bioimage Analysis (COBA), USA).

Statistical analysis

The data were expressed as mean ± standard deviation (SD) or standard error of the mean (SEM) between two groups and analyzed by Prism 7 statistical software (GraphPad Software, Inc., USA). Differences between two group means were assessed with Student's test or two-way ANOVA as indicated in each figure legend. All error bars in this study for at least three independent experiments. p-values stands for statistically significant are indicated in figures or legends as ∗∗∗p < 0.001; ∗∗p < 0.01; ∗p < 0.05, ns (no statistical difference).

Results

lncTUG1 knockdown inhibits proliferation and induces apoptosis in OS cells

Accumulating evidence indicates that the majority of lncRNAs are functional and correlated with various diseases, especially cancers [[27], [28], [29]]. Firstly, we identified that lncTUG1 and metastasis-associated lung adenocarcinoma transcript 1 (lncMALAT1) were important OS-related lncRNAs by the Lnc2cancer 3.0 database, a manually curated database for associations between lncRNA or circRNA and human cancer (http://bio-bigdata.hrbmu.edu.cn/lnc2cancer/) [Fig. 1A]. Next, we verified that the lncTUG1 expression was significantly upregulated more than lncMALAT1 in OS cells [Fig. 1B]. In addition, Kaplan–Meier survival analysis indicated that the overall survival rate of OS patients with high TUG1 expression was lower than those with low lncTUG1 expression, consistent with other studies [18,30] [Fig. S1]. To further evaluate the functional role of lncTUG1 in OS cells, we transfected two lncTUG1 siRNAs (siLn-1 and siLn-2) separately into OS cells and used siLn-2, which displayed higher lncTUG1-knockdown efficacy [Fig. 1C], to evaluate the effects of lncTUG1 on cell viability. The results showed that lncTUG1 knockdown reduced OS cell proliferation (CCK8 assay) and resulted in more dead cells (live/dead cell staining, [Fig. 1D and E]). In addition, Western blot results indicated that lncTUG1 knockdown led to an evident increase of several apoptosis-related proteins (BCL-2-associated X protein, BAX; Cl. cas3 and Caspase 1, CASP1) and a marked decrease of survival protein BCL2 (B-cell lymphoma-2) comparing to the controls [Fig. 1F]. Meanwhile, TUNEL assay detected that lncTUG1 knockdown induced more cell apoptosis [Fig. 1G]. These data support that knockdown of highly-expressed lncTUG1 suppressed cell viability and promoted OS cell apoptosis.

Fig. 1.

Fig. 1

Knockdown of lncTUG1 inhibits OS growth. (A) OS-related lncRNAs analysis via the Lnc2cancer 3.0 database. (B) Relative lncMALAT1 and lncTUG1 levels in osteosarcoma cell lines (HOS and MG63) compared to normal cells (hFOB and LO2) by qRT-PCR (n = 6). (C) LncTUG1 expression identification in lncTUG1-knockdown HOS cells by qRT-PCR (n = 6). (D) Cell proliferation of lncTUG1-knockdown HOS cells at 24 h, 48 h, 72 h by CCK8 (n = 8). (E) Live/dead staining assay of lncTUG1-knockdown HOS cells. (F) Western blot of apoptosis-related proteins levels and quantitative analysis (n = 3) in lncTUG1-knockdown HOS cells. (G) TUNEL staining assay of lncTUG1-knockdown HOS cells. Data are means ± SD. ns, not significant; p ≥ 0.05; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001.

lncTUG1 negatively regulates miR-26a-5p in OS cells

Next, we investigated the potential miRNAs regulated by lncTUG1 in OS cells. According to ENCORI database and miRcancer database, four OS-related miRNAs (hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-221–3p and hsa-miR-132–3p) were site-validated with lncTUG1 targeting [Fig. 2A]. Especially the expressions of miR-26a-5p, miR-27a-3p and miR-221–3p were significantly correlated with lncTUG1 [Fig. 2B], and miR-26a-5p was most obviously inhibited after lncTUG1-knockdown [Fig. 2C]. Moreover, we validated that miR-26a-5p was elevated in OS cells [Fig. 2D] and HOS cells transfected with miR-26a-5p mimics (mimic miR) showed increased miR-26a-5p [Fig. 2E] and exhibited suppressed proliferation (CCK8 assay) and increased dead cells (live/dead cell staining, Fig. 2F and G). In addition, Western blot results indicated that miR-26a-5p mimics increased the expressions of apoptosis-related proteins BAX, Cl. cas3 and CASP1 and decreased BCL2 [Fig. 2H]. Meanwhile, TUNEL assay also demonstrated that miR-26a-5p mimics induced more cell apoptosis [Fig. 2I]. Altogether, these data confirm that lncTUG1 negatively regulates miR-26a-5p and promotes OS growth.

Fig. 2.

Fig. 2

LncTUG1 acted as a sponge of miR-26a-5p in osteosarcoma. (A) Venn diagram between miRNAs were site-validated of lncTUG1 targeting by the ENCORI database and OS-associated miRNAs via the miRcancer database. (B) Expression correlation analysis of LncTUG1 and miRNAs (hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-221–3p, hsa-miR-132–3p) via ENCORI database. (C) Relative miRNAs (hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-221–3p, hsa-miR-132–3p) expression in LncTUG1-knockdown HOS cells by qRT-PCR (n = 6). (D) Relative miR-26a-5p expression in osteosarcoma cell lines (HOS and MG63) compared to normal cells (hFOB and LO2) by qRT-PCR (n = 6). (E) miR-26a-5p identification of HOS cells transfected with mimic-miR-26a-5p (mimic miR) by qRT-PCR (n = 6). (F) Cell proliferation of HOS cells transfected with mimic-miR-26a-5p at 24 h, 48 h, 72 h by CCK8 (n = 8). (G) Live/dead staining assay of HOS cells transfected with mimic-miR-26a-5p. (H) Western blot of apoptosis-related proteins levels and quantitative analysis (n = 3) in HOS cells. (I) TUNEL staining assay of HOS cells transfected with mimic-miR-26a-5p. Data are means ± SD. ns, not significant; p ≥ 0.05; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001.

lncTUG1 up-regulates ZBTB7C via inhibiting miR-26a-5p

To further explore the core target genes targeted by miR-26a-5p functionally relevant to OS, we performed RNA-sequencing and discovered 855 differentially-regulated genes (587 down-regulated and 268 up-regulated) [Fig. 3A and B]. The Kyoto Encylopaedia of Genes and Genomes (KEGG) analysis showed that the differential genes were enriched in many entries of signaling pathways and miRNAs related to tumorigenesis [Fig. 3C]. Further analysis of miR-26a-5p target genes by TargetScan (|log2 Fold change|≥ 1 and q < 0.05) revealed that ZBTB7C (also called KR-POK), a BTB-POZ family transcription factor with proto–oncogenic activity [31], was among the top target genes [Fig. 3D] and down-regulated at both mRNA and protein levels by miR-26a-5p mimics in OS cells (mimic miR), respectively [Fig. 3E]. To verify that ZBTB7C is a direct target of miR-26-a-5p, we constructed a luciferase-ZBTB7C 3′UTR report plasmid and a plasmid harboring the ZBTB7C 3′UTR with a mutated miR-26a-5p site (ACUUGA converted to CAGGUC, [Fig. 3F]). We transfected the plasmids separately into HOS cells plus miR-26a-5p mimics and found that miR-26a-5p mimic significantly decreased the luciferase activity of the wild-type ZBTB7C 3′UTR reporter, but not the vector control or the mutant reporter, confirming that ZBTB7C is a direct target of miR-26a-5p. Further, we transfected a miR-26a-5p inhibitor (miR in) [Fig. 3G] and found that lncTUG1 knockdown-incurred ZBTB7C repression was blocked by miR-26a-5p inhibitor [Fig. 3H]. Consistently, we detected elevations of ZBTB7C expression in both OS cell lines and OS clinical samples [Fig. 3I and S2]. Collectively, these data indicate that ZBTB7C is directly regulated by miR-26a-5p in OS cells.

Fig. 3.

Fig. 3

miR-26a-5p targeting ZBTB7C regulated by lncTUG1. (A) The volcano map and heatmap of the differentially expressed genes. (B) The statistics of the differentially expressed genes in HOS cells transfected with mimic miR-26a-5p. (C) KEGG pathway enrichment of the differentially expressed genes in HOS cells transfected with mimic miR-26a-5p. (D) Genes Venn diagrams of hsa-miR-26a-5p targeting by the TargetScan database and differentially expressed genes by transcriptome sequencing. (E) Relative ZBTB7C protein by Western blot (n = 3) and mRNA by qRT-PCR (n = 6) expression in HOS cells transfected with mimic-miR-26a-5p. (F) Mutation site design and relative activity of the wild-type or mutant ZBTB7C 3′UTR firefly luciferase reporter in HOS cells transfected with mimic miR-26a-5p (n = 8). (G) miR-26a-5p expression identification of HOS cells transfected with miR-26a-5p inhibitor (miR in) by qRT-PCR (n = 6). (H) Western blot of ZBTB7C protein and quantitative analysis (n = 3) in lncTUG1-knockdown and miR-26a-5p-inhibition HOS cells. (I) Western blot of ZBTB7C protein and quantitative analysis (n = 3) in OS cell lines. Data are means ± SD. ns, not significant; p ≥ 0.05; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001.

ZBTB7C knockdown inhibits the proliferation and induces apoptosis of OS cells

To confirm the role of ZBTB7C in OS progression, we constructed three ZBTB7C knockdown siRNAs (siZB-1, siZB-2 and siZB-3), among them siZB-3 showed the highest knockdown efficacy [Fig. 4A–C]. As shown in [Fig. 4D and E], HOS cells transfected with these siRNAs displayed reduced cell proliferation, more dead cells (CCK8 assay and live/dead cell staining), apoptotic expressions of altered BAX, CASP1, Cl. cas3 and BCL2 [Fig. 4F and G], and increased apoptotic cells (TUNEL assay, [Fig. 4H]). These findings provide clear evidence that ZBTB7C is a pro-OS protein.

Fig. 4.

Fig. 4

ZBTB7C expression is positively correlated with OS growth. (A and B) Western blot of ZBTB7C protein expression and corresponding quantitative analysis (n = 3) in HOS cells transfected with ZBTB7C-knockdown siRNAs (siZB-1, siZB-2 and siZB-3). (C) Relative ZBTB7C mRNA level in ZBTB7C-knockdown HOS cells by qRT-PCR(n = 6). (D) Cell proliferation of ZBTB7C-knockdown HOS cells at 24 h, 48 h, 72 h by CCK8 (n = 8). (E) Live/dead staining assay of ZBTB7C-knockdown HOS cells. (F and G) Western blot of apoptosis-related proteins levels and quantitative analysis (n = 3) in ZBTB7C-knockdown HOS cells. (H) TUNEL staining assay of ZBTB7C-knockdown HOS cells. Data are means ± SD. ns, not significant; p ≥ 0.05; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001.

ZBTB7C is essential for the pro-OS activities of lncTUG1 in vivo

To further confirm the functional role of lncTUG1 regulation of ZBTB7C in OS in vivo, we compared the anti-OS effects of lncTUG1 knockdown between the control OS cells and OS cells overexpressing ZBTB7C (ZBTB7C OE) by lentivirus in an OS xenograft mouse model. The results showed that ZBTB7C overexpression promoted, while lncTUG1 knockdown inhibited, the OS cell growth, however, the inhibitory effects were significantly reduced in OS cells overexpressing ZBTB7C [Fig. 5A–C]. Consistently, the histology and immunohistochemistry staining of Ki67, Cl. Cas3 and CD31 exhibited similar alteration patterns [Fig. 5D]. Taken together, these data confirm that ZBTB7C is essential for the pro-OA effects of lncTUG1.

Fig. 5.

Fig. 5

LncTUG1 inhibited ZBTB7C-mediated tumor growth in vivo. BALB/c nude mice (n = 5) grafted with HOS cells or the same cells transduced with vehicle control, ZBTB7C-overexpression (ZBTB7C OE) lentivirus, then treated with or without silncTUG1, monitored for 27 days. (A) Tumor volumes of OS xenografts (n = 5). (B) Photographs of OS-bearing mice. Scale bars, 2 cm. (C) Tumor weight of OS-bearing mice (n = 5). (D) Representative H&E, Ki-67, Cl. Cas3, and CD31 staining of OS xenografts. Data are means ± SEM. ns, not significant; p ≥ 0.05; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001.

Discussion

LncRNA-miRNA-mRNA networks have emerged as important contributors to tumorigenesis. In this study, we discovered that lncTUG1 was preferentially upregulated in OS cells and clinical samples, which correlated with reduced miR-26a-5p and upregulated oncoprotein ZBTB7C. We further confirmed that siRNA-mediated lncTUG1 knockdown reversed the miR-26a-5p and ZBTB7C alterations and suppressed proliferation and enhanced apoptosis of OS cells in a miR-26a-5p and ZBTB7C dependent manner. Our results demonstrated that lncTUG1, miR-26a-5p and ZBTB7C formed an important signaling pathway critically involved in OS progression [Fig. 6].

Fig. 6.

Fig. 6

The mimic mechanism of lncTUG1 regulating OS apoptosis via the miR-26a-5p/ZBTB7C axis. Aberrant lncTUG1 activates ZBTB7C expression by sponging miR-26a-5p to promote OS progression.

Identification of the lncTUG1/miR-26a-5p/ZBTB7C signaling pathway critically involved in OS progression is an important discovery of our study. LncTUG1 is known to regulate p53 [32,33], and function as an oncogene in several types of cancers [15,34]. Further, its oncogenic effects are related to large tumor size, advanced pathological stages and distant metastasis [[35], [36], [37]]. Previous studies have established that lncTUG1 can work as a dynamic scaffold or a direct guider for downstream target genes in cancer tissues [38,39]; however, its most prominent mode of action in OS is to behave like a sponge of various miRNAs to affect mRNAs of some core OS genes. For example, lncTUG1 can absorb miR-337–3p, miR-140–5p and miR-212–3p to enhance Ezrin [17], PFN2 [40] and FOXA1 [41], respectively, during OS progression. In this study, we found that lncTUG1 elevation coincided with reduced miR-26a-5p and increased ZBTB7C. We provided clear evidence that lncTUG1 activated ZBTB7C via sponging miR-26a-5p and lncTUG1 silencing inhibited OS progression in a ZBTB7C overexpression-sensitive manner. Together with other studies, these data suggest that lncTUG1 affects OS via multiple signaling pathways and different downstream targets.

Another intriguing observation of our study is that we identified miR-26a-5p as an important link of aberrant lncTUG1 and ZBTB7C upregulation. We initially identified miR-26a-5p as a key target of lncTUG1 in OS by bioinformatics analysis of ENCORI and miRcancer database and we then confirmed its regulation by lncTUG1 via lncTUG1-knockdown assay and further identified ZBTB7C as its functional target, as miR-26a-5 overexpression reduced ZBTB7C and inhibited OS cell proliferation and activated OS apoptosis. The regulatory mechanisms of miRNAs expression aberration under many pathological conditions are unclear. miR-26a-5p seems to be a major miRNA that mediates the lncRNAs regulation of several important genes, such as lncSNHG5/TRPC6 [42], lncGAS5/PDE4B [43] and lncTUG1/MMP14 [44]. MiRNAs exercises their regulatory role by binding to the 5-untranslated region (5′UTR), coding sequence (CDS) and 3′-untranslated region (3′UTR) of the target mRNAs [45]. The 3′UTR of ZBTB7C mRNA contains a seed sequence of miR-26a-5p (ACUUGA) and the mutation of the sequence abrogated its regulation by miR-26a-5p. Based on these observations, we conclude that miR-26a-5p mediates the oncogenic effects of lncTUG1 and ZBTB7C aberrations during OS progression.

ZBTB7C is an important transcriptional factor that can function either as a tumor suppressor or a proto-oncoprotein [38,39]. Aberrant ZBTB7C expressions have been observed in various tumors. For example, ZBTB7C expression level is low in colorectal cancer [46], but our previous [20] and current study discovered that ZBTB7C was highly expressed in OS, and ZBTB7C overexpression enhanced OS progression. In addition, although aberrant ZBTB7C expressions have been reported in different cancers, the information regarding its expression regulation is largely unknown. We have previously shown that sustained ZBTB7C expression in OS is mediated by METTL3-incurred m6A modification [20]. Here, we further found that lncTUG1 targeted miR-26a-5p and released the miR-26a-5p suppression of ZBTB7C, resulting in enhanced OS progression. Our results support that ZBTB7C is a pro-OS protein in OS and its epigenetic upregulation by lncTUG1/miR-26a-5p axis contributes significantly to OS.

It is noteworthy that although we discovered the critical roles of the lncTUG1-miR-26a-5p-ZBTB7C network in OS cell proliferation, apoptosis and OS progression in cell assays and a xenograft mouse model, these results need further validation by endogenous mouse OS models or clinical OS patients. Also, it remains to be determined whether the lncTUG1-miR-26a-5p-ZBTB7C network is specific to OS or generally applicable to other types of cancers.

Conclusions

In conclusion, our results demonstrate that lncTUG1, miR-26a-5p and ZBTB7C form an important signaling pathway critically involved in OS progression, and that lncTUG1 inhibition by siRNA-mediated knockdown or other alternative strategies are potentially effective for OS treatments.

Ethics approval and consent to participate

The research was approved by the Ethics Committee and the Institutional Animal Care and Use Committee of Drum Tower Hospital, Nanjing University Medical School.

Consent for publication

Not applicable.

Availability of data and materials

Please contact the corresponding author for all data requests.

Funding

This work was supported by Key Program of NSFC (81730067), Major Project of NSFC (81991514), Jiangsu Provincial Key Medical Center Foundation, Jiangsu Provincial Medical Outstanding Talent Foundation, Jiangsu Provincial Medical Youth Talent Foundation and Jiangsu Provincial Key Medical Talent Foundation. the Fundamental Research Funds for the Central Universities (14380493, 14380494).

Declaration of competing interest

The authors declare that they have no competing interests.

Footnotes

Peer review under responsibility of Chang Gung University.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.bj.2023.100651.

Contributor Information

Xingquan Xu, Email: xuxingquan12345@163.com.

Jianmei Chen, Email: cjm@yzu.edu.cn.

Wangsen Cao, Email: wangsencao@nju.edu.cn.

Qing Jiang, Email: qingj@nju.edu.cn.

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Multimedia component 1
mmc1.doc (976.5KB, doc)

References

  • 1.Ekhtiari S, Chiba K, Popovic S, Crowther R, Wohl G, Kin On Wong A, et al. First case of osteosarcoma in a dinosaur: a multimodal diagnosis. Lancet Oncol. 2020;21(8) doi: 10.1016/S1470-2045(20)30171-6. 1021-507. [DOI] [PubMed] [Google Scholar]
  • 2.Wu W, Guo H, Jing D, Zhang Z, Zhang Z, Pu F, et al. Targeted delivery of PD-L1-derived phosphorylation-mimicking peptides by engineered biomimetic nanovesicles to enhance osteosarcoma treatment. Adv Healthcare Mater. 2022;11(23) doi: 10.1002/adhm.202200955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Meltzer P.S, Helman L.J. New horizons in the treatment of osteosarcoma. N Engl J. 2021;385(22) doi: 10.1056/NEJMra2103423. 2066-76. [DOI] [PubMed] [Google Scholar]
  • 4.Wittig J.C, Bickels J, Priebat D, Jelinek J, Kellar-Graney K, Shmookler B, et al. Osteosarcoma: a multidisciplinary approach to diagnosis and treatment. Am Fam Physician. 2002;65(6) 1123-32. [PubMed] [Google Scholar]
  • 5.Gorlick R, Janeway K, Lessnick S, Randall R.L, Marina N, Committee C.O.G.B.T. Children’s Oncology Group’s 2013 blueprint for research: bone tumors. Pediatr Blood Cancer 2013;60(6):1009–15. [DOI] [PMC free article] [PubMed]
  • 6.Yin J, Pan S, Guo X, Gao Y, Zhu D, Yang Q, et al. Nb2C MXene-functionalized scaffolds enables osteosarcoma phototherapy and angiogenesis/osteogenesis of bone defects. Nano-Micro Lett. 2021;13(1):30. doi: 10.1007/s40820-020-00547-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jing Z, Ni R, Wang J, Lin X, Fan D, Wei Q, et al. Practical strategy to construct anti-osteosarcoma bone substitutes by loading cisplatin into 3D-printed titanium alloy implants using a thermosensitive hydrogel. Bioact Mater. 2021;6(12) doi: 10.1016/j.bioactmat.2021.05.007. 4542-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liao J, Han R, Wu Y, Qian Z. Review of a new bone tumor therapy strategy based on bifunctional biomaterials. Bone Res. 2021;9(1):18. doi: 10.1038/s41413-021-00139-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhu S, Liu Y, Wang X, Wang J, Xi G. lncRNA SNHG10 promotes the proliferation and invasion of osteosarcoma via wnt/beta-catenin signaling. Mol Ther Nucleic Acids. 2020;22 doi: 10.1016/j.omtn.2020.10.010. 957-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Paraskevopoulou M.D, Hatzigeorgiou A.G. Analyzing MiRNA-LncRNA interactions. Methods Mol Biol. 2016;1402 doi: 10.1007/978-1-4939-3378-5_21. 271-86. [DOI] [PubMed] [Google Scholar]
  • 11.Dong Z, Wang Y. LncRNA BLACAT1 accelerates the proliferation and migration of osteosarcoma cells through regulating STAT3. Pathol Res Pract. 2019;215(3) doi: 10.1016/j.prp.2019.01.017. 571-9. [DOI] [PubMed] [Google Scholar]
  • 12.Xing C.Y, Zhang Y.Z, Hu W, Zhao L.Y. LINC00313 facilitates osteosarcoma carcinogenesis and metastasis through enhancing EZH2 mRNA stability and EZH2-mediated silence of PTEN expression. Cell Mol Life Sci. 2022;79(7):382. doi: 10.1007/s00018-022-04376-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Khalil A.M, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A. 2009;106(28) doi: 10.1073/pnas.0904715106. 11667-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tasaki Y, Suzuki M, Katsushima K, Shinjo K, Iijima K, Murofushi Y, et al. Cancer-specific targeting of taurine-upregulated gene 1 enhances the effects of chemotherapy in pancreatic cancer. Cancer Res. 2021;81(7) doi: 10.1158/0008-5472.CAN-20-3021. 1654-66. [DOI] [PubMed] [Google Scholar]
  • 15.Huang M.D, Chen W.M, Qi F.Z, Sun M, Xu T.P, Ma P, et al. Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2. Mol Cancer. 2015;14:165. doi: 10.1186/s12943-015-0431-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yuan J.B, Gu L, Chen L, Yin Y, Fan B.Y. Annexin A8 regulated by lncRNA-TUG1/miR-140-3p axis promotes bladder cancer progression and metastasis. Mol Ther Oncolytics. 2021;22:36–51. doi: 10.1016/j.omto.2021.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yao Q, Li Y, Pei Y, Xie B. Long non-coding RNA taurine up regulated 1 promotes osteosarcoma cell proliferation and invasion through upregulating Ezrin expression as a competing endogenous RNA of micro RNA-377-3p. Bioengineered. 2022;13(1) doi: 10.1080/21655979.2021.1995578. 1767-78. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 18.Yu X, Hu L, Li S, Shen J, Wang D, Xu R, et al. Long non-coding RNA Taurine upregulated gene 1 promotes osteosarcoma cell metastasis by mediating HIF-1alpha via miR-143-5p. Cell Death Dis. 2019;10(4):280. doi: 10.1038/s41419-019-1509-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li G, Liu K, Du X. Long non-coding RNA TUG1 promotes proliferation and inhibits apoptosis of osteosarcoma cells by sponging miR-132-3p and upregulating SOX4 expression. Yonsei Med J. 2018;59(2) doi: 10.3349/ymj.2018.59.2.226. 226-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.An X, Wu W, Yang L, Dong J, Liu B, Guo J, et al. ZBTB7C m6A modification incurred by METTL3 aberration promotes osteosarcoma progression. Transl Res. 2023;259:62–71. doi: 10.1016/j.trsl.2023.04.005. [DOI] [PubMed] [Google Scholar]
  • 21.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7) doi: 10.1038/nmeth.2019. 676-82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gao Y, Shang S, Guo S, Li X, Zhou H, Liu H, et al. Lnc2Cancer 3.0: an updated resource for experimentally supported lncRNA/circRNA cancer associations and web tools based on RNA-seq and scRNA-seq data. Nucleic Acids Res. 2021;49(D1):D1251–8. doi: 10.1093/nar/gkaa1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Xie B, Ding Q, Han H, Wu D. miRCancer: a microRNA-cancer association database constructed by text mining on literature. Bioinformatics. 2013;29(5) doi: 10.1093/bioinformatics/btt014. 638-44. [DOI] [PubMed] [Google Scholar]
  • 24.Li J.H, Liu S, Zhou H, Qu L.H, Yang J.H. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 2014;42(Database issue):D92–7. doi: 10.1093/nar/gkt1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019;47(W1):W556–60. doi: 10.1093/nar/gkz430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.McGeary S.E, Lin K.S, Shi C.Y, Pham T.M, Bisaria N, Kelley G.M, et al. The biochemical basis of microRNA targeting efficacy. Science. 2019;366(6472):eaav1741. doi: 10.1126/science.aav1741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Eptaminitaki GC, Stellas D, Bonavida B, Baritaki S. Long non-coding RNAs (lncRNAs) signaling in cancer chemoresistance: from prediction to druggability. Drug Resist Updates. 2022;65:100866. doi: 10.1016/j.drup.2022.100866. [DOI] [PubMed] [Google Scholar]
  • 28.Tu Z, Hu Y, Raizada D, Bassal MA, Tenen DG, Karnoub AE. Long noncoding RNA-mediated activation of PROTOR1/PRR5-AKT signaling shunt downstream of PI3K in triple-negative breast cancer. Proc Natl Acad Sci U S A. 2022;119(43) doi: 10.1073/pnas.2203180119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cheng R, Li F, Zhang M, Xia X, Wu J, Gao X, et al. A novel protein RASON encoded by a lncRNA controls oncogenic RAS signaling in KRAS mutant cancers. Cell Res. 2022;33(1):30-45 doi: 10.1038/s41422-022-00726-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sheng K, Li Y. LncRNA TUG1 promotes the development of osteosarcoma through RUNX2. Exp Ther Med. 2019;18(4) doi: 10.3892/etm.2019.7880. 3002-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Choi WI, Yoon JH, Song JY, Jeon BN, Park JM, Koh DI, et al. Zbtb7c is a critical gluconeogenic transcription factor that induces glucose-6-phosphatase and phosphoenylpyruvate carboxykinase 1 genes expression during mice fasting. Biochim Biophys Acta Gene Regul Mech. 2019;1862(6) doi: 10.1016/j.bbagrm.2019.04.001. 643-56. [DOI] [PubMed] [Google Scholar]
  • 32.Zhang E, He X, Yin D, Han L, Qiu M, Xu T, et al. Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric cancer and regulates cell proliferation by epigenetically silencing of p57. Cell Death Dis. 2016;7(2) doi: 10.1038/cddis.2015.356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lai L, Wang Y, Peng S, Guo W, Li F, Xu S. P53 and taurine upregulated gene 1 promotes the repair of the DeoxyriboNucleic Acid damage induced by bupivacaine in murine primary sensory neurons. Bioengineered. 2022;13(3) doi: 10.1080/21655979.2022.2048985. 7439-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li Z, Shen J, Chan MT, Wu WK. TUG1: a pivotal oncogenic long non-coding RNA of human cancers. Cell Prolif. 2016;49(4) doi: 10.1111/cpr.12269. 471-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yang B, Tang X, Wang Z, Sun D, Wei X, Ding Y. TUG1 promotes prostate cancer progression by acting as a ceRNA of miR-26a. Biosci Rep 2018;38(5): BSR20180677. [DOI] [PMC free article] [PubMed]
  • 36.Zhou Y, Lu Y, Li R, Yan N, Li X, Dai T. Prognostic role of long non-coding RNA TUG1 expression in various cancers: a meta-analysis. Oncotarget. 2017;8(59) doi: 10.18632/oncotarget.20037. 100499-507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tang Q, Li X, Chen Y, Long S, Yu Y, Sheng H, et al. Solamargine inhibits the growth of hepatocellular carcinoma and enhances the anticancer effect of sorafenib by regulating HOTTIP-TUG1/miR-4726-5p/MUC1 pathway. Mol Carcinog. 2022;61(4) doi: 10.1002/mc.23389. 417-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bencivenga D, Stampone E, Vastante A, Barahmeh M. Della Ragione F, Borriello A. An unanticipated modulation of cyclin-dependent kinase inhibitors: the role of long non-coding RNAs. Cells. 2022;11(8):1346. doi: 10.3390/cells11081346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zilio N, Codlin S, Vashisht AA, Bitton DA, Head SR, Wohlschlegel JA, et al. A novel histone deacetylase complex in the control of transcription and genome stability. Mol Cell Biol. 2014;34(18) doi: 10.1128/MCB.00519-14. 3500-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zhao ZY, Zhao YC, Liu W. Long non-coding RNA TUG1 regulates the progression and metastasis of osteosarcoma cells via miR-140-5p/PFN2 axis. Eur Rev Med Pharmacol Sci. 2019;23(22) doi: 10.26355/eurrev_201911_19541. 9781-92. [DOI] [PubMed] [Google Scholar]
  • 41.Xie C, Chen B, Wu B, Guo J, Cao Y. LncRNA TUG1 promotes cell proliferation and suppresses apoptosis in osteosarcoma by regulating miR-212-3p/FOXA1 axis. Biomed Pharmacother. 2018;97 doi: 10.1016/j.biopha.2017.12.004. 1645-53. [DOI] [PubMed] [Google Scholar]
  • 42.Zhou Y, Li ZL, Ding L, Zhang XJ, Liu NC, Liu SS, et al. Long noncoding RNA SNHG5 promotes podocyte injury via the microRNA-26a-5p/TRPC6 pathway in diabetic nephropathy. J Biol Chem. 2022;298(12):102605. doi: 10.1016/j.jbc.2022.102605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Xu S, Wang Y, Li Z, Hua Q, Jiang M, Fan X. LncRNA GAS5 knockdown mitigates hepatic lipid accumulation via regulating MiR-26a-5p/PDE4B to activate cAMP/CREB pathway. Front Endocrinol. 2022;13:889858. doi: 10.3389/fendo.2022.889858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tian L, Zhao ZF, Xie L, Zhu JP. Taurine up-regulated 1 accelerates tumorigenesis of colon cancer by regulating miR-26a-5p/MMP14/p38 MAPK/Hsp27 axis in vitro and in vivo. Life Sci. 2019;239:117035. doi: 10.1016/j.lfs.2019.117035. [DOI] [PubMed] [Google Scholar]
  • 45.Kamenova S, Aralbayeva A, Kondybayeva A, Akimniyazova A, Pyrkova A, Ivashchenko A. Evolutionary changes in the interaction of miRNA with mRNA of candidate genes for Parkinson’s disease. Front Genet. 2021;12:647288. doi: 10.3389/fgene.2021.647288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen X, Jiang Z, Pu Y, Jiang X, Xiang L, Jiang Z. Zinc finger and BTB domain-containing 7C (ZBTB7C) expression as an independent prognostic factor for colorectal cancer and its relevant molecular mechanisms. Am J Transl Res. 2020;12(8) 4141-59. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.doc (976.5KB, doc)

Data Availability Statement

Please contact the corresponding author for all data requests.


Articles from Biomedical Journal are provided here courtesy of Chang Gung University

RESOURCES