Bone transport induces the release of factors with multi-tissue regenerative potential for diabetic wound healing in rats and patients

Jing Xie; Xuhua Liu; Biaoliang Wu; Bochong Chen; Qiancheng Song; Yuan Guan; Yuanxun Gong; Chengliang Yang; Jinbo Lin; Mingfeng Huang; Xinyu Tan; Ruijun Lai; Xiaozhen Lin; Sheng Zhang; Xiaoling Xie; Xiaoli Chen; Chunyuan Zhang; Mei Yang; Huijiao Nong; Xiaoyang Zhao; Laixin Xia; Weijie Zhou; Guozhi Xiao; Qing Jiang; Weiguo Zou; Di Chen; Di Lu; Jia Liu; Xiaochun Bai

doi:10.1016/j.xcrm.2024.101588

. 2024 May 22;5(6):101588. doi: 10.1016/j.xcrm.2024.101588

Bone transport induces the release of factors with multi-tissue regenerative potential for diabetic wound healing in rats and patients

Jing Xie ^1,^2,¹², Xuhua Liu ^1,^4,¹², Biaoliang Wu ^2,^3,¹², Bochong Chen ¹, Qiancheng Song ¹, Yuan Guan ^2,³, Yuanxun Gong ^2,³, Chengliang Yang ^2,³, Jinbo Lin ¹, Mingfeng Huang ¹, Xinyu Tan ^1,⁴, Ruijun Lai ^1,⁴, Xiaozhen Lin ^2,³, Sheng Zhang ¹, Xiaoling Xie ¹, Xiaoli Chen ¹, Chunyuan Zhang ^2,³, Mei Yang ^2,³, Huijiao Nong ^2,³, Xiaoyang Zhao ⁵, Laixin Xia ⁵, Weijie Zhou ⁶, Guozhi Xiao ⁷, Qing Jiang ⁸, Weiguo Zou ⁹, Di Chen ¹⁰, Di Lu ^11,^∗, Jia Liu ^2,^3,^∗∗, Xiaochun Bai ^1,^4,^13,^∗∗∗

¹Guangdong Province, Guangdong Provincial Key Laboratory of Bone and Joint Degeneration Diseases, Department of Cell Biology, School of Basic Medical Sciences, Southern Medical University, Guangzhou 510515, China

²Affiliated Hospital of Youjiang Medical University for Nationalities, Baise 533000, China

³Guangxi Health Commission Key Laboratory of Biomedical Materials Research, Guangxi Health Commission Key Laboratory of Clinical Medicine Research on Bone and Joint Degenerative Diseases Cohort, Guangxi Biomedical Materials Engineering Research Center for Bone and Joint Degenerative Diseases, Baise 533000, China

⁴Academy of Orthopedics, Guangdong Province, Guangdong Provincial Key Laboratory of Bone and Joint Degeneration Diseases, The Third Affiliated Hospital of Southern Medical University, Guangzhou 510630, China

⁵Department of Developmental Biology, School of Basic Medical Sciences, Southern Medical University, Guangzhou 510515, China

⁶Department of Pathology, Nanfang Hospital, School of Basic Medical Sciences, Southern Medical University, Guangzhou 510515, China

⁷Department of Biochemistry, School of Medicine, Shenzhen Key Laboratory of Cell Microenvironment, Guangdong Provincial Key Laboratory of Cell Microenvironment and Disease Research, Southern University of Science and Technology, Shenzhen 518055, China

⁸State Key Laboratory of Pharmaceutical Biotechnology, Division of Sports Medicine and Adult Reconstructive Surgery, Department of Orthopedic Surgery, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing 210008, China

⁹State Key Laboratory of Cell Biology, Shanghai Institute of Biochemistry and Cell Biology, CAS Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Shanghai 200031, China

¹⁰Research Center for Human Tissue and Organ Degeneration, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China

¹¹Yunnan Key Laboratory of Stem Cell and Regenerative Medicine, Science and Technology Achievement Incubation Center, Kunming Medical University, Kunming 650500, China

^∗

Corresponding author ludi20040609@126.com

^∗∗

Corresponding author liujia0111@live.cn

^∗∗∗

Corresponding author baixc15@smu.edu.cn

¹²

These authors contributed equally

¹³

Lead contact

PMCID: PMC11228591 PMID: 38781961

Summary

Tibial cortex transverse distraction is a surgical method for treating severe diabetic foot ulcers (DFUs), but the underlying mechanism is unclear. We show that antioxidant proteins and small extracellular vesicles (sEVs) with multiple-tissue regenerative potential are released during bone transport (BT) in humans and rats. These vesicles accumulate in diabetic wounds and are enriched with microRNAs (miRNAs) (e.g., miR-494-3p) that have high regenerative activities that improve the circulation of ischemic lower limbs while also promoting neovascularization, fibroblast migration, and nerve fiber regeneration. Deletion of miR-494-3p in rats reduces the beneficial effects of BT on diabetic wounds, while hydrogels containing miR-494-3p and reduced glutathione (GSH) effectively repair them. Importantly, the ginsenoside Rg1 can upregulate miR-494-3p, and a randomized controlled trial verifies that the regimen of oral Rg1 and GSH accelerates wound healing in refractory DFU patients. These findings identify potential functional factors for tissue regeneration and suggest a potential therapy for DFUs.

Keywords: tissue regeneration, diabetic wound healing, bone transport, small extracellular vesicles, ginsenoside

Graphical abstract

Highlights

•
sEVs and antioxidants released during bone transport promote diabetic wound healing
•
The sEVs are enriched with miRNAs (e.g., miR-494-3p) with high regenerative activities
•
Ginsenoside Rg1 upregulates miR-494-3p and promotes diabetic wound healing in rats
•
Oral Rg1 and GSH accelerate refractory diabetic foot ulcer healing in a clinical trial

Xie et al. reveal the mechanism by which bone transport enhances diabetic wound healing via the secretion of small extracellular vesicles and antioxidant proteins. Based on this discovery, a therapeutic protocol involving oral administration of ginsenoside Rg1 and reduced glutathione is investigated for the treatment of recalcitrant diabetic foot ulcers.

Introduction

Diabetic foot ulcers (DFUs) are a common and serious complication of diabetes. DFUs affect 15% of people with diabetes and is a leading cause of amputations.¹ Non-healing wounds impair the quality of life and are associated with increased mortality.² DFUs are caused by diseases of peripheral blood vessels, which produce different degrees of abnormalities in the distal lower limb nerves, resulting in foot infections, ulcers, and deep tissue damage.³ Systemic and local diabetes-related alterations, such as hyperglycemia, an oxidative or proinflammatory state, neuropathy, and tissue hypoxia/impaired vascular adaptation predispose for a reduced inflammatory response upon injury, which results in chronic inflammation and impaired tissue regeneration.³^,⁴ The current standard of care for DFU treatment relies on non-specific local wound care and optimized metabolic control.⁵ Although these treatments can delay the progression of DFUs, the majority of patients with DFUs have a high recurrence rate after treatment and eventually have to undergo amputation.⁶ Therefore, more specific and effective treatment for DFUs is urgently needed.

The Ilizarov bone transport (BT) operation was originally developed to address some complex orthopedic diseases.⁷ The tension-stress effect was thought to activate and enhance the regenerative potential of living tissues, leading to growth or regeneration of muscles, fascia, blood vessels, and nerves simultaneously.⁸ After years of clinical and basic research, researchers have found that the operation not only promotes the repair of bone tissue, but also significantly promotes the regeneration of various peripheral and even distant soft tissues.⁹ Interestingly, the improved Ilizarov tibial cortex transverse distraction (TCTD), a new method for treating diabetic foot based on the tension-stress effect, has been clinically practiced for 10 years in the treatment of severe DFU and has shown a high limb salvage rate (>90%) and <10% 1-year recurrence rate.¹⁰ A recent multi-center cohort study of 1,175 DFU patients demonstrated that TCTD is an effective treatment for refractory DFU patients.¹¹ However, some patients with DFUs are not suitable for surgical treatment, and most importantly, the risk and expense of surgery prevent the use of TCTD in the majority of DFU patients.⁷ Therefore, there is an urgent need to develop an inexpensive, convenient, and effective non-surgical treatment for DFU.

The mechanism by which BT promotes multi-tissue regeneration is currently unclear. It has been shown that a variety of cytokines and hormones, such as vascular endothelial growth factor, bone morphogenetic protein, immune factors, and stromal cell-derived factors, are increased during BT and distraction osteogenesis.¹²^,¹³^,¹⁴ However, no evidence has demonstrated a causal relation between these factors and BT-stimulated regeneration, and how the regenerative potentials are activated during BT is unknown. Elucidating the underlying mechanisms will not only provide a novel theoretical basis for regenerative medicine, but will help develop more convenient, safe, and economical therapy for patients suffering from chronic refractory wounds. In this study, a series of in vitro and in vivo experiments was conducted to reveal the important cellular biological mechanisms by which BT promotes diabetic wound healing, and a randomized controlled trial (RCT) was conducted to seek a potential oral drug treatment for DFU.

In this study, we show that BT promoted diabetic wound healing through the release of antioxidants and small extracellular vesicles (sEVs) enriched with microRNAs (miRNAs) (e.g., miR-494-3p) that have high multi-tissue regenerative potential. We found that the ginsenoside Rg1 could stimulate miR-494-3p expression and that combined use of antioxidants and BT-derived sEVs or Rg1 effectively promoted diabetic wound healing in animal models. Importantly, an RCT verified that the regimen of oral Rg1 and reduced glutathione (GSH) effectively promoted wound healing in refractory DFU patients. These findings identify potential functional factors for diabetic wound tissue regeneration and suggest an effective, convenient, and safe therapy for DFUs.

Results

Release of sEVs is crucial for BT-accelerated wound healing in diabetic patients and rats

To confirm the effect of BT on the healing of DFU, we followed 12 patients with Wagner grade 3 or 4 DFU who received TCTD (Table S1). Figure 1A illustrates the therapeutic effect of TCTD in a typical refractory DFU case, suggesting that BT promoted tissue regeneration.

To replicate the effect of BT on diabetic wounds in animal models, we established a rat model of BT¹² (Figures 1B and S1). A total of 20 Sprague-Dawley rats were randomly divided into sham operation (sham) and BT groups after induction of diabetes by streptozotocin. Compared to the sham group, we observed a significantly faster wound closure rate in the BT group (Figure S2A). Histological assessment of wound tissue by hematoxylin and eosin (H&E) or Masson staining revealed that the wounds in the BT group were highly epithelialized after 10 days of BT (Figures S2B and S2C). In addition, immunofluorescence staining showed that more neovascularization (CD31 positive), fibroblasts (a-SMA positive), and nerve bundles (PGP9.5 positive¹⁵) were observed in the regenerated skin of the BT group compared with the sham group (Figures S2D and S2E). These results indicated that diabetic wound recovery was significantly accelerated by BT in rats.

To explore the mechanism by which BT promotes diabetic wound healing, we first added the plasma of patients obtained before or after BT treatment to cultures of primary human umbilical vein endothelial cells (HUVECs) and human dermal fibroblasts (HDFs). We found that plasma (mass/volume, 4%) from patients after BT markedly promoted HUVEC angiogenesis and HDF migration (Figures 1C and 1D) without affecting their proliferation (Figure S3). Next, we divided the plasma of BT rats into three components: soluble factors, large extracellular vesicles (lEVs), and sEVs¹⁶ and then screened for factors stimulating diabetic wound healing in BT plasma. According to the recommendations of the International Society for Extracellular Vesicles,¹⁷ the purified sEVs were verified by transmission electron microscopy (TEM), NanoSight tracking analysis (NTA), and western blotting of protein markers (CD9, Alix, and TSG101; Figures S4A, S4B, 1E, and 1F). Interestingly, the potential of plasma sEVs from BT rats to promote angiogenesis and fibroblast migration in vitro was much greater than that of the other two components (Figures S4C, S4D, 1G, and 1H). Similarly, this phenomenon was also detected in plasma sEVs from patients (Figures S5A and S5B).

To verify the function of sEVs in BT-stimulated diabetic wound healing, GW4869, an inhibitor of sEV secretion,¹⁸ was injected intravenously into BT rats. It is worth noting that the plasma sEV concentration of BT rats was much higher than that of the sham group, but the amount of sEVs isolated from the plasma of BT rats significantly decreased after GW4869 treatment (Figures 1G and 1H). As expected, the wound-healing speed of BT rats was significantly reduced after GW4869 treatment (Figure 1I). The thickness and collagen deposition (Figures 1J and 1K), level of neovascularization, number of fibroblasts, and nerve bundles in the wound skin of diabetic rats decreased significantly after inhibition of sEV release by GW4869 (Figures 1L and 1M).

We next examined whether the increased plasma sEVs during BT were released from distracted bone tissue. As expected, CD63 (TSG101) expression in rat bone tissue was markedly elevated by BT, and most CD63 (TSG101) was expressed in cells positive for osteocalcin (OCN) in the retractive region (Figures 1N and S6). These results implicated osteoblasts as contributing to the increased plasma sEVs during BT.

Together, the above evidence suggests that secretion of sEVs is essential for BT-accelerated wound healing in diabetic patients and rats.

sEVs released during BT have multiple-tissue regenerative activities for diabetic wound healing

To evaluate the regenerative functions of sEVs produced during BT, we first tested their effect on the remodeling of diabetic terminal circulation in diabetic rat/mouse models of lower limb ischemia. The RFLSI III laser speckle imaging system was used to analyze the blood perfusion rate and blood flow velocity of the ischemic lower limbs. The results showed that BT could significantly promote the reconstruction of terminal circulation in diabetic rats, while GW4869 reversed the effect of BT (Figure S7). To further confirm the effect of BT-sEVs (sEVs derived from plasma of the BT-operated group) on diabetic terminal circulation, normal saline, sham-sEVs (sEVs derived from plasma of the sham-operated group), and BT-sEVs (100 μg/day) were injected intravenously into diabetic mice with lower limb ischemia. As expected, blood flow velocity and perfusion rates were significantly elevated after BT-sEV treatment (Figure 2A). These results suggest that BT-sEVs can promote the reconstruction of terminal circulation in diabetes.

Peripheral neuropathy is one of the common causes of DFU. To determine whether BT-sEVs have the potential to improve peripheral neuropathy in diabetic mice, we selected 8-week-old db/db mice¹⁹ and injected normal saline, sham-sEVs, or BT-sEVs (100 μg/2 days) into their tail veins. After 2 weeks of treatment, the dorsal root ganglion (DRG) neurons of each group of db/db mice were cultured in vitro. Strikingly, BT-sEVs significantly accelerated the growth of DRG neurons from db/db mice as evidenced by increased expression of microtubule-associated protein 2 (Figure 2B). This suggested that BT-sEVs have strong potential for the improvement of diabetic peripheral neuropathy.

Next, we evaluated the therapeutic potential of BT-sEVs for diabetic wounds. sEVs (50 μg/wound) were embedded into chitosan hydrogel (50 μL/wound) with sustained-release effect,²⁰^,²¹ and we applied the hydrogel carrying sEVs to the wounds of diabetic mice. We found that the hydrogel containing BT-sEVs effectively promoted wound healing in diabetic mice (Figure 2C). Similarly, BT-sEVs increased the thickness of regenerated skin and the rate of collagen deposition in diabetic mice (Figures 2D and 2E). Consistently, the levels of neovascularization, fibroblasts, and nerve bundles in the regenerated skin were markedly increased in the BT-sEV but not in the sham-sEV group (Figures 2F and 2G). Moreover, we examined the effects of BT-derived soluble fraction (SF), lEVs, and sEVs on wound healing, and our results revealed that while BT-SF promoted wound closure, BT-sEVs exhibited a relatively more potent capacity to facilitate the healing process (Figures S8A–S8C). Together, this evidence indicates that sEVs secreted during BT have high, multiple-tissue-regenerative potential for diabetic wound healing.

We further examined the ability of BT-sEVs to reach the wound area. We injected PKH67-labeled sham-sEVs or BT-sEVs (100 μg) into diabetic mice with back wounds and detected the distribution of PKH67-sEVs by biophoton imaging.²⁰ Interestingly, PKH67-labeled BT-sEVs were more likely to accumulate in the wound than in the internal organs (Figure 2H), and confocal fluorescence images of the wound further confirmed this finding (Figure 2I). In addition, BT-sEVs were more easily incorporated by HUVECs and HDFs than sham-sEVs (Figures 2J and 2K). Taken together, these results imply that BT-sEVs prefer to accumulate in diabetic wounds.

Antioxidants and proregenerative miRNAs are enriched in plasma and sEVs during BT

sEVs are rich in proteins and miRNAs, which mediate cell-cell communication and play essential roles in health and disease.²² To explore how BT-sEVs promote diabetic wound repair, a proteomic analysis of BT-sEVs and sham-sEVs was performed. KEGG enrichment analysis revealed that glutathione metabolism, folate biosynthesis, and riboflavin metabolism were activated in BT-sEVs (Figure 3A; Table S2). Several antioxidant proteins were upregulated in BT-sEVs, namely glutamate-cysteine ligase catalytic subunit (GCLC), glutathione peroxidase 1 (GPX1), and catalase (CAT), which was verified by western blot (Figure 3B). Proteomic analysis of plasma proteins also detected the upregulation of CAT 14 days after TCTD (Figure S9; Table S3). These antioxidants might reduce the high-glucose-induced oxidative microenvironment to facilitate the regeneration of diabetic wounds. Therefore, two common antioxidant proteins (CAT and GSH) obtained by proteomics were applied to the wounds of diabetic mice, and the results showed that GSH had a better effect (Figures S10A and S10B).

Next, we performed miRNA-sequencing analysis to assess miRNA expression profiles (SRP439980) in plasma sEVs from patients before and 14 days after TCTD. The heatmap of miRNAs (>2-fold changes) in plasma sEVs after TCTD in four patients is shown in Figure S11. Venn diagram showed that only four miRNAs (intersection) were upregulated in the four patients after TCTD (Figure 3C), which were miR-146b-3p, miR-576-5p, miR-411-5p, and miR-494-3p, as shown in Figure 3D. Four upregulated miRNAs and two downregulated miRNAs were verified by real-time quantitative polymerase chain reaction (qPCR; Figure 3E). To determine the regenerative activity of the four upregulated miRNAs in vitro, HUVECs and HDFs were transfected with miRNA mimics or negative controls. We found that miR-146b-3p, miR-576-5p, miR-411-5p, and miR-494-3p significantly enhanced HUVEC angiogenesis and HDF migration (Figures S12A and S12B). However, miR-494-3p showed much stronger activity than the other three. In contrast, inhibitors of miR-494-3p prevented HUVECs and HDFs from undergoing angiogenesis and migration (Figures 3F and 3G). Interestingly, miR-494-3p is conserved in humans, rats, and mice. The level of miR-494-3p in plasma sEVs from BT rats was also much higher than in the sham group (Figure 3H).

To verify the activity of miR-494-3p on wound healing in vivo, we embedded agomirs (20 nmol/wound) into the hydrogel (50 μL/wound) and then applied the agomir-carrying hydrogels to the wounds of diabetic mice. The results showed that agomiR-494-3p effectively promoted wound healing in diabetic mice (Figure 3I). It not only activated fibroblasts, but also promoted wound microvascular regeneration (Figure 3J). In contrast, inhibitors of miR-494-3p blocked the healing process (Figures 3I and 3J).

miR-494-3p targets CRMP4 and contributes to BT-promoted diabetic wound healing

The above data demonstrated that miR-494-3p exerts strong regenerative activity on wound healing in vitro and in vivo. To further investigate the functional role of miR-494-3p in BT-stimulated diabetic wound healing, we constructed miR-494-knockout (miR-494^−/−) rats (Figures 4A, S13A, and S13B). Notably, BT efficiently accelerated the wound healing of diabetic control but not miR-494^−/− rats (Figure 4B). BT induced increased thickness and collagen deposition rates (Figures 4C and 4D), and the extent of neovascularization as well as the numbers of fibroblasts and nerve bundles (Figures 4E and 4F) in the regenerated skin were significantly attenuated in miR-494^−/− rats. These results support the hypothesis that miR-494-3p plays an important role in BT-promoted wound repair of diabetes mellitus.

To identify the target of miR-494-3p, we first applied PicTar and TargetScan to search for putative miRNA targets. Based on the representation of miRNA sites in their 3′ untranslated region (3′ UTR), >100 mRNAs were predicted to be regulated by miRNAs. Among these candidates, eight genes were involved in the suppression of angiogenesis and cell migration, and the four genes with the highest ranking of scores in the prediction program were selected. In order to determine whether miRNAs targeted these genes directly, we cloned the 3′ UTR of the putative targets into a dual luciferase assay system. Reporter assays revealed that miR-494-3p repressed the collapsin-response mediator protein 4 (CRMP4) 3′ UTR (Figure S14). Mutations of the putative miR-494-3p site in the 3′ UTR abrogated the responsiveness to miR-494-3p (Figures 4G and 4H).

Next, we determined whether there was a causal correlation between the expression of CRMP4 and wound healing during BT. We found that the level of CRMP4 was decreased in the wound site of the BT group compared to the sham group, while the CRMP4 level in the BT-miR-494^−/− group showed no change, which suggests that CRMP4 may be involved in BT-stimulated wound healing (Figure 4I). Thereafter, transfection of miR-494-3p reduced the level of endogenous CRMP4 protein in HUVECs and HDFs, while inhibition of miR-494-3p significantly increased the level of CRMP4 protein (Figure 4J). We further found that knockdown of CRMP4 produced changes similar to that of miR-494-3p overexpression (Figure 4K). Importantly, the effect of miR-494-3p could be partially restored by overexpression of CRMP4, indicating that CRMP4 is the downstream target of miR-494-3p and promotes diabetic wound healing (Figure 4L). Taken together, these results suggest that miR-494-3p in BT-sEVs downregulated the expression of CRMP4 by directly targeting the CRMP4 3′ UTR, thus contributing to BT-stimulated diabetic wound healing.

Combined use of Rg1 or agomir-494-3p with GSH efficiently accelerates wound healing in diabetic mice

Considering that the high-glucose-induced oxidative microenvironment may prevent wound repair,²³^,²⁴ and that antioxidant levels were enhanced by BT, we mixed agomir-494-3p (20 nmol/wound) and GSH (100 nmol/wound) into chitosan hydrogels (agomir + GSH, 50 μL/wound) and applied them to wounds on the backs of diabetic mice. After 2 weeks of observation, we found that the efficiency of the combination regimen was much better than that of agomir-494-3p alone (Figures 5A–5E). We used 8-hydroxydeoxyguanosine (8-OHdG) as a biomarker to evaluate oxidative damage and repair in vivo.²⁴ Immunohistochemical staining showed that the mixed regimen produced less 8-OHdG expression than did agomir-494-3p alone (Figure 5F). These findings suggest that the combination of miR-494-3p and antioxidants might improve the local redox environment, promote wound repair under hyperglycemia, and mobilize multi-tissue regeneration.

Combined use of agomir-494-3p and GSH efficiently accelerates wound healing in diabetic mice

(A) Gross view of the wounds over time in each group of mice. The wounds in the control group had no dressing, while wounds in the other two groups were treated with chitosan hydrogel containing agomiR-494-3p or agomiR-494-3p + GSH. ImageJ software was applied to quantitatively analyze the wound healing rate of the groups (n = 6 biological replicates).

(B and C) Representative images of H&E and Masson staining of regenerated skin tissue of mice in each group. The granulation tissue thickness and collagen remodeling of the regenerated skin were quantitatively analyzed by ImageJ software. Scale bars: 100 μm (n = 6 biological replicates).

(D and E) Representative immunofluorescence images of regenerated skin were taken by confocal microscope. The red represents a-SMA, the green represents CD31, and DAPI-stained nuclei are blue (D). In (E), green shows PGP9.5 staining, while DAPI-stained nuclei are blue. ImageJ software was applied to analyze the number of CD31-positive blood vessels, the number of a-SMA-positive cells, and the proportion of the PGP9.5-positive nerve bundle area in the regenerated skin of mice in each group. Scale bars: 50 μm (n = 6 biological replicates).

(F) Representative immunohistochemical staining and quantitation of expression of 8-OHdG in the regenerated skin. Scale bar: 100 μm (n = 6 biological replicates). Data are presented as the mean ± SD. ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

As miRNAs are not suitable for clinical use at this stage,²⁵ we next tried to screen for drugs that could elevate miR-494-3p expression for DFU treatment. We screened the drug library of natural products (Selectable Natural Product Library L6020, TargetMol, Shanghai, China) and obtained three drugs that could promote the expression of endogenous miR-494-3p, namely ginsenoside Rg1 (120 μM), silibinin (20 μM), and hinokitiol (10 μM).²⁶^,²⁷^,²⁸ Ginsenoside Rg1, the major active component isolated from Panax notoginseng, with a variety of functions and applications,²⁹ markedly increased the expression of endogenous miR-494-3p in HUVECs and HDFs (Figures 6A and 6B). The drug also exhibited strong activity promoting HUVEC angiogenesis and HDF migration (Figures 6C and 6D). Furthermore, the level of miR-494-3p in plasma from diabetic mice with oral Rg1 (10 mg/kg) after 24 h was significantly increased (Figure 6E), indicating that Rg1 could enhance miR-494-3p level in vivo. Strikingly, similar to agomir-494-3p + GSH, Rg1 + GSH (125 nmol Rg1/wound,³⁰ 100 nmol GSH nmol/wound) also accelerated wound healing in diabetic mice (Figure 6F). Meanwhile, the thickness, collagen accumulation rate, neovascularization, number of fibroblasts and nerve bundles, and antioxidant level of regenerated skin in the Rg1 + GSH group were significantly improved (Figures 6G–6K). Taken together, these results indicate that combined use of Rg1 or agomir-494-3p with antioxidant GSH could efficiently accelerate wound repair in diabetic mice.

Combined use of ginsenoside Rg1 and GSH efficiently accelerates wound healing in diabetic mice

(A and B) The relative contents of miR-494-3p in HUVECs and HDFs treated with silibinin, hinokitiol, and ginsenoside Rg1 were compared by real-time qPCR (n = 3 biological replicates).

(C and D) Angiogenesis and migration of HUVECs and HDFs treated with hinokitiol, silibinin, and ginsenoside Rg1. Scale bars: 50 μm (n = 3 biological replicates).

(E) The relative contents of miR-494-3p in the plasma of diabetic mice in the control group and the oral ginsenoside Rg1 group were compared by real-time qPCR (n = 6 biological replicates).

(F) Gross view of the wounds over time in each group of mice. The wounds in the control group had no dressing, while the wounds in the other two groups were treated with chitosan hydrogel containing ginsenoside Rg1 or ginsenoside Rg1 + GSH. ImageJ software was applied to quantitatively analyze the wound healing rate of the groups (n = 6 biological replicates).

(G and H) Representative images of H&E and Masson staining of regenerated skin tissue of mice in each group. The granulation tissue thickness and collagen remodeling of the regenerated skin were quantitatively analyzed by ImageJ software. Scale bars: 50 μm (n = 6 biological replicates).

(I and J) Representative immunofluorescence images of regenerated skin were taken by confocal microscope. The red represents a-SMA, green represents CD31, and DAPI-stained nuclei are blue (I). In (J), green shows PGP9.5 staining and DAPI-stained nuclei are blue. ImageJ software was applied to analyze the number of CD31-positive blood vessels, the number of a-SMA-positive cells, and the proportion of the PGP9.5-positive nerve bundle area in the regenerated skin of mice in each group. Scale bars: 50 μm (n = 6 biological replicates).

(K) Representative immunohistochemical staining and quantitation of expression of 8-OHdG in the regenerated skin of mice in each group. Scale bar: 50 μm (n = 6 biological replicates). Data are presented as the mean ± SD. ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

Regimen of oral Rg1 and GSH accelerated wound healing in patients with refractory DFU

To verify the effectiveness of Rg1 + GSH in the treatment of refractory DFU patients, a randomized, single-center, placebo-controlled, double-blind trial (ChiCTR 2200055194) was conducted. A total of 66 eligible patients with Wagner grade 2–4 DFU were randomly assigned to treatment: 33 patients were treated with Rg1 (30 mg three times daily) + GSH (400 mg three times daily) orally, and 33 patients were treated with placebo until wound closure or the end of the 12-week trial. All patients received regular local wound care and metabolic control. Despite randomization, a higher proportion of patients in the placebo group than in the Rg1 + GSH group had cerebral infarction (42.4% in the placebo group vs. 12.1% in the Rg1 + GSH group, p = 0.006). There were no significant (p > 0.05) between-group differences in other baseline characteristics (Table S4).

For the primary outcomes, at the end of the 12-week trial, the mean rate of wound contraction was 71.5% (standard deviation [SD] 31.3%) in the placebo group and 91.1% (SD 17.4%) in the Rg1 + GSH group. There were 10 cases (30.3%) in the placebo group and 22 cases (66.7%) in the Rg1 + GSH group that had wound closure (the rate of wound contraction was 100%). Evaluation of effectiveness showed a mean score of 2.9 in the placebo group and 3.6 in the Rg1 + GSH group. For secondary outcomes, deterioration of the wound (increased infection or inflammation) occurred in 6 patients (18.2%) in the placebo group and 0 (0%) in the Rg1 + GSH group. Satisfaction assessments showed a mean score of 1.9 in the placebo group and 3.1 in the Rg1 + GSH group. Differences between groups for all the above data were statistically significant at p < 0.05. Adverse events were reported in 6 patients (18.2%) in the placebo group and in 7 patients (21.2%) in the Rg1 + GSH group. Serious adverse events, including death and infection, were not suspected to be drug related. Other less severe adverse events, nausea (placebo group, 6.1%, and Rg1 + GSH group, 9.1%) and constipation (placebo group, 3.0%, and Rg1 + GSH group, 6.1%), were suspected to be drug related, but these adverse events resolved before the end of the trial. Overall, the oral combination of Rg1 and GSH was safe and well tolerated. Detailed data for each group are provided in Figure 7A.

Regimen of oral Rg1 and GSH accelerates wound healing in patients with refractory DFUs

In a randomized, single-center, placebo-controlled, double-blind trial, 66 patients with Wagner grade 2–4 DFU were evenly randomized to an Rg1 + GSH group (oral Rg1 and GSH) or placebo group (oral placebo). Fasting blood and debridement tissue samples were retained from patients in each group after enrollment and after 2 weeks of treatment.

(A) Primary outcomes, secondary outcomes, and safety analysis of the clinical trial. Items labeled with ∗ are presented as mean (standard deviation) (independent sample t test), items labeled with # are presented as means (Mann-Whitney U test), and other items are presented as frequencies and percentages (chi-squared test).

(B) The levels of miR-494-3p in plasma from the two groups before and after treatment were compared by real-time qPCR (n = 12 biological replicates).

(C) An 2',7'-Dichlorodihydrofluorescein diacetate fluorescent probe was used to compare the changes in ROS content in plasma from the two groups before and after treatment (n = 12 biological replicates).

(D) Representative H&E staining of debridement tissues from the two groups of patients. Scale bar: 100 μm.

(E) Representative immunohistochemical staining and quantification of 8-OHdG expression in the debridement tissues from the two groups of patients. Scale bar: 100 μm (n = 12 biological replicates).

(F) Representative immunofluorescence images of the debridement tissue from the two patient groups were taken under a confocal microscope; red shows a-SMA, and DAPI-stained nuclei are blue. ImageJ software was used to analyze the number of CD31-positive blood vessels in debridement tissue from the two groups of patients. Scale bar: 100 μm (n = 12 biological replicates). Data are presented as the mean ± SD. ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

Furthermore, serum levels of miR-494-3p and reactive oxygen species (ROS) were measured before and 4 weeks after intervention (12 cases each in the Rg1 + GSH group and the placebo group). The levels of miR-494-3p in plasma were significantly enhanced in the Rg1 + GSH group, while there was little change in the placebo group (Figure 7B). Similarly, patients in the Rg1 + GSH group, but not in the placebo group, had a significant reduction in plasma ROS levels (Figure 7C). Meanwhile, wound tissue samples were collected and evaluated histologically. There were still many necrotic cells in the placebo but not in the Rg1 + GSH group tissues (Figure 7D). 8-OHdG and CRMP4 were reduced after 4 weeks of Rg1 + GSH intervention (Figures 7E and S15). Angiogenesis was also enhanced by Rg1 + GSH treatment, as evidenced by CD31 and a-SMA staining (Figure 7F).

Together, these results confirmed that the regimen of oral Rg1 and GSH could significantly accelerate wound healing in patients with refractory DFUs with a high safety profile.

Discussion

The mechanism by which BT stimulates diabetic wound healing remains unclear. This study demonstrated that during BT, sEVs enriched with antioxidant proteins and miRNAs (such as miR-494-3p, with strong multi-tissue regenerative activities) were released. These sEVs accumulated in the wound area to mobilize fibroblasts and promote angiogenesis and nerve axon growth and eventually repaired diabetic wounds. In addition, antioxidant proteins accumulating in BT-derived sEVs and plasma contributed to balancing the redox microenvironment in diabetic wounds. Importantly, the combined use of Rg1 and GSH effectively stimulated miR-494-3p expression and promoted diabetic wound healing in animal models and in refractory DFU patients. To summarize, our findings reveal a mechanism by which BT accelerates diabetic wound healing and suggest a potential therapy for refractory DFU treatment.

Ilizarov TCTD is an effective surgical therapy for severe DFUs, but the feasibility, risk, and expense of surgical treatment prevent the technique from being used in the majority of DFU patients.⁷^,¹⁰^,¹¹ It is urgent to comprehensively understand the mechanism by which BT promotes DFU repair and to seek an alternative strategy. As a kind of mechanical stimulation, BT has been widely applied to the treatment of bone non-union, infected fracture, and chronic refractory wound.⁷^,¹⁰^,¹¹ Published reports mainly focus on the angiogenic function of BT.³¹^,³² The mechanical traction induces a strong angiogenic response, and the blood flow during activation is 10 times higher than normal.³² It stimulates the expression of stromal cell-derived factor 1, which plays an important role in neovascularization.¹⁴ However, no evidence has demonstrated the causal relationships, and angiogenesis is insufficient to explain the robust regenerative activities induced by BT. Our results showed that, during BT, antioxidants and sEVs enriched with strong regenerative miRNAs were released from bone tissue and accumulated in the diabetic wounds. Under hyperglycemia, the BT-derived sEVs reconstruct limb terminal circulation after intravenous injection and promote wound healing by external application via chitosan hydrogels. Importantly, inhibition of sEV release or deletion of miR-494-3p markedly reduced the effect of BT, implicating a causal relationship between BT-derived sEVs and diabetic wound healing. Together, our evidence indicates that BT-derived antioxidants and sEVs are the functional components that have promising therapeutic potential for DFUs.

The effects of diabetes on wound healing are systemic, including hyperglycemia, a proinflammatory state, neuropathy, tissue hypoxia, and angiopathy. Microangiopathy caused by persistent hyperglycemia is one of the main causes of DFUs.³^,⁴ Blood vessels provide nutrients and oxygen to the cells in the wound and vascular growth is an essential part of tissue repair.³³ Furthermore, hyperglycemia inhibits the proliferation and migration of fibroblasts, keratinocytes, and endothelial cells, thus preventing angiogenesis and reepithelialization.³⁴^,³⁵^,³⁶ Systemic hyperglycemia also leads to excessive protein glycosylation and the formation of advanced glycation end products, leading to the overexpression of proinflammatory cytokines, changes in the extracellular matrix, and oxidative damage.⁴^,³⁷ Therefore, for the treatment of DFUs, factors should be multi-functional under the condition of good blood glucose control, for example, by improving the redox environment of the injury, mobilizing the rapid migration of fibroblasts and keratinocytes, and accelerating the deposition of extracellular matrix.³ Based on our findings from severe DFU patients with TCTD and diabetic rats after BT surgery, the enriched antioxidant proteins in BT-derived plasma and sEVs improve the antioxidant environment of the wound, while miR-494-3p makes the wound recover quickly by mobilizing fibroblast migration and accelerating angiogenesis. Previous studies have also found that miR-494 is an angiogenic factor,³⁸ and miR-494 in tumors is a feature of angiogenesis and enhanced metastasis in tumors,³⁹ which supports the potential of miR-494 to promote wound healing.

As sEV and miRNA therapy cannot be widely used in clinical medicine at present,²⁵^,⁴⁰ we screened for drugs that could integrate our findings with clinical practice. We found that Rg1 can enhance the expression of endogenous miR-494-3p and identified the therapeutic effect of Rg1 on diabetic wound repair. Rg1 is the main component underlying various pharmacological actions of ginseng.²⁹ Increasing evidence has shown that Rg1 has a strong proangiogenic effect,²⁹^,⁴¹ and many miRNAs involved in angiogenesis or neuroprotection are regulated by Rg1²⁶^,⁴². Rg1 also has a certain antioxidant effect.⁴³ To further confirm the clinical efficacy and feasibility of Rg1 and GSH, we conducted an RCT on DFU patients with Wagner grade 2–4 diagnoses. Importantly, the healing rate and mean daily wound healing area of DFUs in patients taking drugs was significantly higher than in patients taking placebo, and no obvious adverse reactions were caused, indicating that the regimen can promote the healing of refractory DFUs safely and efficiently.

Most of the reported clinical studies on diabetic wound healing have focused on the local treatment of wounds. It was impressive that the oral Rg1 and GSH regimen significantly promoted refractory DFU healing, achieving a 91.1% wound contraction rate when combined with regular local wound care for 3 months. We speculate that the oral regimen played a systemic role, which duplicated the mode of action of TCTD. This was supported by the evidence that orally taking Rg1 and GSH reduced the oxidative environment and elevated the miR-494-3p level in plasma from DFU patients. Furthermore, Rg1 is one of the most important pharmacologically active components of P. ginseng, with low toxicity and few side effects.²⁹ The reported effects of Rg1 include enhancement of nerve growth factor, anti-inflammation, antioxidation, antiapoptosis, inhibition of excitotoxicity, and maintaining the level of cellular ATP.⁴¹^,⁴²^,⁴³^,⁴⁴^,⁴⁵ Many diseases, including cardiovascular diseases, diabetes, cancer, and neurological disease, have been shown to benefit from Rg1 in animal models or patients.⁴⁶ Because of the various functions of Rg1 on the body, the effects of Rg1 on diabetic wounds may not be specific, and Rg1 cannot replace BT. In addition, the recurrence rate of diabetic foot treated with Rg1 is still unknown. A large-scale multi-center RCT to verify the efficacy, safety, and feasibility of the regimen for refractory DFU treatment is highly warranted.

In summary, we have demonstrated that BT-derived antioxidants and sEVs with high regenerative potential are functional components that can promote diabetic wound healing. Our findings provide a paradigm for the regeneration of diabetic soft tissue through bone regulation. Importantly, the regimen of oral Rg1 and GSH based on our findings exhibited satisfactory clinical efficacy and safety in the treatment of DFU.

Limitations of the study

The mechanisms by which BT facilitates multi-tissue regeneration are complex and remain poorly understood. Our study has provided evidence that BT-derived antioxidants and sEVs play a functional role in promoting diabetic wound healing. However, BT-derived SFs also have a positive influence on diabetic wound repair, and their specific functions are still waiting to be uncovered. Furthermore, the impact of the sEV release inhibitor GW4869 on the secretion profile of SF has yet to be determined. In addition, while an oral treatment regimen combining Rg1 and GSH has shown promise in a preliminary study, its effectiveness and safety must be thoroughly assessed in larger, controlled clinical trials before it can be recommended for routine clinical use.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

Mouse monoclonal anti-8-OHdG	Abcam	ab48508; RRID: AB_867461
Rabbit polyclonal anti-CRMP4	Proteintech	13661-1-AP; RRID: AB_10638641
Mouse monoclonal anti-CD63	Abcam	ab193349 ;RRID: AB_3095976
Rabbit polyclonal anti-OCN	Proteintech	16157-1-AP; RRID: AB_2878225
Rabbit monoclonal anti-a-SMA	Cell Signaling Technology	19245; RRID: AB_2734735
Rabbit monoclonal anti-PGP9.5	Cell Signaling Technology	33575; RRID: AB_3099461
Mouse monoclonal anti-TSG101	Abcam	ab83; RRID: AB_306450
Rabbit polyclonal anti-Alix	Abcam	ab76608; RRID: AB_2042595
Rabbit monoclonal anti-GAPDH	Cell Signaling Technology	2118; RRID: AB_561053
Rabbit polyclonal anti-GCLC	Abclonal	A1038; RRID:AB_2757927
Rabbit polyclonal anti-CAT	Abclonal	A11777; RRID:AB_2758747
Rabbit polyclonal anti-GPX1	Abclonal	A0873; RRID:AB_2757436

Chemicals, peptides, and recombinant proteins

GW4869	Sigma-Aldrich	D1692
Catalase	Sigma-Aldrich	C1345
Reduced glutathione	Sigma-Aldrich	G6013

Critical commercial assays

PKH67 Green Fluorescent Cell Linker Kit	Sigma-Aldrich	PKH67GL
Qiagen miRNeasy Mini kit	Qiagen	217004
miRNA 1st Strand cDNA Synthesis Kit	Vazyme	MR101-02

Deposited data

miRNA expression profiles raw data	This paper	SRA: SRP439980

Experimental models: Cell lines

Human: Umbilical Vein Endothelial Cells	PromoCell	C-12203
Human: Dermal Fibroblasts	PromoCell	C-12302

Experimental models: Organisms/strains

Mouse: B6.BKS(D)-Lepr^db/J	The Jackson Laboratory	JAX: 000697
Rat: Sprague-Dawley-miR-494^-/-	This paper	N/A

Oligonucleotides

Primers of miRNAs (Tables S5 and and S6)	Vazyme	N/A

Software and algorithms

GraphPad Prism	GraphPad Software	Version 8.0
Image J	National Institutes of Health	Version 1.8.0
Laser speckle flow imaging system	RWD Life science Co.,LTD	RFLSI Ⅲ

Open in a new tab

Resource availability

Lead contact

Further information and requests for resources should be directed to the lead contact, Dr. Xiaochun Bai (baixc15@smu.edu.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

•
MiRNA expression profiles raw data have been deposited in the NCBI Sequence Read Archive (SRA) and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Additional data generated or analyzed during this study are included in the supplemental information files.
•
This study does not report original code.
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental model and study participant details

Human participants

From December 2020 to December 2021, 12 DFU patients were admitted to Affiliated Hospital of Youjiang Medical University for Nationalities. Inclusion criteria were DFU patients aged 18 to 80 years with wagner grade 3 or 4. Patients were excluded if they had malignancy, acute critical limb ischemia, autoimmune disease, end-stage renal disease, or stroke. All enrolled patients were treated with TCTD as reported previously¹¹ and were followed up at least once a month for half a year. Ulcers were assessed and photographed at each follow-up visit by medical staff. Fasting venous plasma was collected from patients before and 2 weeks after TCTD. We confirm that our study is compliant with the “Guidance of the Ministry of Science and Technology (MOST) for the Review and Approval of Human Genetic Resources”. Ethics approval was granted by the Human Research Ethics Committee of Affiliated Hospital of Youjiang Medical University for Nationalities (YYFY-LL-2020-12). The study was conducted in accordance with the principles and guidelines of The Declaration of Helsinki. The ulcers in all patients were treated. The clinical characteristics and pathological information of the patients are listed in Table S1. All patients enrolled in this study provided written informed consent.

The clinical trial reported in this study was a single-center, double-blind, placebo-controlled, randomized clinical trial. Sixty-six patients with diabetic wounds were randomly divided into a placebo group and Rg1+GSH group. Both groups were given comprehensive wound care. This trial was approved by the Human Research Ethics Committee of Affiliated Hospital of Youjiang Medical University for Nationalities (YYFY-LL-2021-10). The inclusion criteria were diabetic foot/wound patients who met the latest diagnostic criteria of diabetes of the American Diabetes Association and were aged 18–80 years with Wagner grades 2–4 diagnoses. The patients had at least one chronic wound that had not healed for 2 weeks with a target diabetic wound surface area between 1 and 50 cm². Patients or their family members understood the requirements of the trial and were willing to actively cooperate with the study. Exclusion criteria included pregnant, lactating or women with reproductive needs; severe renal impairment (creatinine clearance less than 10 ml/min) or patients with any known intolerance or allergy; patients who had undergone surgery or surgical revascularization within the past 2 months; patients enrolled in other clinical studies within the last 3 months; and patients who were deemed unsuitable for this study by the investigators. The clinical characteristics and pathological information of the patients are listed in Table S4. All patients enrolled in this study provided written informed consent.

Animals

All animal experimental protocols were approved by the Ethical Committee for Animal Research of Southern Medical University, Guangzhou, China (SMUL2020141). ICR male albino mice and Sprague-Dawley male rats were obtained from the Experimental Animal Center of the Southern Medical University in Guangzhou, China. Half of the mice and the rats were intraperitoneally injected with streptozotocin (60 mg/kg, mice; 40mg/kg, rats; Sigma, St. Louis, MO, USA) along with a high-fat, refined-sugar diet until becoming diabetic in 8-week models. Non-fasting glucose levels in diabetic mice were greater than 16.7 mmol/L in each model. Male diabetic db/db mice (B6.BKS(D)-Lepr^db/J, 8 weeks old) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). The care of animals was in accordance with the guidelines of the US National Institutes of Health and the Chinese National Institute of Health (Beijing, China). All surgical interventions were performed under anesthesia with a mixture of 13.3% urethane and 0.5% chloralose (0.65 mL/100 g body weight, ip), using a standardized protocol established in our laboratory. All efforts were made to reduce the number of animals used and to minimize animal discomfort.

Cell culture

HUVECs and HDF cells were purchased from the PromoCell (Heidelberg, Germany) and cultured in DMEM (Invitrogen, Waltham, MA, USA) containing 10% exosome-depleted fetal bovine serum (FBS; BI Sartorius AG, Kibbutz Beit-Haemek, Israel).

DRG neurons were isolated from 8-week-old male diabetic db/db mice. The mice were pretreated with sEVs (100ug / 2days, saline as control) for two weeks in advance. Briefly, ganglia from all spinal levels were removed, placed in ice-cold dissecting solution (130 mM NaCl, 5 mM KCl, 2 mM KH₂PO₄, 1.5 mM CaCl₂, 6 mM MgCl₂, 10 mM glucose and 10 mM Hepes, pH 7.2), and connective tissue was trimmed off. Ganglia were incubated for 1 h at 37 °C with collagenase type A (Roche, Basel, Switzerland) and trypsin, then were washed, incubated with DNase I (Roche), dissociated by 20 gentle triturations and spun for 3 min at 200 g to pellet ganglia. Next, DRGs were incubated for 20 min at 37 °C in complete saline solution (137 mM NaCl, 5.3 mM KCl, 1 mM MgCl₂, 25 mM sorbitol, 3 mM CaCl₂ and 10 mM HEPES, adjusted to pH 7.2 with NaOH) containing 1.5 mg/ml collagenase A (Roche) and 0.6 mM EDTA, followed by a 20-min incubation at 37 °C in complete saline solution containing 1.5 mg/ml collagenase D (Roche), 0.6-mM EDTA and 30 U/ml papain (Roche). DRGs were then triturated in 0.5 ml of DRG media (DMEM/F12 with 100 U/ml penicillin, 0.1 mg/ml streptomycin [Invitrogen], 2 mM L-glutamine and 10% FBS containing 1.5 mg/ml BSA (low endotoxin; Sigma) and 1.5 mg/ml trypsin inhibitor (Sigma). After trituration, the cell suspension was filtered with a 70-μm cell strainer (Becton Dickinson, Franklin Lakes, NJ, USA). The cell suspension was centrifuged (100 g for 3 min). After neurons had settled for 50 min, each well was fed with 1.44 ml of DRG media (final volume 1.5 ml) supplemented with nerve growth factor (50 ng/ml, Sigma) and glial cell line-derived neurotrophic factor (50 ng/ml, Sigma) and maintained for 3 days at 37 °C in a 95% air/5% CO₂ (v/v) incubator before immunofluorescence staining.

Method details

Generation of the miR-494^-/- rat model

The miR-494^-/- rat model in a Sprague-Dawley background was created in our laboratory. Briefly, two guide RNA (gRNA) sequences designed to disrupt early exon 1 according to the off-target scores (http://www.genome-engineering.org; miR-494 gRNA-1: GCCATCTGGCACTTTGCAGC; miR-494 gRNA-2: ACCTGGTAGGCACTCCCTGT) were transcribed using a MEGAshortscript T7 kit (Thermo Fisher Scientific, Waltham, MA, USA), and then purified using a MEGAclear Kit (Thermo Fisher). Cas9 mRNA was transcribed in vitro using a mMESSAGE mMACHINE T7 ULTRA kit (Thermo Fisher). Approximately 1 nL of Cas9 mRNA and gRNA mixture was injected into the cytoplasm of one-cell-stage Sprague-Dawley embryos. The injected embryos were transferred immediately into the oviductal ampulla of pseudopregnant female rats. Four rats tested positive for the excised allele and were homozygous for the constitutive allele (miR-494^-/-). These rats were analyzed by Sanger sequencing and backcrossed with Sprague-Dawley rats for more than six generations, then were used in further breeding to establish stable miR-494^-/- rats.

Rat/mouse wound models

Following ip pentobarbital sodium injection (1%, 0.3 mg/kg), dorsal hair was shaved and a round full-thickness cutaneous wound (mouse diameter = 8 mm, rat diameter = 15 mm) was generated on the back of each animal proximal to the hip. Each wound (mice) was implanted with methacrylated glycol chitosan hydrogels containing various nanoparticles or left empty. The hydrogels were formed by exposing 50 μL of the suspension under visible blue light (400–500 nm, 500–600 mW/cm−2; Bisco, Schaumburg, IL, USA) in the presence of riboflavin as a photoinitiator (final concentration 6 μM). To prevent the wounds from being scratched or dehydrated, moisturizing medical gauze was used to cover it after being splinted. The size of the wounds was assessed after 0, 3, 7, 10 and 14 days with an internal scale, with wound closure being measured as follows: wound closure (%) = [W0 − Wn] / W0 × 100%, where W0 and Wn refer to wound areas on day 0 and day n, respectively (n = 6). On day 14, wound healing outcomes were also assessed via H&E and Masson’s staining (n = 6).

Rat BT models

The rat femur BT model was established as previously described¹². Briefly, a transverse osteotomy was performed at the midshaft of the right femur after anesthesia and exposure. Then, a specially designed monolateral external fixator (Tianjin Xinzhong Company, Tianjin, China) was installed to fix the proximal and distal segments of the femur. The periosteum was preserved as much as possible during the procedure. Finally, the surgical incisions were sutured layer by layer. The BT procedure consisted of three phases: a 5-day latency phase; a 10-day gradual lengthening phase (0.5 mm/day in two steps, every 12 h, the sham group was not included); and a consolidation phase for 1 week. We used GW4869, a compound used to inhibit sEVs secretion in rats. GW4869 was dissolved in dimethylsulfoxide at 8 mg/mL. The working solution was prepared in 0.9% normal saline, freshly made before use with a final concentration of 0.3 mg/mL (2.5 μg/g body weight), with 3.75% dimethylsulfoxide in saline as a control. Rats were injected with the working solution twice a week.

Rat/mouse hind-limb ischemia models

The rats were operated on 1 week after implantation of an external fixator in the femur. All animals underwent right-sided unilateral induction of hind-limb ischemia under anesthesia with isoflurane. The common femoral artery was ligated at the level of the inguinal ligament and excised down to branching of the deep femoral artery, which was also ligated. Post-surgery, the animals received subcutaneous buprenorphine (0.03 mg/kg twice daily) for pain relief. On the day after induction, the rats were treated with BT, while mice were treated with sEVs (100ug / day, saline as control) via tail vein injection. Three days after treatment, the right paw blood flow of the rats/mice was analyzed using a laser speckle flow imaging system (RFLSI Ⅲ; RWD, Shenzhen, China).

Differential ultracentrifugation of several fractions from plasma and sEVs isolation

Plasma was obtained from rats with bone lengthening for 10 days or from sham-operated rats at the same time. All rats were anesthetized and peripheral blood was collected in a tube containing EDTA as an anticoagulant. The samples were stored at 4°C for a short time and immediately centrifuged at 4°C and 3000 rpm for 10 min. The supernatant was carefully collected and transferred to a new tube. For separation of plasma components, whole plasma was collected and pipetted into 15-mL Falcon tubes, centrifuged at low speed (2,000 g for 20 min; k-factor of the rotor was 41056) to remove dead cells and cellular debris prior to use, then split in two. One half was used as whole plasma, concentrated and used to treat cells, while the other half was further processed. From the second half, large EVs (lEVs) were collected after centrifugation at 10,000 g for 1 h, washed in 15 mL PBS and centrifuged again at 10,000 g (k-factor of the rotor was 669) for 1 h. The soluble fraction (SF) was then filtered through a 0.22-mm filter prior to centrifugation at 100,000 g for 1 h and 20 min. The SF was collected and concentrated using a 10K column (Amicon Ultra-0.5 filter, Millipore, Billerica, MA, USA) at 14,000 g for 10 min, achieving a concentration factor of 10X. The final 100,000 g pellet containing sEVs was washed once in 15 ml PBS and resuspended in 10% EV-depleted FBS media for the functional cell culture experiments. Each SF, lEVs and sEVs individual fraction from 15 ml of rat plasma was used to treat three wells of a 48-well plate. The protein concentration in sEVs was determined using a BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).

sEVs labeling and cellular uptake

sEVs were labeled using the PKH67 Green Fluorescent Cell Linker Kit (Sigma) by following the manufacturer’s protocol. The isolated sEVs diluted in PBS were added to 0.5 mL of Diluent C. A volume of 2 μL of PKH67 dye was added and incubated for 4 min at room temperature. Two mL of 1% BSA/PBS was added to bind excess dye. The labeled sEVs were washed at 100,000 × g for 70 min, and the sEVs pellet was suspended in PBS and used for uptake experiments. We then co-cultured these PKH67 sEVs with HUVECs and HDF cells. After the indicated time of co-culture, we stained the cells with TRITC-phalloidin and DAPI (Sigma) and observed them with confocal microscopy.

Fluorescence imaging analysis of organ distribution of sEVs

To facilitate tracking in vivo, we injected PKH67-labeled sEVs into ICR mice. A total of 100 μg of sEVs were injected into each mouse intravenously. Thereafter, the mice were euthanatized 8 h after the intravenous injections and subjected to biophotonic imaging. Fluorescence imaging for PKH67-labeled sEVs in these organs (Heart, liver, spleen, lung, kidney and the regenerated skin) was performed using the Fx Pro optical imaging system (Bruker BioSpin MRI GmbH, Ettlingen, Germany). For anatomical orientation, a white light/grayscale picture was obtained and used with the fluorescent signal (Cy3.5: excitation = 570 nm; emission = 620 nm). For data analysis, molecular imaging software 7.1.3 (Bruker) was used. Regions of interest were defined around the skin defect area and analyzed compared to the background after injection of PBS for calculation of the signal to noise ratio.

Histological evaluation

Regenerative skin tissue from rats or mice was harvested at day 10 after skin lesions. After fixation with a 4% paraformaldehyde solution for 24 h, skin samples were dehydrated, embedded in paraffin and then sliced into 5-μm sections. Masson’s trichrome staining and H&E staining were performed on the tissue slides. The tissue slides were imaged using an FSX100 microscope (Olympus, Tokyo, Japan). Three regions containing the same area were selected randomly from each skin specimen to calculate the epidermal thickness and collagen deposition of each sample with Image J software (National Institutes of Health, Bethesda, MD, USA).

Immunofluorescence staining and immunohistochemistry

Bone samples from rats were harvested on day 7 of bone transport and fixed using 4% paraformaldehyde for 48 h at 4 °C, then decalcified in 0.5 M EDTA, pH 7.4, on a shaker for 1 month. The bone and skin tissues were embedded in paraffin and 2–5 μm sagittal sections were prepared for histological analyses. After deparaffinization and rehydration, sections were incubated in citrate buffer (10 mM citric acid, pH 6.0) for 30 min at 90 °C or were treated with 200 mg/mL proteinase K (Sigma) for 10 min at 37 °C to unmask antigen. Sections for immunohistochemistry were treated with 3% hydrogen peroxide for 15 min. Thereafter, the sections were permeabilized with 0.1% Triton X-100 in PBS for 5 min at room temperature and then blocked with 1% sheep serum for 1 h at room temperature.

For immunohistochemistry, we incubated primary antibodies that recognized 8-OHdG (Abcam, Cambridge, UK; cat. #: ab48508, 1:200) or CRMP4 (Proteintech, Rosemont, IL, USA; cat. #: 13661-1-AP, 1:100) overnight at 4 °C. Subsequently, section were incubated with horseradish peroxidase-labeled secondary antibodies (1:200 in 1% bovine serum albumin [BSA]) for 1 h at 37 °C (either anti-rabbit IgG [cat. #: 7074, dilution 1:200] from Cell Signaling Technology [CST, Danvers, MA, USA] or anti-mouse IgG [cat# A9044, dilution 1:200] from Sigma. Diaminobenzidine was used as the chromogen and hematoxylin as the counterstain. For immunofluorescence, we incubated primary antibodies that recognized CD63 (Abcam, cat. #: ab193349, 1:50), OCN (Proteintech, cat. #: 15613-1-AP, 1:100), a-SMA (CST, cat #: 19245S, 1:200), CD31 (CST, cat. #: 3528S, 1:200) and PGP9.5 (CST cat. #: 33575SF, 1:200).For secondary reactions, species-matched Alexa Fluor 488 and Alexa Fluor 594 secondary antibodies were used (1:500 in 1% BSA, 1 h at 37 °C in the dark). Secondary antibodies for immunofluorescence staining were goat anti-rabbit Alexa Fluor 488 (cat. #: A-11008, dilution 1:500) and goat anti-mouse Alexa Fluor 594 (cat. #: A-11032, dilution 1:500), both from Invitrogen. The sections were counterstained with DAPI (Thermo Fisher) before imaging and we examined more than five different microscopic images taken under a confocal laser scanning microscope (Olympus GmbH, Hamburg, Germany).

Western blot analysis

Cells and sEVs were lysed in 2% SDS, 2 M urea, 10% glycerol, 10 mM Tris-HCl (pH 6.8), 10 mM dithiothreitol and 1 mM phenylmethylsulfonyl fluoride. The lysates were centrifuged and the supernatants were separated by SDS-polyacrylamide gel electrophoresis. After blotting onto nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA, USA), the membranes were blocked with BSA, then incubated with antibodies against TSG101 (Abcam, cat. #: ab83, 1:1,000), CD63 (Abcam, cat. #: ab193349, 1:1,000), Alix (Abcam, cat. #: ab76608, 1:1,000), GAPDH (CST, cat. #: 2118, 1:5000), GCLC (Abclonal, Wuhan, China; cat. #:A1038, 1:1000), CAT (Abclonal, cat. #: A11777, 1:1000), GPX1 (Abclonal, cat. #: A0873, 1:1000) or CRMP4 (Proteintech, cat. #: 13661-1-AP, 1:1000). Secondary antibodies for western blots were anti-rabbit IgG, (CST, cat. #: 7074, dilution 1:2000) or anti-mouse IgG (Sigma, cat. #; A9044, dilution 1:2000). The membranes were analyzed after visualization by an enhanced chemiluminescence kit (Amersham Biosciences, Piscataway, NJ, USA).

TEM and NTA

The morphology of the sEVs was observed by TEM. Briefly, the sEVs suspension was mixed with an equal amount of 4% paraformaldehyde. After washing with PBS, 4% uranyl acetate was added for chemical staining of sEVs, and images were captured using a Hitachi H-7650 TEM (Hitachi, Tokyo, Japan). NTA was performed to measure the size and the concentration of the isolated sEVs using the NanoSight NS500 (Malvern, Westborough, MA, USA), according to the operating instructions, without any changes. The sEVs were diluted to be within the recommended concentration range. Five 60 s videos were captured for each sample during flow mode (camera settings: slider shutter 890, slider gain 146). Plasma-derived sEVs were diluted and loaded onto the NS500 instrument by a syringe at a constant flow. The videos were analyzed with NTA 3.2 software (Malvern). All measurements were performed at room temperature.

RNA isolation

RNA was extracted from cells using the QIAzol Lysis Reagent (Qiagen, Hilden, Germany) according to the user guidelines. Briefly, the sEVs were collected in a reaction tube, lysed with QIAzol and mixed with chloroform. After being centrifuged for 15 min at 12,000 × g and 4 °C, the upper aqueous phase was transferred to an RNeasy Mini spin column in a 2-mL collection tube and mixed with 100% ethanol. After being washed for 5 min at 7500 × g and 4 °C, total RNA was collected for qRT-PCR analysis. RNA was extracted from plasma and sEVs fractions using Qiagen miRNeasy Mini kit (Qiagen), according to the manufacturer’s instructions, with a final elution volume of 20 μL.

RT-PCR and qRT-PCR

RNA samples were quantitated and qualified using NanoDrop analysis (Thermo Fisher). Equal quantities (5 ng) of total RNA from each sample were used for cDNA synthesis using the miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The reverse transcriptions of miRNAs were performed by looped miRNA-specific RT primers (Table S5) for miRNAs. qRT-PCR (Primers, Table S6) was performed using Applied Biosystem’s StepOnePlus (FosterCity, CA, USA), using the miRNA Universal SYBR qPCR Master Mix (Vazyme). The internal control was U6 snRNA (relative quantification of tissue-derived miRNAs), and the external control was Cel-miR-39-3p (relative quantification of plasma and sEVs-derived miRNAs). Dissociation curves were generated to ensure the specificity of each qRT-PCR reaction. The relative expression levels of miRNAs in each sample were calculated and quantified using the 2^−ΔΔCt method.

Luciferase assays

HUVECs and HDF cells were cultured at 1 × 10⁵ cells/well in 12-well plates. The cells were co-transfected with miR-494-3p mimic (50 nM) or miRNA mimic negative control (50 nM) and 0.2 μg of psiCHECK™-1-UTR. Transfection was performed using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA). After 48 h, cells were collected and luciferase activity was determined using a dual luciferase reporter assay system (Promega, Madison, WI, USA) with a dual luciferase assay reporter-ready luminometer (Promega). The assays were performed in triplicate.

miRNA transfection

HUVEC and HDF cells were cultured to 70–80% confluence and transfected with miRNA mimics, inhibitor, and their negative control (GenePharma Inc, Shanghai, China) by Lipofectamine 3000 (Invitrogen), according to the manufacturer’s instructions. Mimics were used at a final concentration of 50 nM, inhibitors were transfected at 100 nM concentration and incubated for 4 h. Subsequently, the medium was changed to normal culture medium to terminate transfection.

Cell migration assays

For the transwell assay, 5 × 10⁴ treated HDF cells and their controls in 200 μL of serum-free DMEM medium were seeded into the upper chambers of transwell inserts (Corning, Corning, NY, USA). Next, 600 μL of DMEM medium containing 20% FBS were added to the lower chambers. After 24 h of incubation, the cells remaining in the upper chambers were removed with a cotton swab, while cells that had invaded the bottom surface were fixed with 75% ice-alcohol for 30 min and stained with 1% crystal violet solution for 20 min. An inverted microscope was then used for imaging. The average number of HDF cells in five random fields was calculated for statistical analysis. Each experiment was repeated three times.

Tube formation assay

After spreading 100 μl Matrigel™ (BD Biosciences, San Jose, CA, USA.) per well, 96-well plates were placed into a humidified incubator at 37 °C until the Matrigel solidified (about 30–40 min). Treated HUVECs from a different group were resuspended to make a cell suspension of 1 × 10⁴ cells/ml. The prepared cells were added to the Matrigel-coated plate and cultured. The cells were observed under an inverted microscope and the number of tubes formed were counted. The average number of tubes in five random fields was calculated for statistical analysis. Each experiment was repeated three times.

Cell counting kit-8 assay

The Cell Counting Kit-8 assay (CCK-8) was used to determine cell viability. In total, 2 × 10³ cells (HUVEC/HDF) were seeded in 96-well plates and allowed to adhere overnight. Following incubation with the compounds under evaluation for 72 h, 10 μL CCK-8 dye was added to each well, and the cells were incubated for 1 h at 37 °C. Subsequently, the absorbance was determined at 450 nm (BioTek Synergy-HTX, Winooski, VT, USA).

Randomization and masking

Patients who are screened and agreed to participate in this trial will be given a registration code number, and will be randomly assigned in a double-blind 1:1 ratio to receive either oral placebo or Rg1+GSH. A statistician will use a randomized permuted block design and generated the randomization list. The groupings will be kept in consecutive unique opaque envelopes. Participants, caregivers, clinical investigators (outcome assessors), and individuals responsible for data collection will be blinded to the grouping during the trial. Group assignments will not be disclosed to individuals performing statistical analyses until the clinical database have been assembled, tissue acquisition has been achieved and all planned analyses have been completed. After all study data are locked, blinding will be unmasked jointly by the principal investigator, statistician, and sponsor.

Preparation of drugs

Ginsenoside Rg1: The drug name is QiShengLiPian (TeAnNa), the National Medical Products Administration number is Z20027165, and the specification is 0.12 g/tablet (each tablet contains ginsenoside Rg1 15 mg, Dosage: 2 tablets three times daily). Reduced Glutathione (GSH): The drug name is Reduced Glutathione Tablets, the National Medical Products Administration number is H20050667, and the specification is 0.1 g/tablet (Dosage: 4 tablets three times daily). Placebo: The main components of the placebo are starch and maltodextrin. The specifications and dosage are identical to those described above.

Procedures

All eligible patients received standard care and screening for 2 weeks before randomization. Demographic characteristics, medical history, current treatment, wound characteristics and blood test results were recorded at screening (14 days before randomization). Diabetic complications and co-morbidities were recorded in the case report form of the patient's medical record and no other tests were performed. At the end of the screening period, patients who were still eligible had fasting blood and debrided-tissue samples taken, received the same standard of care as before, and were randomly assigned to start oral placebo or Rg1+GSH.

Patients were first assessed after randomization and then every 4 weeks for 12 weeks. During screening and treatment, care and treatment were recorded in the study file, and clinically debrided-skin tissues and blood samples will be harvested at 2 weeks after treatment. Serum ROS were detected by BBoxiProbe O12 assay kit (BestBio, Shanghai, China). Serum were incubated with O12 probe 15 min at 37°C and protected from light. The samples were excited at 488 nm, and the fluorescence emission intensity was measured at 530 nm. Histological assessments were performed as described above. Wound debridement and removal of hyperkeratosis were performed at each visit at the investigator's discretion. Wound cleaning with 0.9% sodium chloride was performed, and the frequency was determined by the clinical condition of the wound and its level of exudate. Wound debridement and removal of hyperkeratosis will be performed at each visit at the investigator's discretion. Wound cleaning with 0.9% sodium chloride will be performed, and the frequency will be determined by the clinical condition of the wound and its level of exudate. At each assessment, the wound was tracked and photographs were taken after debridement, and the wound was closed or not. Wound closure could be reported by the investigator or the patient and was confirmed within 7 days. Wound healing was assessed centrally and was assessed in a blinded manner from photographs of the wound by two experienced clinicians not involved in this study.

Patients with wound closure during the treatment phase could request discontinuation of treatment and advance to the next phase, which is allowed. During the 12-week treatment period, a participant will be considered out of the group if any of the following occurs: patients voluntarily withdraw from the trial; serious violation of the clinical research protocol; the patient is pregnant; The patient develops secondary malignant tumor; those who could not be treated according to the protocol, have poor compliance, or should be excluded from the group according to the investigators; patients who have to undergo surgical treatment during the study, such as skin grafting and amputation. A participant's regimen will be discontinued if a serious adverse event occurred or another event that was deemed by the investigator to warrant stopping the trial.

Outcomes

The primary outcomes included the rate of wound contraction and the effectiveness score at the end of the 12-week trial. Wound area at each stage was assessed by the local investigator. Wound closure was defined as 100% wound contraction. Effectiveness scores were determined by the percentage of wound closure at the end of phase 3, with complete closure defined as 4, closure ≥ 70%–100% as 3, closure ≥ 30%–70% as 2, closure ≥ 0%–30% as 1 and deterioration as 0. Secondary outcomes included wound deterioration (Increased infection or inflammation) and patient satisfaction assessment at the end of phase 3 (patient self-assessment in the form of a questionnaire, with integer numbers between 0 and 4 representing increasing satisfaction). Safety outcomes included nature and incidence of any general or local adverse events. These adverse events include but not are limited to death, severe infections, kidney function decline, high fever, dizziness, and all kinds of digestive tract symptoms. Other outcomes included biologic measurements of blood and debrided tissue, will be reported by the laboratory testing team.

Quantification and statistical analysis

All data expect for clinical trial were analyzed for statistical significance using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). P-values were determined using Student’s t test for two-groups or one-way ANOVA test for multiple group comparisons. P < 0.05 was considered to be statistically significant. All experiments were repeated at least three times. Quantitative data in animal and cell experiments were expressed as mean ± SD.

For the clinical trial, the aim of this study was to compare the effects of the intervention between the placebo and Rg1+GSH groups. This is a pilot study of a novel treatment approach, and thus the sample size was based on current recommendation for pilot studies informing RCTs: 30 participants per group ⁴⁷. With an estimated exclusion rate of 10%, 66 patients need to be recruited.

All primary analyses were performed with the use of a coded database (groups were identified as A and B). All analyses were performed using the intention-to-treat population. Independent sample t test was used to compare normally distributed data, Mann-Whitney U test was used for non-normally distributed data, and chi-square test was used for categorical variables. All p values were two-sided, and a p value less than 0.05 was considered to indicate significance. Values are reported as means (SD) and counts (percentages) unless otherwise stated. SPSS 18.0 software (IBM, Armonk, NY, USA) was used for statistical analysis. Quantitative data in histograms are expressed as mean ± SD.

Additional resources

The clinical trial of the study was registered at www.chictr.org.cn, number ChiCTR2200055194.

Acknowledgments

We thank the Central Laboratory, Southern Medical University, for providing facilities and technical support. We thank the Department of Endocrinology, Department of Orthopedics, and Clinical Medical Research Center of the Affiliated Hospital of Youjiang Medical University for Nationalities for their substantial support of this study. We thank all the patients and health-care professionals who contributed to making the trial possible and the investigators for their commitment, time, and effort. The graphical abstract was created with biorender.com. This work was supported by grants from the National Natural Science Foundation of China, China (grants 81991511 and 92268204) and the Guangxi Key Laboratory of Basic and Translational Research of Bone and Joint Degenerative Diseases, China (grant 21-220-06).

Author contributions

X.B., J. Liu, D.L., and J.X. designed the study. X.B. and J.X. wrote the manuscript. X. Liu and X.X. assisted in editing the manuscript. For the biological research, J.X., X. Liu, B.C., Q.S., and X.T. performed the experiments and analyzed the data. S.Z. designed and constructed the miR-494^−/− rats. X.C. assisted in the bioinformatics analysis. X.Z., L.X., and W. Zhou provided the experimental technical support. For the clinical study, the protocol was written by X.B., J. Liu, B.W., J.X., and Y. Gong and reviewed by D.L., D.C., W. Zou, and Q.J. J. Liu, B.W., Y. Guan, R.L., X. Lin, C.Z., M.Y., and H.N. collected the patient samples and data. J.X., X. Liu, and Y. Gong tested patient samples and statistically analyzed the clinical data. X.B., J.X., X. Liu, J. Lin, and M.H. supplemented the experiments and revised the manuscript. All authors contributed to the article and approved the submitted version.

Declaration of interests

The authors declare no competing interests.

Published: May 22, 2024

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.xcrm.2024.101588.

Contributor Information

Di Lu, Email: ludi20040609@126.com.

Jia Liu, Email: liujia0111@live.cn.

Xiaochun Bai, Email: baixc15@smu.edu.cn.

Supplemental information

Document S1. Figures S1–S15 and Tables S1 and S4–S6

mmc1.pdf^{(13.5MB, pdf)}

Table S2. Excel file containing the proteomic data of BT-sEVs and sham-sEVs, related to Figure 3

mmc2.xlsx^{(248.7KB, xlsx)}

Table S3. Excel file containing the proteomic data of plasma from patients before and 14 days after TCTD, related to Figure 3

mmc3.xlsx^{(52.9KB, xlsx)}

Document S2. Article plus supplemental information

mmc4.pdf^{(25.6MB, pdf)}

References

1.Armstrong D.G., Boulton A.J.M., Bus S.A. Diabetic Foot Ulcers and Their Recurrence. N. Engl. J. Med. 2017;376:2367–2375. doi: 10.1056/NEJMra1615439. [DOI] [PubMed] [Google Scholar]
2.Falanga V., Isseroff R.R., Soulika A.M., Romanelli M., Margolis D., Kapp S., Granick M., Harding K. Chronic wounds. Nat. Rev. Dis. Primers. 2022;8:50. doi: 10.1038/s41572-022-00377-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Matoori S., Veves A., Mooney D.J. Advanced bandages for diabetic wound healing. Sci. Transl. Med. 2021;13 doi: 10.1126/scitranslmed.abe4839. [DOI] [PubMed] [Google Scholar]
4.McDermott K., Fang M., Boulton A.J.M., Selvin E., Hicks C.W. Etiology, Epidemiology, and Disparities in the Burden of Diabetic Foot Ulcers. Diabetes Care. 2023;46:209–221. doi: 10.2337/dci22-0043. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Chang M., Nguyen T.T. Strategy for Treatment of Infected Diabetic Foot Ulcers. Acc. Chem. Res. 2021;54:1080–1093. doi: 10.1021/acs.accounts.0c00864. [DOI] [PubMed] [Google Scholar]
6.Jeffcoate W.J., Vileikyte L., Boyko E.J., Armstrong D.G., Boulton A.J.M. Current Challenges and Opportunities in the Prevention and Management of Diabetic Foot Ulcers. Diabetes Care. 2018;41:645–652. doi: 10.2337/dc17-1836. [DOI] [PubMed] [Google Scholar]
7.Hosny G.A. Limb lengthening history, evolution, complications and current concepts. J. Orthop. Traumatol. 2020;21 doi: 10.1186/s10195-019-0541-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Ilizarov G.A. The tension-stress effect on the genesis and growth of tissues: Part II. The influence of the rate and frequency of distraction. Clin. Orthop. Relat. Res. 1989:263–285. [PubMed] [Google Scholar]
9.Ransom R.C., Carter A.C., Salhotra A., Leavitt T., Marecic O., Murphy M.P., Lopez M.L., Wei Y., Marshall C.D., Shen E.Z., et al. Mechanoresponsive stem cells acquire neural crest fate in jaw regeneration. Nature. 2018;563:514–521. doi: 10.1038/s41586-018-0650-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Chen Y., Kuang X., Zhou J., Zhen P., Zeng Z., Lin Z., Gao W., He L., Ding Y., Liu G., et al. Proximal Tibial Cortex Transverse Distraction Facilitating Healing and Limb Salvage in Severe and Recalcitrant Diabetic Foot Ulcers. Clin. Orthop. Relat. Res. 2020;478:836–851. doi: 10.1097/CORR.0000000000001075. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Chen Y., Ding X., Zhu Y., Jia Z., Qi Y., Chen M., Lu J., Kuang X., Zhou J., Su Y., et al. Effect of tibial cortex transverse transport in patients with recalcitrant diabetic foot ulcers: A prospective multicenter cohort study. J. Orthop. Translat. 2022;36:194–204. doi: 10.1016/j.jot.2022.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Ye L., Xu J., Mi J., He X., Pan Q., Zheng L., Zu H., Chen Z., Dai B., Li X., et al. Biodegradable magnesium combined with distraction osteogenesis synergistically stimulates bone tissue regeneration via CGRP-FAK-VEGF signaling axis. Biomaterials. 2021;275 doi: 10.1016/j.biomaterials.2021.120984. [DOI] [PubMed] [Google Scholar]
13.Huang C., Holfeld J., Schaden W., Orgill D., Ogawa R. Mechanotherapy: revisiting physical therapy and recruiting mechanobiology for a new era in medicine. Trends Mol. Med. 2013;19:555–564. doi: 10.1016/j.molmed.2013.05.005. [DOI] [PubMed] [Google Scholar]
14.Fujio M., Yamamoto A., Ando Y., Shohara R., Kinoshita K., Kaneko T., Hibi H., Ueda M. Stromal cell-derived factor-1 enhances distraction osteogenesis-mediated skeletal tissue regeneration through the recruitment of endothelial precursors. Bone. 2011;49:693–700. doi: 10.1016/j.bone.2011.06.024. [DOI] [PubMed] [Google Scholar]
15.Schweizerhof M., Stosser S., Kurejova M., Njoo C., Gangadharan V., Agarwal N., Schmelz M., Bali K.K., Michalski C.W., Brugger S., et al. Hematopoietic colony-stimulating factors mediate tumor-nerve interactions and bone cancer pain. Nat. Med. 2009;15:802–U122. doi: 10.1038/nm.1976. [DOI] [PubMed] [Google Scholar]
16.Fafián-Labora J.A., Rodriguez-Navarro J.A., O'Loghlen A. Small Extracellular Vesicles Have GST Activity and Ameliorate Senescence-Related Tissue Damage. Cell Metab. 2020;32:71. doi: 10.1016/j.cmet.2020.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Théry C., Witwer K.W., Aikawa E., Alcaraz M.J., Anderson J.D., Andriantsitohaina R., Antoniou A., Arab T., Archer F., Atkin-Smith G.K., et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles. 2018;7 doi: 10.1080/20013078.2018.1535750. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Trajkovic K., Hsu C., Chiantia S., Rajendran L., Wenzel D., Wieland F., Schwille P., Brügger B., Simons M. Ceramide triggers budding of exosome vesicles into multivesicular Endosomes. Science. 2008;319:1244–1247. doi: 10.1126/science.1153124. [DOI] [PubMed] [Google Scholar]
19.Xu X., Wang W., Wang Z., Lv J., Xu X., Xu J., Yang J., Zhu X., Lu Y., Duan W., et al. DW14006 as a Direct AMPKalpha Activator Ameliorates Diabetic Peripheral Neuropathy in Mice. Diabetes. 2020;69:1974–1988. doi: 10.2337/db19-1084. [DOI] [PubMed] [Google Scholar]
20.Xia W., Xie J., Cai Z., Liu X., Wen J., Cui Z.K., Zhao R., Zhou X., Chen J., Mao X., et al. Damaged brain accelerates bone healing by releasing small extracellular vesicles that target osteoprogenitors. Nat. Commun. 2021;12 doi: 10.1038/s41467-021-26302-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Hu J., Hou Y., Park H., Choi B., Hou S., Chung A., Lee M. Visible light crosslinkable chitosan hydrogels for tissue engineering. Acta Biomater. 2012;8:1730–1738. doi: 10.1016/j.actbio.2012.01.029. [DOI] [PubMed] [Google Scholar]
22.Mateescu B., Kowal E.J.K., van Balkom B.W.M., Bartel S., Bhattacharyya S.N., Buzás E.I., Buck A.H., de Candia P., Chow F.W.N., Das S., et al. Obstacles and opportunities in the functional analysis of extracellular vesicle RNA - an ISEV position paper. J. Extracell. Vesicles. 2017;6 doi: 10.1080/20013078.2017.1286095. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature. 2001;414:813–820. doi: 10.1038/414813a. [DOI] [PubMed] [Google Scholar]
24.Dandona P., Thusu K., Cook S., Snyder B., Makowski J., Armstrong D., Nicotera T. Oxidative damage to DNA in diabetes mellitus. Lancet. 1996;347:444–445. doi: 10.1016/s0140-6736(96)90013-6. [DOI] [PubMed] [Google Scholar]
25.Rupaimoole R., Slack F.J. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat. Rev. Drug Discov. 2017;16:203–222. doi: 10.1038/nrd.2016.246. [DOI] [PubMed] [Google Scholar]
26.Zheng H.Z., Fu X.K., Shang J.L., Lu R.X., Ou Y.F., Chen C.L. Ginsenoside Rg1 protects rat bone marrow mesenchymal stem cells against ischemia induced apoptosis through miR-494-3p and ROCK-1. Eur. J. Pharmacol. 2018;822:154–167. doi: 10.1016/j.ejphar.2018.01.001. [DOI] [PubMed] [Google Scholar]
27.Sun T., Cheung K.S.C., Liu Z.L., Leung F., Lu W.W. Matrix metallopeptidase 9 targeted by hsa-miR-494 promotes silybin-inhibited osteosarcoma. Mol. Carcinog. 2018;57:262–271. doi: 10.1002/mc.22753. [DOI] [PubMed] [Google Scholar]
28.Chen S.M., Wang B.Y., Lee C.H., Lee H.T., Li J.J., Hong G.C., Hung Y.C., Chien P.J., Chang C.Y., Hsu L.S., Chang W.W. Hinokitiol up-regulates miR-494-3p to suppress BMI1 expression and inhibits self-renewal of breast cancer stem/progenitor cells. Oncotarget. 2017;8:76057–76068. doi: 10.18632/oncotarget.18648. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Sengupta S., Toh S.A., Sellers L.A., Skepper J.N., Koolwijk P., Leung H.W., Yeung H.W., Wong R.N.S., Sasisekharan R., Fan T.P.D. Modulating angiogenesis - The yin and the yang in ginseng. Circulation. 2004;110:1219–1225. doi: 10.1161/01.Cir.0000140676.88412.Cf. [DOI] [PubMed] [Google Scholar]
30.Guo H., Huang S., Yang X., Wu J., Kirk T.B., Xu J., Xu A., Xue W. Injectable and Self-Healing Hydrogels with Double-Dynamic Bond Tunable Mechanical, Gel-Sol Transition and Drug Delivery Properties for Promoting Periodontium Regeneration in Periodontitis. Acs Appl. Mater Inter. 2021;13:61638–61652. doi: 10.1021/acsami.1c18701. [DOI] [PubMed] [Google Scholar]
31.Yang Y., Li Y., Pan Q., Bai S., Wang H., Pan X.H., Ling K.K., Li G. Tibial cortex transverse transport accelerates wound healing via enhanced angiogenesis and immunomodulation. Bone Joint Res. 2022;11:189–199. doi: 10.1302/2046-3758.114.Bjr-2021-0364.R1. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Tomlinson R.E., Silva M.J. Skeletal Blood Flow in Bone Repair and Maintenance. Bone Res. 2013;1:311–322. doi: 10.4248/Br201304002. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Ramasamy S.K., Kusumbe A.P., Adams R.H. Regulation of tissue morphogenesis by endothelial cell-derived signals. Trends Cell Biol. 2015;25:148–157. doi: 10.1016/j.tcb.2014.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Jansen F., Yang X.Y., Nickenig G., Werner N. Endothelial Microparticle-mediated Transfer of MicroRNA-126 Promotes Vascular Endothelial Cell Repair Via SPRED1 and is Abrogated in Glucose-damaged Endothelial Microparticles. Circulation. 2013;128 doi: 10.1161/CIRCULATIONAHA.113.001720. [DOI] [PubMed] [Google Scholar]
35.Goldstein S., Moerman E.J., Soeldner J.S., Gleason R.E., Barnett D.M. Diabetes mellitus and genetic prediabetes. Decreased replicative capacity of cultured skin fibroblasts. J. Clin. Invest. 1979;63:358–370. doi: 10.1172/JCI109311. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Sundaram G.M., Common J.E.A., Gopal F.E., Srikanta S., Lakshman K., Lunny D.P., Lim T.C., Tanavde V., Lane E.B., Sampath P. 'See-saw' expression of microRNA-198 and FSTL1 from a single transcript in wound healing. Nature. 2013;495:103–106. doi: 10.1038/nature11890. [DOI] [PubMed] [Google Scholar]
37.Falanga V. Wound healing and its impairment in the diabetic foot. Lancet. 2005;366:1736–1743. doi: 10.1016/S0140-6736(05)67700-8. [DOI] [PubMed] [Google Scholar]
38.Mao G., Liu Y., Fang X., Liu Y., Fang L., Lin L., Liu X., Wang N. Tumor-derived microRNA-494 promotes angiogenesis in non-small cell lung cancer. Angiogenesis. 2015;18:373–382. doi: 10.1007/s10456-015-9474-5. [DOI] [PubMed] [Google Scholar]
39.Orso F., Quirico L., Dettori D., Coppo R., Virga F., Ferreira L.C., Paoletti C., Baruffaldi D., Penna E., Taverna D. Role of miRNAs in tumor and endothelial cell interactions during tumor progression. Semin. Cancer Biol. 2020;60:214–224. doi: 10.1016/j.semcancer.2019.07.024. [DOI] [PubMed] [Google Scholar]
40.Tenchov R., Sasso J.M., Wang X., Liaw W.S., Chen C.A., Zhou Q.A. Exosomes-Nature's Lipid Nanoparticles, a Rising Star in Drug Delivery and Diagnostics. ACS Nano. 2022;16:17802–17846. doi: 10.1021/acsnano.2c08774. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Leung K.W., Ng H.M., Tang M.K.S., Wong C.C.K., Wong R.N.S., Wong A.S.T. Ginsenoside-Rg1 mediates a hypoxia-independent upregulation of hypoxia-inducible factor-1 alpha to promote angiogenesis. Angiogenesis. 2011;14:515–522. doi: 10.1007/s10456-011-9235-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Zhai K., Duan H., Wang W., Zhao S., Khan G.J., Wang M., Zhang Y., Thakur K., Fang X., Wu C., et al. Ginsenoside Rg1 ameliorates blood-brain barrier disruption and traumatic brain injury via attenuating macrophages derived exosomes miR-21 release. Acta Pharm. Sin. B. 2021;11:3493–3507. doi: 10.1016/j.apsb.2021.03.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Wang Z., Wang L., Jiang R., Li C., Chen X., Xiao H., Hou J., Hu L., Huang C., Wang Y. Ginsenoside Rg1 prevents bone marrow mesenchymal stem cell senescence via NRF2 and PI3K/Akt signaling. Free Radic. Biol. Med. 2021;174:182–194. doi: 10.1016/j.freeradbiomed.2021.08.007. [DOI] [PubMed] [Google Scholar]
44.Alolga R.N., Nuer-Allornuvor G.F., Kuugbee E.D., Yin X., Ma G. Ginsenoside Rg1 and the control of inflammation implications for the therapy of type 2 diabetes: A review of scientific findings and call for further research. Pharmacol. Res. 2020;152 doi: 10.1016/j.phrs.2020.104630. [DOI] [PubMed] [Google Scholar]
45.Yang F., Ma Q., Matsabisa M.G., Chabalala H., Braga F.C., Tang M. Panax notoginseng for Cerebral Ischemia: A Systematic Review. Am. J. Chin. Med. 2020;48:1331–1351. doi: 10.1142/S0192415x20500652. [DOI] [PubMed] [Google Scholar]
46.Mohanan P., Subramaniyam S., Mathiyalagan R., Yang D.C. Molecular signaling of ginsenosides Rb1, Rg1, and Rg3 and their mode of actions. J. Ginseng Res. 2018;42:123–132. doi: 10.1016/j.jgr.2017.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Lancaster G.A., Dodd S., Williamson P.R. Design and analysis of pilot studies: recommendations for good practice. J. Eval. Clin. Pract. 2004;10:307–312. doi: 10.1111/j.2002.384.doc.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figures S1–S15 and Tables S1 and S4–S6

mmc1.pdf^{(13.5MB, pdf)}

Table S2. Excel file containing the proteomic data of BT-sEVs and sham-sEVs, related to Figure 3

mmc2.xlsx^{(248.7KB, xlsx)}

Table S3. Excel file containing the proteomic data of plasma from patients before and 14 days after TCTD, related to Figure 3

mmc3.xlsx^{(52.9KB, xlsx)}

Document S2. Article plus supplemental information

mmc4.pdf^{(25.6MB, pdf)}

Data Availability Statement

•
MiRNA expression profiles raw data have been deposited in the NCBI Sequence Read Archive (SRA) and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Additional data generated or analyzed during this study are included in the supplemental information files.
•
This study does not report original code.
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

[bib1] 1.Armstrong D.G., Boulton A.J.M., Bus S.A. Diabetic Foot Ulcers and Their Recurrence. N. Engl. J. Med. 2017;376:2367–2375. doi: 10.1056/NEJMra1615439. [DOI] [PubMed] [Google Scholar]

[bib2] 2.Falanga V., Isseroff R.R., Soulika A.M., Romanelli M., Margolis D., Kapp S., Granick M., Harding K. Chronic wounds. Nat. Rev. Dis. Primers. 2022;8:50. doi: 10.1038/s41572-022-00377-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib3] 3.Matoori S., Veves A., Mooney D.J. Advanced bandages for diabetic wound healing. Sci. Transl. Med. 2021;13 doi: 10.1126/scitranslmed.abe4839. [DOI] [PubMed] [Google Scholar]

[bib4] 4.McDermott K., Fang M., Boulton A.J.M., Selvin E., Hicks C.W. Etiology, Epidemiology, and Disparities in the Burden of Diabetic Foot Ulcers. Diabetes Care. 2023;46:209–221. doi: 10.2337/dci22-0043. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] 5.Chang M., Nguyen T.T. Strategy for Treatment of Infected Diabetic Foot Ulcers. Acc. Chem. Res. 2021;54:1080–1093. doi: 10.1021/acs.accounts.0c00864. [DOI] [PubMed] [Google Scholar]

[bib6] 6.Jeffcoate W.J., Vileikyte L., Boyko E.J., Armstrong D.G., Boulton A.J.M. Current Challenges and Opportunities in the Prevention and Management of Diabetic Foot Ulcers. Diabetes Care. 2018;41:645–652. doi: 10.2337/dc17-1836. [DOI] [PubMed] [Google Scholar]

[bib7] 7.Hosny G.A. Limb lengthening history, evolution, complications and current concepts. J. Orthop. Traumatol. 2020;21 doi: 10.1186/s10195-019-0541-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] 8.Ilizarov G.A. The tension-stress effect on the genesis and growth of tissues: Part II. The influence of the rate and frequency of distraction. Clin. Orthop. Relat. Res. 1989:263–285. [PubMed] [Google Scholar]

[bib9] 9.Ransom R.C., Carter A.C., Salhotra A., Leavitt T., Marecic O., Murphy M.P., Lopez M.L., Wei Y., Marshall C.D., Shen E.Z., et al. Mechanoresponsive stem cells acquire neural crest fate in jaw regeneration. Nature. 2018;563:514–521. doi: 10.1038/s41586-018-0650-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] 10.Chen Y., Kuang X., Zhou J., Zhen P., Zeng Z., Lin Z., Gao W., He L., Ding Y., Liu G., et al. Proximal Tibial Cortex Transverse Distraction Facilitating Healing and Limb Salvage in Severe and Recalcitrant Diabetic Foot Ulcers. Clin. Orthop. Relat. Res. 2020;478:836–851. doi: 10.1097/CORR.0000000000001075. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] 11.Chen Y., Ding X., Zhu Y., Jia Z., Qi Y., Chen M., Lu J., Kuang X., Zhou J., Su Y., et al. Effect of tibial cortex transverse transport in patients with recalcitrant diabetic foot ulcers: A prospective multicenter cohort study. J. Orthop. Translat. 2022;36:194–204. doi: 10.1016/j.jot.2022.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib12] 12.Ye L., Xu J., Mi J., He X., Pan Q., Zheng L., Zu H., Chen Z., Dai B., Li X., et al. Biodegradable magnesium combined with distraction osteogenesis synergistically stimulates bone tissue regeneration via CGRP-FAK-VEGF signaling axis. Biomaterials. 2021;275 doi: 10.1016/j.biomaterials.2021.120984. [DOI] [PubMed] [Google Scholar]

[bib13] 13.Huang C., Holfeld J., Schaden W., Orgill D., Ogawa R. Mechanotherapy: revisiting physical therapy and recruiting mechanobiology for a new era in medicine. Trends Mol. Med. 2013;19:555–564. doi: 10.1016/j.molmed.2013.05.005. [DOI] [PubMed] [Google Scholar]

[bib14] 14.Fujio M., Yamamoto A., Ando Y., Shohara R., Kinoshita K., Kaneko T., Hibi H., Ueda M. Stromal cell-derived factor-1 enhances distraction osteogenesis-mediated skeletal tissue regeneration through the recruitment of endothelial precursors. Bone. 2011;49:693–700. doi: 10.1016/j.bone.2011.06.024. [DOI] [PubMed] [Google Scholar]

[bib15] 15.Schweizerhof M., Stosser S., Kurejova M., Njoo C., Gangadharan V., Agarwal N., Schmelz M., Bali K.K., Michalski C.W., Brugger S., et al. Hematopoietic colony-stimulating factors mediate tumor-nerve interactions and bone cancer pain. Nat. Med. 2009;15:802–U122. doi: 10.1038/nm.1976. [DOI] [PubMed] [Google Scholar]

[bib16] 16.Fafián-Labora J.A., Rodriguez-Navarro J.A., O'Loghlen A. Small Extracellular Vesicles Have GST Activity and Ameliorate Senescence-Related Tissue Damage. Cell Metab. 2020;32:71. doi: 10.1016/j.cmet.2020.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib17] 17.Théry C., Witwer K.W., Aikawa E., Alcaraz M.J., Anderson J.D., Andriantsitohaina R., Antoniou A., Arab T., Archer F., Atkin-Smith G.K., et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles. 2018;7 doi: 10.1080/20013078.2018.1535750. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] 18.Trajkovic K., Hsu C., Chiantia S., Rajendran L., Wenzel D., Wieland F., Schwille P., Brügger B., Simons M. Ceramide triggers budding of exosome vesicles into multivesicular Endosomes. Science. 2008;319:1244–1247. doi: 10.1126/science.1153124. [DOI] [PubMed] [Google Scholar]

[bib19] 19.Xu X., Wang W., Wang Z., Lv J., Xu X., Xu J., Yang J., Zhu X., Lu Y., Duan W., et al. DW14006 as a Direct AMPKalpha Activator Ameliorates Diabetic Peripheral Neuropathy in Mice. Diabetes. 2020;69:1974–1988. doi: 10.2337/db19-1084. [DOI] [PubMed] [Google Scholar]

[bib20] 20.Xia W., Xie J., Cai Z., Liu X., Wen J., Cui Z.K., Zhao R., Zhou X., Chen J., Mao X., et al. Damaged brain accelerates bone healing by releasing small extracellular vesicles that target osteoprogenitors. Nat. Commun. 2021;12 doi: 10.1038/s41467-021-26302-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] 21.Hu J., Hou Y., Park H., Choi B., Hou S., Chung A., Lee M. Visible light crosslinkable chitosan hydrogels for tissue engineering. Acta Biomater. 2012;8:1730–1738. doi: 10.1016/j.actbio.2012.01.029. [DOI] [PubMed] [Google Scholar]

[bib22] 22.Mateescu B., Kowal E.J.K., van Balkom B.W.M., Bartel S., Bhattacharyya S.N., Buzás E.I., Buck A.H., de Candia P., Chow F.W.N., Das S., et al. Obstacles and opportunities in the functional analysis of extracellular vesicle RNA - an ISEV position paper. J. Extracell. Vesicles. 2017;6 doi: 10.1080/20013078.2017.1286095. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] 23.Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature. 2001;414:813–820. doi: 10.1038/414813a. [DOI] [PubMed] [Google Scholar]

[bib24] 24.Dandona P., Thusu K., Cook S., Snyder B., Makowski J., Armstrong D., Nicotera T. Oxidative damage to DNA in diabetes mellitus. Lancet. 1996;347:444–445. doi: 10.1016/s0140-6736(96)90013-6. [DOI] [PubMed] [Google Scholar]

[bib25] 25.Rupaimoole R., Slack F.J. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat. Rev. Drug Discov. 2017;16:203–222. doi: 10.1038/nrd.2016.246. [DOI] [PubMed] [Google Scholar]

[bib26] 26.Zheng H.Z., Fu X.K., Shang J.L., Lu R.X., Ou Y.F., Chen C.L. Ginsenoside Rg1 protects rat bone marrow mesenchymal stem cells against ischemia induced apoptosis through miR-494-3p and ROCK-1. Eur. J. Pharmacol. 2018;822:154–167. doi: 10.1016/j.ejphar.2018.01.001. [DOI] [PubMed] [Google Scholar]

[bib27] 27.Sun T., Cheung K.S.C., Liu Z.L., Leung F., Lu W.W. Matrix metallopeptidase 9 targeted by hsa-miR-494 promotes silybin-inhibited osteosarcoma. Mol. Carcinog. 2018;57:262–271. doi: 10.1002/mc.22753. [DOI] [PubMed] [Google Scholar]

[bib28] 28.Chen S.M., Wang B.Y., Lee C.H., Lee H.T., Li J.J., Hong G.C., Hung Y.C., Chien P.J., Chang C.Y., Hsu L.S., Chang W.W. Hinokitiol up-regulates miR-494-3p to suppress BMI1 expression and inhibits self-renewal of breast cancer stem/progenitor cells. Oncotarget. 2017;8:76057–76068. doi: 10.18632/oncotarget.18648. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib29] 29.Sengupta S., Toh S.A., Sellers L.A., Skepper J.N., Koolwijk P., Leung H.W., Yeung H.W., Wong R.N.S., Sasisekharan R., Fan T.P.D. Modulating angiogenesis - The yin and the yang in ginseng. Circulation. 2004;110:1219–1225. doi: 10.1161/01.Cir.0000140676.88412.Cf. [DOI] [PubMed] [Google Scholar]

[bib30] 30.Guo H., Huang S., Yang X., Wu J., Kirk T.B., Xu J., Xu A., Xue W. Injectable and Self-Healing Hydrogels with Double-Dynamic Bond Tunable Mechanical, Gel-Sol Transition and Drug Delivery Properties for Promoting Periodontium Regeneration in Periodontitis. Acs Appl. Mater Inter. 2021;13:61638–61652. doi: 10.1021/acsami.1c18701. [DOI] [PubMed] [Google Scholar]

[bib31] 31.Yang Y., Li Y., Pan Q., Bai S., Wang H., Pan X.H., Ling K.K., Li G. Tibial cortex transverse transport accelerates wound healing via enhanced angiogenesis and immunomodulation. Bone Joint Res. 2022;11:189–199. doi: 10.1302/2046-3758.114.Bjr-2021-0364.R1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] 32.Tomlinson R.E., Silva M.J. Skeletal Blood Flow in Bone Repair and Maintenance. Bone Res. 2013;1:311–322. doi: 10.4248/Br201304002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33.Ramasamy S.K., Kusumbe A.P., Adams R.H. Regulation of tissue morphogenesis by endothelial cell-derived signals. Trends Cell Biol. 2015;25:148–157. doi: 10.1016/j.tcb.2014.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] 34.Jansen F., Yang X.Y., Nickenig G., Werner N. Endothelial Microparticle-mediated Transfer of MicroRNA-126 Promotes Vascular Endothelial Cell Repair Via SPRED1 and is Abrogated in Glucose-damaged Endothelial Microparticles. Circulation. 2013;128 doi: 10.1161/CIRCULATIONAHA.113.001720. [DOI] [PubMed] [Google Scholar]

[bib35] 35.Goldstein S., Moerman E.J., Soeldner J.S., Gleason R.E., Barnett D.M. Diabetes mellitus and genetic prediabetes. Decreased replicative capacity of cultured skin fibroblasts. J. Clin. Invest. 1979;63:358–370. doi: 10.1172/JCI109311. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] 36.Sundaram G.M., Common J.E.A., Gopal F.E., Srikanta S., Lakshman K., Lunny D.P., Lim T.C., Tanavde V., Lane E.B., Sampath P. 'See-saw' expression of microRNA-198 and FSTL1 from a single transcript in wound healing. Nature. 2013;495:103–106. doi: 10.1038/nature11890. [DOI] [PubMed] [Google Scholar]

[bib37] 37.Falanga V. Wound healing and its impairment in the diabetic foot. Lancet. 2005;366:1736–1743. doi: 10.1016/S0140-6736(05)67700-8. [DOI] [PubMed] [Google Scholar]

[bib38] 38.Mao G., Liu Y., Fang X., Liu Y., Fang L., Lin L., Liu X., Wang N. Tumor-derived microRNA-494 promotes angiogenesis in non-small cell lung cancer. Angiogenesis. 2015;18:373–382. doi: 10.1007/s10456-015-9474-5. [DOI] [PubMed] [Google Scholar]

[bib39] 39.Orso F., Quirico L., Dettori D., Coppo R., Virga F., Ferreira L.C., Paoletti C., Baruffaldi D., Penna E., Taverna D. Role of miRNAs in tumor and endothelial cell interactions during tumor progression. Semin. Cancer Biol. 2020;60:214–224. doi: 10.1016/j.semcancer.2019.07.024. [DOI] [PubMed] [Google Scholar]

[bib40] 40.Tenchov R., Sasso J.M., Wang X., Liaw W.S., Chen C.A., Zhou Q.A. Exosomes-Nature's Lipid Nanoparticles, a Rising Star in Drug Delivery and Diagnostics. ACS Nano. 2022;16:17802–17846. doi: 10.1021/acsnano.2c08774. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.Leung K.W., Ng H.M., Tang M.K.S., Wong C.C.K., Wong R.N.S., Wong A.S.T. Ginsenoside-Rg1 mediates a hypoxia-independent upregulation of hypoxia-inducible factor-1 alpha to promote angiogenesis. Angiogenesis. 2011;14:515–522. doi: 10.1007/s10456-011-9235-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib42] 42.Zhai K., Duan H., Wang W., Zhao S., Khan G.J., Wang M., Zhang Y., Thakur K., Fang X., Wu C., et al. Ginsenoside Rg1 ameliorates blood-brain barrier disruption and traumatic brain injury via attenuating macrophages derived exosomes miR-21 release. Acta Pharm. Sin. B. 2021;11:3493–3507. doi: 10.1016/j.apsb.2021.03.032. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib43] 43.Wang Z., Wang L., Jiang R., Li C., Chen X., Xiao H., Hou J., Hu L., Huang C., Wang Y. Ginsenoside Rg1 prevents bone marrow mesenchymal stem cell senescence via NRF2 and PI3K/Akt signaling. Free Radic. Biol. Med. 2021;174:182–194. doi: 10.1016/j.freeradbiomed.2021.08.007. [DOI] [PubMed] [Google Scholar]

[bib44] 44.Alolga R.N., Nuer-Allornuvor G.F., Kuugbee E.D., Yin X., Ma G. Ginsenoside Rg1 and the control of inflammation implications for the therapy of type 2 diabetes: A review of scientific findings and call for further research. Pharmacol. Res. 2020;152 doi: 10.1016/j.phrs.2020.104630. [DOI] [PubMed] [Google Scholar]

[bib45] 45.Yang F., Ma Q., Matsabisa M.G., Chabalala H., Braga F.C., Tang M. Panax notoginseng for Cerebral Ischemia: A Systematic Review. Am. J. Chin. Med. 2020;48:1331–1351. doi: 10.1142/S0192415x20500652. [DOI] [PubMed] [Google Scholar]

[bib46] 46.Mohanan P., Subramaniyam S., Mathiyalagan R., Yang D.C. Molecular signaling of ginsenosides Rb1, Rg1, and Rg3 and their mode of actions. J. Ginseng Res. 2018;42:123–132. doi: 10.1016/j.jgr.2017.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib47] 47.Lancaster G.A., Dodd S., Williamson P.R. Design and analysis of pilot studies: recommendations for good practice. J. Eval. Clin. Pract. 2004;10:307–312. doi: 10.1111/j.2002.384.doc.x. [DOI] [PubMed] [Google Scholar]

PERMALINK

Bone transport induces the release of factors with multi-tissue regenerative potential for diabetic wound healing in rats and patients

Jing Xie

Xuhua Liu

Biaoliang Wu

Bochong Chen

Qiancheng Song

Yuan Guan

Yuanxun Gong

Chengliang Yang

Jinbo Lin

Mingfeng Huang

Xinyu Tan

Ruijun Lai

Xiaozhen Lin

Sheng Zhang

Xiaoling Xie

Xiaoli Chen

Chunyuan Zhang

Mei Yang

Huijiao Nong

Xiaoyang Zhao

Laixin Xia

Weijie Zhou

Guozhi Xiao

Qing Jiang

Weiguo Zou

Di Chen

Di Lu

Jia Liu

Xiaochun Bai

Summary

Graphical abstract

Highlights

Introduction

Results

Release of sEVs is crucial for BT-accelerated wound healing in diabetic patients and rats

Figure 1.

sEVs released during BT have multiple-tissue regenerative activities for diabetic wound healing

Figure 2.

Antioxidants and proregenerative miRNAs are enriched in plasma and sEVs during BT

Figure 3.

miR-494-3p targets CRMP4 and contributes to BT-promoted diabetic wound healing

Figure 4.

Combined use of Rg1 or agomir-494-3p with GSH efficiently accelerates wound healing in diabetic mice

Figure 5.

Figure 6.

Regimen of oral Rg1 and GSH accelerated wound healing in patients with refractory DFU

Figure 7.

Discussion

Limitations of the study

STAR★Methods

Key resources table

Resource availability

Lead contact

Materials availability

Data and code availability

Experimental model and study participant details

Human participants

Animals

Cell culture

Method details

Generation of the miR-494-/- rat model

Rat/mouse wound models

Rat BT models

Rat/mouse hind-limb ischemia models

Differential ultracentrifugation of several fractions from plasma and sEVs isolation

sEVs labeling and cellular uptake

Fluorescence imaging analysis of organ distribution of sEVs

Histological evaluation

Immunofluorescence staining and immunohistochemistry

Western blot analysis

TEM and NTA

RNA isolation

RT-PCR and qRT-PCR

Luciferase assays

miRNA transfection

Cell migration assays

Tube formation assay

Cell counting kit-8 assay

Generation of the miR-494^-/- rat model