Generation of a human induced pluripotent stem cell line (OGIi001) from peripheral blood mononuclear cells of a healthy male donor

Abstract

We have successfully derived a novel human induced pluripotent stem cell (hiPSC) line using non-integrative Sendai virus. This hiPSC line was generated from a healthy male adult donor, aged 55, and subjected to thorough characterization and extensive quality control. The analysis confirmed the expression of undifferentiated stem cell markers, demonstrated the ability to differentiate into the three germ layers, and revealed the absence of any chromosomal abnormalities.

1. Resource Table

nique stem cell line identifier	OGIi001-A
Alternative name(s) of stem cell line	N/A
Institution	Ocular Genomics Institute, Department of Ophthalmology, Massachusetts Eye and Ear, Harvard Medical School
Contact information of distributor	Dr. Marcela Garita-Hernandez mgarita@meei.harvard.edu
Type of cell line	hiPSC
Origin	Human
Additional origin info required for human ESC or hiPSC	Age: 55Sex: Male
Cell Source	Peripheral blood mononuclear cells (PBMC)
Clonality	Clonal
Method of reprogramming	Sendai virus method with the CTS™ CytoTune™-iPS 2.1 Sendai Reprogramming Kit
Genetic Modification	none
Type of Genetic Modification	N/A
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	Negative by RT-qPCR
Associated disease	N/A
Gene/locus	N/A
Date archived/stock date	September 15, 2021
Cell line repository/bank	hPSCreg® website: https://hpscreg.eu/cell-line/OGIi001-A
Ethical approval	IRB protocol number: 2019P001098

2. Resource utility

The derived line will serve as a valuable control line with good retinal organoid generation potential. These retinal organoids mimic the structure and functionality of the human retina, providing a powerful tool for studying retinal development, disease mechanisms, and potential therapeutic interventions.

3. Resource details

The study was approved by the Institutional Review Board (IRB) at the Mass Eye and Ear (Human Studies Committee MEE in USA) and the Health Information Portability and Accessibility Act (HIPAA). All aspects of the project adhered to the tenets of the Declaration of Helsinki. Informed consent was obtained from the participant for sample collection and use of this sample for cell line generation. The isolated peripheral blood mononuclear cells (PBMCs) were expanded and reprogrammed using non-integrating Sendai viral vectors containing the reprogramming factors OCT3/4, SOX2, L-MYC, and KLF4, as per the method established by Yang et al., (Yang et al., 2012). Five hiPSC lines were generated from this donor. To ensure reliability, the data presented in this study is derived from three independent clones that were expanded and fully characterized (see Table 1, Table 2, Fig. 1, Fig. 2, Supplementary Table S1).

Table 1.

Characterization and validation.

Classification	Test	Result		Data
Morphology	Epifluorescence Bright field	Normal		Fig. 1A
Phenotype	Immunocytochemistry	Positive labeling for undifferentiated stem cell markers (OCT4, NANOG, SSEA4, and TRA-1–60)		Fig. 1B
	Qualitative analysis (RT-qPCR)	Expression of undifferentiated stem cell markers at comparable levels of Human ES cells		Fig. 1C
Genotype	Karyotype and resolution	46XY, Band resolution 400–425		Fig. 1D
Identity	STR analysis	STR polymorphisms for 15 loci plus amelogenin (Promega PowerPlex® 16) match PBMCs		Available with the authors
Mutation analysis (IF APPLICABLE)	WES on genomic DNA from peripheral blood	Found no mutations		dbGAp Acession number: phs001272.v1.p1
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence. Result: Negative (B/A ratio < 1)		Supplementary Table S1
	Sendai virus elimination	Sendai virus RNA undetected by RT-qPCR at p6
Differentiation potential	Embryoid body	Proof of three germ layers formation		Fig. 2
List of recommended germ layer markers	Expression of these markers was demonstrated by RT-qPCR and immunofluorescence	RT-qPCR	Ectoderm: GFAP Mesoderm: SMA Endoderm: AFP	Fig. 2A
		Immunofluorescence	Ectoderm: EN1, MAP2 and NR2F2 Mesoderm: HAND2, RGS4 and SNAIL2 Endoderm: AFP, KLF5 and SST	Fig. 2B
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A		N/A
	Blood group genotyping	N/A		N/A
Genotype additional info (OPTIONAL)	HLA tissue typing	N/A		N/A

Table 2.

Reagents details.

1. Antibodies used for immunocytochemistry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency marker	Rabbit Anti-OCT4 polyclonal IgG	1:100	Abcam Cat# 19,857	AB_445175
	Rabbit Anti-NANOG polyclonal IgG	1:50	Abcam Cat# 21,624	AB_446437
	Mouse Anti-SSEA4 monoclonal IgG	1:200	Millipore Cat# MAB4304	AB_177629
	Mouse Anti-TRA-1–60 monoclonal IgM	1:200	Millipore Cat# MAB4360	AB_2119183
Secondary antibody	Donkey anti-Rabbit IgG 488	1:1000	Thermo Fisher Cat# A21206	AB_2535792
	Goat anti-Mouse IgM 555	1:1000	Thermo Fisher Cat# A21426	AB_1500929
	Donkey anti-Mouse IgG 488	1:1000	Thermo Fisher Cat# A21202	AB_141607
Nuclei staining	DAPI	1:1000	Thermo Fisher Cat# 62,248	N/A
2. Primers / Probes
	Target	Amplicon Size	Forward/Reverse primer (5′ – 3′) or Company Assay ID
Housekeeping gene	Beta-actin (pluripotency)	234	GGACTTCGAGCAAGAGATGGAGCACTGTGTTGGCGTACAG
	RPLPO (EBs)	105	Thermo Fisher Assay# Hs99999902_m1
Pluripotency marker	DNMT3B	203	ATAAGTCGAAGGTGCGTCGTGGCAACATCTGAAGCCATTT
	HTERT	166	TGTGCACCAACATCTACAAGGCGTTCTTGGCTTTCAGGAT
	NANOG	149	CAGTCTGGACACTGGCTGAACTCGCTGATTAGGCTCCAAC
	OCT4	150	TGTACTCCTCGGTCCCTTTCTCCAGGTTTTCTTTCCCTAGC
	REX1	181	TGGACACGTCTGTGCTCTTCGTCTTGGCGTCTTCTCGAAC
	SOX2	144	GCTAGTCTCCAAGCGACGAAGCAAGAAGCCTCTCCTTGAA
3. Differentiation markers
Ectoderm	EN1	64	Thermo Fisher Assay# Hs00154977_m1
	MAP2	98	Thermo Fisher Assay# Hs00258900_m1
	NR2F2	145	Thermo Fisher Assay# Hs00819630_m1
Mesoderm	HAND2	62	Thermo Fisher Assay# Hs00232769_m1
	RGS4	73	Thermo Fisher Assay# Hs01111690_g1
	SNAIL2	79	Thermo Fisher Assay# Hs00161904_m1
Endoderm	AFP	72	Thermo Fisher Assay# Hs01040598_m1
	KLF5	87	Thermo Fisher Assay# Hs00156145_m1
	SST	86	Thermo Fisher Assay# Hs00356144_m1

Fig. 1.

Characterization of the OGIi001 hiPSC line.

Fig. 2.

Three germ layer differentiation analysis of OGIi001 hiPSC.

Three weeks post transduction with Sendai virus, 5 colonies were manually selected and passaged for expansion. The expanded human induced pluripotent stem cell (hiPSC) lines exhibited typical characteristics of pluripotent stem cells, including compact colonies with smooth boundaries and a high nucleus to cytoplasm ratio, as shown in Fig. 1A. In order to verify the pluripotency state of these hiPSC clones, undifferentiated stem cell markers were analyzed by immunocytochemistry for OCT4, NANOG, SSEA4, and TRA-1–60 (Fig. 1B) and RT-qPCR analysis for DNMT3B, hTERT, NANOG, OCT4, REX1, and SOX2, (Fig. 1C). The hiPSCs exhibited normal karyotype (46, XY) (Fig. 1D). The trilineage potential of these cells was validated using Immunofluorescence and RT-qPCR on embryoid bodies (EBs) differentiated for 2 weeks (Fig. 2). Day14 EBs showed immunoreactive cells for the trilineage markers, namely ectoderm-GFAP, mesoderm-SMA and endoderm-AFP markers (Fig. 2A). Additionally, the gene expression profile of markers associated with ectoderm (EN1, MAP2, NR2F2), mesoderm (HAND2, RGS4, SNAIL2), and endoderm (AFP, KLF5, SST) in comparison with control group using embryoid bodies generated from a mix of 4 hESC lines, is shown in Fig. 2B. Furthermore, the identity of the hiPSC line was confirmed by performing STR DNA fingerprinting, which demonstrated a 100 % match to the parental sample (data submitted to the journal). Finally, the resulting hiPSC lines underwent thorough testing, confirming their negative status for Mycoplasma contamination and absence of Sendai virus RNA at passage 6 (refer to Supplementary Table S1 and Supplementary Table S2.).

4. Materials and methods

4.1. Reprogramming of PBMCs into hiPSCs

The expansion and reprogramming of erythroblasts from PBMCs was performed following the previously described method (Yang et al., 2012). Briefly, PBMCs were thawed in StemSpan SFEM II medium supplemented with StemSpan Erythroid expansion supplement and expanded for a duration of 9 days. 100,000 erythroblast cells were then transduced with non-integrative Sendai viral vectors (CTS^™ CytoTune^™-iPS 2.1 Sendai Reprogramming Kit, Thermo Fisher) expressing the human OCT3/4, SOX2, KLF4, and L-MYC reprogramming genes. We followed the manufacturer’s instructions for the multiplicity of infection (MOI 5 for virus carrying Oct4, Sox2 and KLF4; MOI 5 for virus carrying c-Myc and MOI 3 for virus carrying Klf4). Transduced cells were plated onto irradiated mouse embryonic fibroblasts (MEFs) coated cultured dishes and maintained in hESC medium supplemented with 10 ng/mL of basic fibroblast growth factor (bFGF). The medium was replenished every 2 days for a total period of 3 weeks. The cells were maintained under these conditions until uniform colonies were generated, and subsequently, the hiPSC colonies were mechanically picked directly in feeder-free culture condition for expansion.

4.2. Spontaneous differentiation: Embryoid body (EB) model

EBs were generated following an optimized protocol of the previously method described by Garita-Hernandez et al (Garita-Hernandez et al., 2013). Briefly, hiPSC OGIi001-A line was dissociated into single cells using StemPro Accutase (Thermo Fisher) for 4 min at 37 °C. The cell suspension generated was spun down by centrifugation (Beckman Coulter) and pelleted cells were resuspended in EB medium consisting of DMEM/F12 (Thermo Fisher) supplemented with 1x MEM Non-Essential Amino Acids Solution (Thermo Fisher), 20 % KnockOut^™ Serum Replacement (Thermo Fisher), 1 % Penicillin-Streptomycin (Sigma-Aldrich) and 0.1 mM β-mercaptoethanol (Thermo Fisher). HiPSCs were plated at the desired concentration (1000 cells per 100 μL) using a multichannel pipette (Eppendorf) in a U-bottom 96-well plate and were allowed to self-aggregate for 7 days in suspension. After 7 days identical spherical EBs were transferred to a Matrigel coated 24-well plate using a 1000 μL low-retention pipette tips (Thermo Fisher) at a final concentration of 24 EBs per well in 500 ul of EB medium. The EBs were cultured for 7 additional days prior characterization and EB medium was changed every 2–3 days.

4.3. Immunocytochemistry

hiPSC cells were fixed in 4 % paraformaldehyde solution (Boston BioProducts Inc.) for 15 min. Subsequently, the cells were washed with PBS/0.05 %Tween 20 (Gibco and Sigma) and permeabilized with 0.1 % Triton X-100 (Sigma Aldrich) for 20 min. To prevent non-specific binding, the cells were then blocked with 4 % Donkey serum for 1 h at room temperature. Following blocking, cells were incubated with primary antibodies overnight at 4 °C. The primary antibodies used in this study are listed in Table 2. Subsequently, secondary antibodies were applied at room temperature for 1 h. Nuclei were counterstained with DAPI (Invitrogen). Fluorescent microscope (Olympus) was used to capture images.

4.4. RT-PCR and quantitative PCR

RNA isolation from the OGIi001 was performed using the RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions. Reverse transcription was carried out on 1 μg of total RNA using random hexamers and qScript cDNA SuperMix (Quantabio). The resulting cDNA served as a template for quantitative PCR amplification of the viral backbone and pluripotency marker genes (DNMT3B, hTERT, NANOG, OCT4, REX1, and SOX2). For qPCR analysis, a Quantstudio 12 K Flex qPCR machine (Thermo Fisher) was utilized. All experiments were performed in triplicate with TaqMan Gene Expression Master Mix (Thermo Fisher) or SYBR Green (Quantabio). Primers for endogenous genes were listed in Table 2.

The data were normalized to the expression levels of housekeeping gene. Additionally, RNA extracted from embryoid bodies was analyzed by TaqMan Gene Expression assay using probes specific for germ layer markers (ectoderm – EN1, MAP2, NR2F2, mesoderm – HAND2, RGS4, SNAIL2, endoderm – AFP, KLF5, SST). Fold change was calculated using the ddCt method.

4.5. Karyotyping

To assess the genome integrity of the generated hiPSCs at early passage (5–10), the G-banded karyotyping assay (WiCell) was employed.

4.6. Mycoplasma detection

Mycoplasma contamination was tested in the antibiotic-free spent media by utilizing the MycoAlert^™ Plus Mycoplasma Detection Set (Lonza, LT07–318). The absence of mycoplasma contamination was subsequently confirmed according to the manufacturer’s instructions. The assay was designed to give ratios of less than 1 with uninfected cultures. Cells that are infected with mycoplasma produce ratios greater than 1.

4.7. Short tandem repeat (STR) DNA fingerprinting

Genomic DNA was isolated using Qiamp DNA mini kit (Qiagen). Isolated DNA was quantified using NanoVue (GE Healthcare). The DNA was sent to WiCell for STR DNA fingerprinting. STR polymorphisms for 15 loci plus amelogenin were analyzed.

Data availability

Data will be made available on request.