Heyingwuzi formulation alleviates diabetic retinopathy by promoting mitophagy via the HIF-1α/BNIP3/NIX axis

Abstract

BACKGROUND

Diabetic retinopathy (DR) is the primary cause of visual problems in patients with diabetes. The Heyingwuzi formulation (HYWZF) is effective against DR.

AIM

To determine the HYWZF prevention mechanisms, especially those underlying mitophagy.

METHODS

Human retinal capillary endothelial cells (HRCECs) were treated with high glucose (hg), HYWZF serum, PX-478, or Mdivi-1 in vitro. Then, cell counting kit-8, transwell, and tube formation assays were used to evaluate HRCEC proliferation, invasion, and tube formation, respectively. Transmission electron microscopy was used to assess mitochondrial morphology, and Western blotting was used to determine the protein levels. Flow cytometry was used to assess cell apoptosis, reactive oxygen species (ROS) production, and mitochondrial membrane potential. Moreover, C57BL/6 mice were established in vivo using streptozotocin and treated with HYWZF for four weeks. Blood glucose levels and body weight were monitored continuously. Changes in retinal characteristics were evaluated using hematoxylin and eosin, tar violet, and periodic acid-Schiff staining. Protein levels in retinal tissues were determined via Western blotting, immunohistochemistry, and immunostaining.

RESULTS

HYWZF inhibited excessive ROS production, apoptosis, tube formation, and invasion in hg-induced HRCECs via mitochondrial autophagy in vitro. It increased the mRNA expression levels of BCL2-interacting protein 3 (BNIP3), FUN14 domain-containing 1, BNIP3-like (BNIP3L, also known as NIX), PARKIN, PTEN-induced kinase 1, and hypoxia-inducible factor (HIF)-1α. Moreover, it downregulated the protein levels of vascular endothelial cell growth factor and increased the light chain 3-II/I ratio. However, PX-478 and Mdivi-1 reversed these effects. Additionally, PX-478 and Mdivi-1 rescued the effects of HYWZF by decreasing oxidative stress and apoptosis and increasing mitophagy. HYWZF intervention improved the symptoms of diabetes, tissue damage, number of acellular capillaries, and oxidative stress in vivo. Furthermore, in vivo experiments confirmed the results of in vitro experiments.

CONCLUSION

HYWZF alleviated DR and associated damage by promoting mitophagy via the HIF-1α/BNIP3/NIX axis.

Core Tip: Our study demonstrates the protective effects and action mechanisms of the Heyingwuzi formulation against diabetic retinopathy (DR) in vivo and in vitro. Here, we developed a new treatment formulation for DR based on traditional Chinese medicine and revealed its action mechanism involving the promotion of mitophagy via regulation of the hypoxia-inducible factor-1α/BCL2-interacting protein 3 (BNIP3)/BNIP3-like (BNIP3L, also known as NIX) axis.

INTRODUCTION

Diabetes mellitus (DM) is a common metabolic disease characterized by chronic hyperglycemia, possibly leading to multi-organ damage, with no specific treatment[1]. The World Health Organization reports 422 million adults (8.5%) with DM worldwide, and this number is expected to increase to 592 million by 2035[2,3]. DM may induce various complications, such as cardiovascular, kidney, and eye diseases, posing a huge economic burden on affected individuals and healthcare systems. Diabetic retinopathy (DR) has attracted attention as the main cause of visual impairment and blindness in patients with diabetes[4]. The number of affected individuals is increasing annually with the increase in the incidence of diabetes and lifespan of patients[5]. Currently, pan-retinal photocoagulation (PRP) and anti-vascular endothelial cell growth factor (VEGF) therapy are the main treatments for DR. Although both methods are moderately effective, PRP may cause the loss of peripheral vision and macular edema, whereas anti-VEGF agents have a short duration of action[6,7]. Therefore, the development of novel and effective strategies is necessary for DR treatment.

Recently, traditional Chinese medicine is widely used for the comprehensive treatment of DM by improving the permeability of the blood-retinal barrier, retinal edema, and blood supply. These traditional medicines are widely used for clinical treatment and research. Heyingwuzi formulation (HYWZF) consists of Rehmannia glutinosa (R. glutinosa, 10 g), Angelica sinensis (10 g), figwort root (10 g), honeysuckle (10 g), dandelion (30 g), danshen (15 g), barbary wolfberry fruit (10 g), sealwort (10 g), pale butterfly bush flower (10 g), glossy privet fruit (10 g), chuanxiong (10 g), Cuscuta (15 g), Chushizi (10 g), white chrysanthemum (10 g), and Plantago (15 g). R. glutinosa is a common bulk medicinal plant widely used in China owing to its active ingredients. R. glutinosa improves diabetic damage via the advanced glycation end products/receptor for AGE/hypoxia-inducible factor (HIF)-1α and nuclear factor-κB/NLR family pyrin domain-containing 3 signaling pathways[8,9]. Plantago extract reduces the blood glucose levels in streptozotocin (STZ)-induced diabetic mice[10]. Salvianolic acid A is an active phenolic acid derived from danshen that alleviates diabetic complications[11]. Dandelion is used in herbal medicine for its choleretic, antirheumatic, and diuretic properties[12]. Dandelion water extract supplements improve the lipid metabolism and prevent complications in diabetic rats[13]. Therefore, we hypothesized that HYWZF also alleviates DR-induced damage.

Mitophagy is a type of self-regulation in which damaged mitochondria are broken down and reused to maintain the balance of material and energy metabolism[14]. Many studies have reported an association between mitophagy and DM. Zhang et al[15] reported that the upregulation of mitophagy and antioxidant enzyme activity reduces the oxidative stress in the liver, thereby exerting protective effects against diabetes. Tang et al[16] revealed that melatonin plays a protective role in diabetic nephropathy via the AMP-activated protein kinase/PTEN-induced kinase 1 mitophagy pathway. A recent study reported that HIF-1α upregulates mitochondrial autophagy in the spinal cord of mice with diabetic neuropathic pain by regulating the Parkin signaling pathway[17]. HIF-1α triggers mitophagy in nucleus pulposus cells via BCL2-interacting protein 3 (BNIP3). However, whether HYWZF mediates mitophagy via HIF-1α to reduce DR injury remains unknown.

Mitophagy occurs via two main pathways: Receptor- and non-receptor-mediated pathways. The receptor-dependent pathway involves mitochondrial outer membrane proteins, such as BNIP3, BNIP3-like (BNIP3L, also known as NIX), and FUN14 domain-containing 1 (FUNDC1)[18]. As DM is a starvation-stimulated disease, we aimed to characterize the receptor-mediated mitophagy pathway and explore whether HIF-1α regulates mitophagy in this study. Consistent with previous reports, we found that HYWZF promoted mitophagy via HIF-1α. Therefore, this study provides a strong foundation for the development of effective DR treatment methods.

MATERIALS AND METHODS

Diabetes animal model establishment and treatment

Male C57BL/6 mice (8-wk-old, 22-30 g) purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., LTD were housed in a temperature-controlled room (22 °C ± 2 °C) under a 12 h/h light/dark cycle with free access to food and water. The model group was intraperitoneally injected with STZ (50 mg/kg/d) for five days to induce diabetes[19], whereas the control group (con) was injected with an equal volume of sodium citrate buffer (10 mg/mL). The model group mice were randomly divided into three different groups (n = 6 each): Diabetic model (mod), HYWZF-low-dose (HYWZF-L), and HYWZF-high-dose (HYWZF-H) groups. Mice in the HYWZF-L and HYWZF-H groups were orally administered low (12 g/kg/d) and high (24 g/kg/d) doses of HYWZF, respectively, for four weeks. Mice in the control and model groups were administered equal volumes of sterilized water.

Preparation of HYWZF serum

Mice in HYWZF-treated groups were administered 60.125 g/kg of HYWZF twice for three days. Mice in the control group received equal volumes of normal saline. Two hours after the final administration, mice were anesthetized using isoflurane. The collected blood was allowed to stand at room temperature and centrifuged to obtain the supernatant after inactivation at 56 °C for 30 min.

Cell culture

Human retinal capillary endothelial cells (HRCECs; BFN60804011) were purchased from Qingqi Biotechnology Development Co., Ltd. Normal (5.5 mM) or high glucose medium (33 mM) was used to culture the cells at 37 °C and 5% CO₂. After the cells adhered to the wall, serum starvation was carried out for 24 h. After replacing with a fresh medium, the cells were cultured for 48 h. Cells cultured in the high glucose medium were randomly divided into five groups: high glucose (hg), hg + negative serum (NEG), hg + 10% HYWZF serum (hg + ps), hg + 10% HYWZF serum + HIF-1α inhibitor (hg + ps + PX-478), hg + 10% HYWZF serum + mitochondrial inhibitor (hg + ps + Mdivi-1) groups. After high glucose treatment, the hg + ns group was treated with the NEG, whereas the hg + ps + HIF-1α inhibitor and hg + ps + mitochondrial inhibitor groups were treated with PX-478 (10 μM, S7612) and Mdivi-1 (25 μM, S7162), respectively, for 2 h. Then, hg + ps, hg + ps + HIF-1α inhibitor, and hg + ps + mitochondrial inhibitor groups were treated with 10% HYWZF serum for 48 h.

Cell viability assay

Cell viability was determined using the cell counting kit (CCK)-8 kit (BS350A; Biosharp, China). Briefly, 100 µL of HRCECs (2 × 10³ cells/well) were seeded on a 96-well plate. After the cells were completely attached to the cell wall, 10 µL CCK-8 solution was added to each well and incubated for 2 h. Finally, a microplate reader (Spectra max PLUS 384; Molecular Devices) was used to measure the absorbance at 450 nm.

Transwell assay

Cell invasion was assessed using the transwell assay with the transwell chambers (8-μm pore; Corning, United States). HRCECs (1 × 10⁵ cells/mL) suspended in a serum-free culture medium with or without HYWZF were added to the upper chamber. The lower chamber was filled with 600 μL of complete medium. After 48 h, the non-invading cells on the upper chamber were wiped off and the cells on the lower chamber were fixed with methanol and stained with 0.1% crystal violet. After air-drying, digital images were acquired, and the number of invasive cells was counted under a microscope (Olympus BX61, Olympus, Japan).

Tube formation assay

Matrigel (200 µL) was added to each well of a 96-well plate and placed in an incubator for 30 min. HRCECs (2 × 10⁵ cells/well) were seeded in the matrigel-coated plates and incubated at 37 °C for 16 h, after which the number of tubes was counted in two random fields from each well under a microscope (Olympus BX61, Olympus, Japan).

Cell apoptosis detection

HRCEC apoptosis was detected using the Annexin V-APC/propidium iodide (PI) apoptosis detection kit (KGA1030; KeyGEN Bio-Tech, China). Cells were seeded in a 6-well plate at a density of 3 × 10⁵ cells/well and treated with HYWZF for 48 h. Then, the cells were digested, washed with phosphate-buffered saline (PBS; AM9624; Thermo Fisher Scientific, United States), and stained with annexin V (5 μL) and PI (5 μL) for 15 min in the dark. Cell apoptosis was assessed using a flow cytometer (CytoFlex; Beckman Coulter).

Quantitative reverse transcription-polymerase chain reaction

Total RNA was obtained from cells using the Total RNA Kit (19221ES50; YEASEN, China) and reverse-transcribed into cDNA using the PrimeScript RT reagent kit (RR047A; Baori Doctor Biotechnology, China). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using Tli RNase H Plus (RR820A; Baori Doctor Biotechnology). The reaction conditions for qRT-PCR were as follows: Pre-denaturation heating at 95 °C for 30 s, 40 cycles of denaturation at 95 °C for 5 s, annealing at 56 °C, and extension at 72 °C for 30 s. Relative expression was determined using the 2^-ΔΔCt method[20]. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal reference. Each sample was tested thrice. All primer sequences are listed in Table 1.

Table 1.

Primer sequences used for quantitative reverse transcription-polymerase chain reaction

Gene	Forward primers	Reverse primers
HIF-1α	TGCTCATCAGTTGCCACTTCCAC	CACCCTGTTGCTGTAGCCAAA
BNIP3	AATAATGGGAACGGGGGCAG	CCCCCTTTCTTCATGACGCT
NIX	CACACCAGCAGGGACCATAG	TGTGCTCAGTCGCTTTCCAA
FUNDC1	CCCCCTCCCCAAGACTATGA	TGCAAGTCCGAGCAAAAAGC
PINK1	AGTCCATTGGTAAGGGCTGC	AAATCTGCGATCACCAGCCA
Parkin	AATCAGAGGGCTCTGGAGGT	TCATCCGAATGGACCGGATT
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA

Western blotting

HRCECs were lysed using the radioimmunoprecipitation assay buffer (P0013; Biyuntian, China). The supernatant was collected, and protein concentration was quantitatively analyzed using the BCA kit (P0009; Biyuntian). Protein samples were treated with the sodium dodecyl sulfate (SDS) loading buffer for 5 min, subjected to SDS-polyacrylamide gel electrophoresis, and transferred onto polyvinylidene fluoride membranes (ISEQ00010; Sigma-Aldrich, United Kingdom). The membranes were blocked with TBST containing 5% skim milk for 1 h and incubated overnight at 4 °C with anti-P62 (A19700; 1:1000; Abclonal, China), anti-light chain 3 (LC3)-B (A19665; 1:1000; Abclonal), anti-β-actin (AC026; 1:50000; Abclonal), anti-BNIP3L (DF8163; 1:3000; Affinity, United States), anti-COX IV (A6564; 1:5000; Abclonal), anti-Beclin1 (A7353; 1:2000; Abclonal), anti-HIF-1α (BS-20399R; 1:2000; Bioss, China), anti-Bcl2 (A19693; 1:2000; Abclonal), anti-caspase-3 (A2156; 1:1000; Abclonal), anti-claudin-5 (AF5216; 1:2000; Affinity), anti-occludin (A2601; 1:1000; Abclonal), anti-VEGF (BS-34032R; 1:1000; Bioss), anti-matrix metalloproteinase (MMP)-9 (A11147; 1:1000; Abclonal), and anti-BNIP3 (BS-4239R; 1:2000; Bioss) antibodies. Then, the membranes were incubated again with goat anti-rabbit IgG (ab150077; 1:1000; Abcam, United Kingdom) secondary antibodies for 1 h at room temperature and captured using the iBright CL750 instrument (A44116; Thermo Fisher Scientific) with the ECL Plus HRP substrate kit (k22030; Abbkine, United States).

Liquid chromatography-tandem mass spectrometry assay

High-performance LC (HPLC; Ultimate 3000; Thermo Fisher Scientific) and mass spectrometer (TripleTOF5600+; AB SCIEX, CA, United States) were used to identify the components in the HYWZF serum. A Sepax GP-C18 Column (1.8 µm, 120 Å, 2.1 mm × 150.0 mm) was used to load the serum after activation by methanol and water. Moreover, 0.1% formic acid was used as mobile phase A and 100% ACN as mobile phase B. Each component was analyzed for 21 min at 40 °C at 0.3 mL/min. The similarities among the HPLC fingerprints of six batches of serum samples were evaluated using the Computer-Aided Similarity Evaluation System for Chromatographic Fingerprints of Traditional Chinese Medicine. The fingerprint similarities at 238 nm and 440 nm were greater than or equal to 0.982 and 0.862, respectively. Electrospray ionization positive and negative ion modes were used for MS analysis. Secondary mass spectra were obtained using information-dependent acquisition. MS-DIAL 4.70 software and various databases, including the MassBank, RIKEN tandem mass spectral, and Global Natural Products Social Molecular Networking databases, were used to analyze the HYWZF components.

Measurement of mitochondrial membrane potential

Cells were uniformly resuspended in the JC-1 working solution (500 µL) and incubated at 37 °C and 5% CO₂ for 20 min. After centrifugation at 350 × g for 5 min, the supernatant was discarded, and cells were washed twice with 1 × incubation buffer (1 mL). Then, cells were resuspended in 500 µL of 1 × incubation buffer and analyzed using a flow cytometer.

Determination of reactive oxygen species levels

HRCECs (5 × 10⁵ cells/well) were seeded in 6-well plates and cultured overnight. After PBS washing, cells were collected and incubated with 5 µM 2’,7’-dichlorodihydrofluorescein diacetate for 30 min in an incubator. The fluorescence intensity of the cells was analyzed using a flow cytometer.

Transmission electron microscopy

HRCECs were fixed with 2.5% glutaraldehyde at 4 °C overnight and washed thrice with PBS. The cells were then fixed with 2% osmium tetroxide at room temperature for 2 h, dehydrated with ethanol (50%, 70%, 80%, 90%, and 100%), and embedded in Epon812 resin (1260804; SPI). The sections were stained with uranyl acetate/lead citrate and examined under a transmission electron microscope (JEM-1400FLASH; Japan).

Enzyme-linked immunosorbent assay of retinal samples

Superoxide dismutase (SOD), malondialdehyde (MDA), glutathione peroxidase (GSH-Px), and ATP activities were determined using the total SOD activity (A001-3-1; Nanjing Jiancheng Bioengineering Institute, China), MDA activity (A003-1-2), GSH-Px activity (A005-1-2), and ATP activity (A016-2-1) detection kits. EB was performed as described by Sun et al[21].

Hematoxylin and eosin and tar violet staining

Retinal tissues were fixed with 4% paraformaldehyde for 48 h at 4 °C and embedded in paraffin. Paraffin sections (5 μm) were then deparaffinized, dehydrated with alcohol, and stained with Hematoxylin and eosin (HE) and 0.1% tar violet staining solution (G1700; Beijing Solaibao Technology Co., Ltd., China). After washing with distilled water, the sections were dehydrated with alcohol, cleared with xylene, and mounted using distyrene plasticizer xylene.

Periodic acid-shiff staining

Tissue sections were incubated with the periodate solution (G1280; Wuhan Saiweier Biotechnology Co., Ltd., China) for 8 min, dipped in Schiff’s reagent for 15 min, and stained with hematoxylin for 1 min. After staining, the slides were dehydrated using a gradient of alcohol and cleared with xylene for 2 min after each reagent.

Immunohistochemistry

After antigen retrieval and peroxidase blocking, tissue slices were incubated with anti-VEGF (05-443; 1:100; Sigma-Aldrich, United States) and zonula occludens (ZO)-1 (21773-1-AP; 1:100; Proteintech, China) antibodies for 24 h at 4 °C, followed by incubation with secondary goat anti-rabbit antibodies (GB23303; 1:100; Servicebio, China) at 37 °C for 30 min. Finally, DAB chromogenic solution (ZLI-9018; 1:20; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., China) was added with hematoxylin as a mild counterstain, and the sections were dehydrated in a graded series of ethanol and sealed.

Immunofluorescence assay

Tissue slices were blocked with 3% bovine serum albumin (GC305010; Wuhan Sevier Biotechnology Co., Ltd. China) at 25 °C for 30 min and incubated with the anti-lysosome membrane-associated protein (LAMP)-2 (66301-1-IG; 1:100; Proteintech, United States), LC3B (14600-1-AP; 1:100; Proteintech), and Tom20 (11802-1-AP; 1:100; Proteintech) antibodies. The sections were then incubated with goat anti-rabbit IgG (GB22303; 1:100; Servicebio) or goat anti-mouse IgG (GB21301; 1:100; Servicebio) antibodies.

Statistical analyses

All statistical analyses were conducted using SPSS23.0 (IBM). Statistical significance was set at P < 0.05. Results are expressed as the mean ± SD. One-way analysis of variance was used to compare multiple groups.

RESULTS

Bioactive components of HYWZF

CCK-8 assay was used to determine the effects of HYWZF serum on HRCECs in a medium-to high-glucose Dulbecco’s modified Eagle’s medium (DMEM) (HyClone, China). As shown in Figure 1A and B, 15% HYWZF serum inhibited the cell viability in normal and high-glucose DMEM, whereas 10% HYWZF serum did not affect the cell viability. Chromatographic analysis (Figure 1C and D) revealed 114 bioactive constituents in HYWZF (Table 2; Supplementary Table 1).

Figure 1.

The analysis of heying wuzi formulation serum effects on human retinal capillary endothelial cell viability in high glucose Dulbecco’s modified Eagle’s medium and active ingredients. A: CCK-8 assay was performed to determine the heying wuzi formulation (HYWZF) serum effects on cell viability in ordinary Dulbecco’s modified Eagle’s medium (DMEM, D-glucose, 5.5 mM); B: HYWZF serum effects on cell viability in high glucose DMEM (D-glucose, 33 mM); C: Chromatographic analysis for HYWZF (positive ion mode); D: Chromatographic analysis for HYWZF (negative ion mode). ^aP value < 0.05, ^bP value < 0.01. HYWZF: Heying wuzi formulation; NEG: Negative serum.

Table 2.

Components of the heying wuzi formulation serum that were identified by liquid chromatography-tandem mass spectrometry

No.	Title	RT (min)	Area	Ontology
1	Phosphatidylethanolamine lyso 22	13.94715	1899972.00	2-acyl-sn-glycero-3-phosphoethanolamines
2	Phosphatidylethanolamine lyso 18	15.32940	226900.40	2-acyl-sn-glycero-3-phosphoethanolamines
3	Citric acid	1.820983	184061.70	Tricarboxylic acids and derivatives
4	sn-Glycero-3-phosphocholine	14.45802	144480.10	Glycerophosphocholines
5	(2R,3R,6R,8R,9S,12S,13R,14R,15R,16R)-6,8,14,15-tetrahydroxy-2,6,13,16-tetramethyl-3-{[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-10-oxatetracyclo[7.6.1.0,.0,]hexadec-4-en-11-one	14.30263	143726.20	Eudesmanolides, secoeudesmanolides, and derivatives
6	Phosphatidylethanolamine lyso 20	13.50750	80798.77	2-acyl-sn-glycero-3-phosphoethanolamines
7	2-[(4S,5S,5aS,9aS)-4-methoxy-6,6,9a-trimethyl-5-[(2E,4E,6E)-octa-2,4,6-trienoyl]oxy-1-oxo-4,5,5a,7,8,9-hexahydro-3H-benzo[e]isoindol-2-yl]pentanedioic acid	15.12730	50046.63	Glutamic acid and derivatives
8	Phosphatidylethanolamine lyso alkenyl 16	15.92828	20239.35	Glycerophosphoethanolamines
9	USNIC ACID	7.950984	17973.83	Acetophenones
10	FORMONONETIN	11.89108	16466.15	4’-O-methylisoflavones
11	PFCA-unsaturated	1.420167	15911.72	PFSA
12	3-hydroxy-1a,5-bis(hydroxymethyl)-5,6b-dimethyl-1,3,3a,4,6,6a-hexahydrocyclopropa[e]inden-2-one	11.26097	15753.38	Cyclic alcohols and derivatives
13	4-[5-[[4-[5-[acetyl(hydroxy)amino]pentylamino]-4-oxobutanoyl]-hydroxyamino]pentylamino]-4-oxobutanoic acid	14.49665	426921.60	N-acyl amines
14	LPE 16:0	14.81610	94029.74	Lipids
15	Cytarabine	1.46050	28727.73	Pyrimidine nucleosides
16	Indole-3-acetyl-L-alanine	7.712983	17271.44	Amino acids
17	Taurocholic acid	13.89302	14700.46	Trihydroxy bile acids, alcohols, and derivatives
18	10-Hydroxydecanoic acid	11.39715	11104.43	Medium-chain hydroxy acids and derivatives
19	Phosphatidylethanolamine lyso 16	15.29023	178188.7	2-acyl-sn-glycero-3-phosphoethanolamines
20	Actrarit	6.760533	23273.13	Benzene and substituted derivatives
21	Pyroglutamic acid	1.820983	19421.45	Alpha amino acids and derivatives
22	Atenolol acid	11.30097	12153.77	Phenol ethers
23	D-PANTOTHENIC ACID	1.94130	22119.00	Secondary alcohols
24	Acacetin	18.55157	15547.79	4’-O-methylated flavonoids
25	(1R,6R,10S,11R,13S,15R)-1,6-dihydroxy-8-(hydroxymethyl)-4,12,12,15-tetramethyl-5-oxotetracyclo[8.5.0.0,.0,]pentadeca-3,8-dien-13-yl hexadecanoate	14.02730	61856.96	Phorbol esters
26	arctigenin	11.81143	24300.10	Dibenzylbutyrolactone lignans
27	4-Hydroxy-4-methyl-2-pentanone	20.19918	11647.11	Beta-hydroxy ketones
28	12-hydroxyeicosapentaenoic acid	14.65860	84224.38	Hydroxyeicosapentaenoic acids
29	(+/-)-Synephrine	20.86260	72999.33	1-hydroxy-2-unsubstituted benzenoids
30	Phosphatidylcholine lyso 16	15.93340	59974.72	2-acyl-sn-glycero-3-phosphocholines
31	4-O-Methylphloracetophenone	1.17735	19537.06	Alkyl-phenylketones
32	5-Methoxy-3-indoleacetic acid	8.153967	13901.50	Indole-3-acetic acid derivatives
33	(1R,9S,10S)-3,4-dihydroxy-11,11-dimethyl-5-(propan-2-yl)-16-oxatetracyclo[7.5.2.0,.0,]hexadeca-2(7),3,5-triene-8,15-dione	15.36857	66856.04	Diterpene lactones
34	3-Isobutylglutaric acid	8.214517	16494.50	Methyl-branched fatty acids
35	LPC 18:1	15.80038	1556111.00	Lipids
36	Phosphatidylcholine lyso 18	16.44933	19155.42	2-acyl-sn-glycero-3-phosphocholines
37	Reserpine	15.13208	27432.26	Yohimbine alkaloids
38	ISOPALMITIC ACID	10.76080	133306.00	Long-chain fatty acids
39	Celastrol	16.38930	16379.43	Triterpenoids
40	(4E,8E)-10-(4-hydroxy-6-methoxy-7-methyl-3-oxo-1H-2-benzofuran-5-yl)-4,8-dimethyldeca-4,8-dienoic acid	15.60355	67788.85	Terpene lactones
41	icos-19-ene-1,2,4-triol	11.94487	16965.70	Long-chain fatty alcohols
42	FT-thioether	7.47550	402198.90	PFSA
43	5-Methoxypsoralen	1.379833	717938.30	5-methoxypsoralens
44	Chaulmoogric Acid	13.66750	19960.99	Long-chain fatty acids
45	Cinnamoylglycine	7.752817	16160.29	N-acyl-alpha amino acids
46	Griseofulvin	7.03820	19173.55	Benzofurans
47	Ketoisovaleric acid	1.841267	9078.108	Short-chain keto acids and derivatives
48	Glycocholic Acid	15.75758	439946.10	Glycinated bile acids and derivatives
49	Phosphatidylserine 18	15.56438	30450.24	Phosphatidylserines
50	[(6Z,10Z)-6-(acetyloxymethyl)-10-(hydroperoxymethyl)-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] 2-methylbutanoate	9.359233	23463.89	Germacranolides and derivatives
51	(2E,4E)-1-[(2R,6S,14S,22S,25R)-25-(3,3-dimethyloxiran-2-yl)-15-methyl-1,3,13,15-tetraazaheptacyclo[18.4.1.0,.0,.0,.0,.0,]pentacosa-7,9,11,16(21),17,19-hexaen-3-yl]hexa-2,4-dien-1-one	14.41933	93651.37	Alpha carbolines
52	2-[5-[2-[2-[5-(2-hydroxypropyl)oxolan-2-yl]propanoyloxy]propyl]oxolan-2-yl]propanoic acid	12.90287	30013.75	Dicarboxylic acids and derivatives
53	Bufotalin	15.83517	45015.64	Bufanolides and derivatives
54	Furostane base -2H + O-Hex, O-Hex-dHex-dHex-dHex	9.319567	21781.36	Steroidal saponins
55	C18(Plasm)-18:1 PC	11.90607	40133.82	1-(1Z-alkenyl),2-acyl-glycerophosphocholines
56	DErySphingosine	10.83890	38805.35	1,2-aminoalcohols
57	C12-AE1S (TENTATIVE)	12.62238	29299.55	Sulfuric acid monoesters
58	LPC 18:3	13.62767	173150.50	Lipids
59	Nifekalant	6.64155	22225.56	Phenylpropylamines
60	beta-N-Methylaminoalanine	13.10987	30146.63	Alpha amino acids
61	Serine-Cholic Acid	15.32113	551130.30	Glycinated bile acids and derivatives
62	methyl 4-((10R,13R)-3-hydroxy-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl) pentanoate	15.44695	19387.68	Monohydroxy bile acids, alcohols, and derivatives
63	Diatoxanthin	7.272067	14265.04	Triterpenoids
64	Argatroban	15.12730	47349.21	Dipeptides
65	9-Methoxy-2,2-dimethyl-2,6-dihydro-pyrano[3,2-c]quinolin-5-one	1.35255	17009.10	Pyranoquinolines
66	Phosphatidylcholine 16	7.83215	48466.42	Phosphatidylcholines
67	Glutamine	1.33950	40752.10	Alpha amino acids
68	(E)-5-hydroxy-N-[3-[5-[3-[[(E)-5-hydroxy-3-methylpent-2-enoyl]amino]propyl]-3,6-dioxopiperazin-2-yl]propyl]-3-methylpent-2-enamide	11.65172	14764.10	Alpha amino acids and derivatives
69	LPC 16:0	14.89577	1942964.00	Lipids
70	Shanzhiside methyl ester	14.03128	26912.56	Iridoid O-glycosides
71	9-Trans-Palmitelaidic acid	18.88537	58417.61	Long-chain fatty acids
72	Sebacic acid	8.96275	28959.26	Medium-chain fatty acids
73	Vindoline	13.89302	60721.01	Plumeran-type alkaloids
74	9Z,12Z-Linoleic acid (NMR)	19.25802	313966.20	Lineolic acids and derivatives
75	3-Indoxyl sulfate	6.68105	322077.40	Arylsulfates
76	a-Linolenic acid (NMR)	18.11325	80101.46	Lineolic acids and derivatives
77	Arachidonic acid	18.92453	253179.40	Long-chain fatty acids
78	Taurine	8.30815	5742.452	Organosulfonic acids
79	LPC 18:2	14.18563	1163369.00	Lipids
80	Oleic acid	20.54262	181184.10	Long-chain fatty acids
81	Conessine	12.99227	21960.55	Conanine-type alkaloids
82	PROTOVERATRINE A	1.379833	21784.06	Cerveratrum-type alkaloids
83	4-Nitrophenol	20.19397	10567.01	Nitrophenols
84	methyl orsellinate	1.313333	25321.51	P Hydroxybenzoic acid alkyl esters
85	Atalaphylline	13.38752	47479.44	Acridones
86	PFSA-pentafluorosulfide	1.17735	85352.33	PFSA
87	piperazine-2,5-dione	1.841267	12361.39	Alpha amino acids and derivatives
88	N-(4-((6aR,8aS)-4-hydroxy-6a,8a,9-trimethyl-3,4,5,6,6a,6b,7,8,8a,8b,11a,12,12a,12b-tetradecahydro-1H-naphtho[2’,1’:4,5]indeno[2,1-b]furan-10-yl)-2-methylbutyl)acetamide	15.32113	1344867.00	Furostanes and derivatives
89	6-(furan-3-yl)-6,8,12,16,21-pentahydroxy-7,15-dimethyl-9-oxo-3,17,19-trioxaheptacyclo[9.9.3.0,.0,.0,.0,.0,]tricosan-14-yl 2-methylbutanoate	13.50750	38900.18	Limonoids
90	Gedunol	15.79632	305832.30	Limonoids
91	2,6-di-tert-butyl-4-methylphenol	1.70115	164993.80	Phenylpropanes
92	1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine	16.57080	1376141.00	Phosphatidylcholines
93	Trifluoroacetic acid	16.21035	175237.70	PFSA
94	Germinaline	1.379833	26898.38	Alkaloids
95	Phytosphingosine (not validated, isomer of 1696)	10.79983	58379.87	Lipids
96	Choline	15.32113	1686757.00	Cholines
97	Decanoic acid	19.0867	11618.62	Medium-chain fatty acids
98	7-ethenyl-1,4a,7-trimethyl-3,4,6,8,8a,9,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	17.87777	111714.60	Diterpenoids
99	Uric acid	1.820983	69064.27	Xanthines
100	vanillic acid	1.313333	53861.45	M-methoxybenzoic acids and derivatives
101	Tuberostemonine	12.69258	91277.17	Stichoneurine-type alkaloids
102	(1R,2R,5R,5’S,6S,8aS)-6-(acetyloxy)-2,5,8a-trimethyl-5’’-oxo-octahydro-2H-dispiro[naphthalene-1,2’:5’,3’-bis(oxolane)]-5-ylmethyl acetate	15.32113	668259.40	Diterpene lactones
103	(R)-4-aminoisoxazolidin-3-one	1.934117	30480.44	Alpha amino acids and derivatives
104	(1S,3R,6S,6aR,6bR,8S,9S,11R,11aR,12R,12aR,14R)-1-ethyl-6,8,11-trihydroxy-3-methyl-10-methylenetetradecahydro-3,6a,12-(epiethane[1,1,2]triyl)-9,11a-methanoazuleno[2,1-b]azocine 1-oxide	12.69258	247497.70	Kaurane diterpenoids
105	Secoisolariciresinol	12.26407	15677.30	Dibenzylbutanediol lignans
106	Cyclamate	6.110917	33820.46	Cyclamates
107	Docosahexanoic acid	18.55157	591446.80	Very long-chain fatty acids
108	anthothecol	14.03128	23028.57	Limonoids
109	(1R,4aR,5S)-5-(3-hydroxy-3-methylpent-4-enyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	15.60355	517448.60	Diterpenoids
110	(6aR,8aS)-11-(3-acetamido-2-methylpropyl)-6a,8a,9-trimethyl-10-oxo-1,3,4,5,6,6a,6b,7,8,8a,8b,9,10,12,12a,12b-hexadecahydropentaleno[2,1-a]phenanthren-4-yl acetate	14.89468	53006.64	Steroid esters
111	4-((9S)-3,5,14-trihydroxy-10-((E)-((1-hydroxybutan-2-yl)imino)methyl)-13-methylhexadecahydro-1H-cyclopenta[a]phenanthren-17-yl)furan-2(5H)-one	13.89302	42323.20	Cardenolides and derivatives
112	N-ACETYL-L-LEUCINE	7.51500	24397.29	Leucine and derivatives
113	2-Mercaptobenzothiazole	17.58292	35381.59	Benzothiazoles
114	Pristimerin	17.16623	48255.61	Triterpenoids

PFSA: Perfluorosulfonic acid.

HYWZF reduces high glucose-induced invasion, tube formation, and apoptosis in HRCECs

Here, we found that hg significantly increased the invasion of cells (Figure 2A and D). Compared to the con group, HYWZF-treated groups exhibited reduced tube formation (Figure 2B and E). Flow cytometry was used to determine whether blocking apoptosis aids in the prevention of DR. As shown in Figure 2C and F, high dose of HYWZF serum reduced the apoptosis rate to 9.03% compared to that in the control group. Notably, HYWZF serum inhibited the invasion, tube formation, and apoptosis in HRCECs in a dose-dependent manner.

Figure 2.

Impact of heying wuzi formulation serum on the invasion, phenotype, and apoptosis of human retinal capillary endothelial cells. A: Transwell assay was used to detect cell invasion (scale bar: 100 μm); B: Tube formation assay detected the tube-forming ability (scale bar: 100 μm); C: Cell apoptosis was detected by flow cytometry; D: The number of invaded cells; E: The number of lumen formation of human retinal capillary endothelial cell (HRCEC); F: The apoptosis rate of HRCEC cells. Compared with the high glucose (hg) group, ^aP value < 0.05, ^bP value < 0.01; compared with the hg + negative serum group, ^cP value < 0.05, ^dP value < 0.01. HYWZF: Heying wuzi formulation; NEG: Negative serum; hg: High glucose; Con: Control.

HYWZF promotes mitophagy in HRCECs under high glucose conditions

Mitophagy protects B cells from diabetic damage[22]. Therefore, this study aimed to explore the role of mitophagy in DR. qPCR was performed to assess the expression levels of mitophagy-related biomarkers. Figure 3A shows that HYWZF serum increased the mRNA expression levels of BNIP3, FUNDC1, and NIX, and high doses of HYWZF serum exhibited the most potent effects. We also verified the effects of mitophagy in cells via Western blotting. Compared with the hg group, HYWZF increased the ratio of LC3-II/LC3-I and downregulated the VEGF protein levels (Figure 3B). Therefore, 10% HYWZF serum was used for subsequent experiments.

Figure 3.

Mitophagy of human retinal capillary endothelial cells analysis. A: Quantitative reverse transcription-polymerase chain reaction detection results of relative BNIP3, FUNDC1, NIX, PARKIN, PINK1, and HIF-1α mRNA expression levels; B: Western blotting analyzed the protein levels of light chain 3 (LC3)-I, LC3-II, and vascular endothelial cell growth factor. Compared with the high glucose (hg) group, ^aP value < 0.05, ^bP value < 0.01; compared with the hg + negative serum group, ^cP value < 0.05, ^dP value < 0.01. HYWZF: Heying wuzi formulation; NEG: Negative serum; hg: High glucose; VEGF: Vascular endothelial cell growth factor.

HYWZF improves the intracellular oxidative stress

To better understand mitochondrial autophagy and determine whether HIF-1α affects the morphology of HRCECs, inhibitors were used in experiments. In contrast to the hg group, 10% HYWZF serum (hg + ps)-treated group exhibited significantly decreased cell invasion (Figure 4A and D). As shown in Figure 4B and E, the tube-forming capacity was significantly decreased in HYWZF-treated groups compared to that in the hg group. Moreover, HYWZF reduced apoptosis compared to that observed in the hg group (Figure 4C and F). HYWZF increased the mitochondrial membrane potential (Figure 5A and C) and reduced the intracellular reactive oxygen species (ROS) content (Figure 5B and D). Additionally, HYWZF significantly enhanced the activities of SOD and GSH-PX but decreased that of MDA (Figure 5E-G).

Figure 4.

Heying wuzi formulation improved intracellular oxidative stress. A and D: A transwell was performed to detect the invasion ability of Human retinal capillary endothelial cell (HRCEC; scar bar: 100 μm); B and E: A tube formation assay was performed to detect the tube-forming ability of HRCEC cells (scar bar: 100 μm); C and F: Cell apoptosis was detected by flow cytometry. Compared with the high glucose (hg) group, ^aP value < 0.05, ^bP value < 0.01; compared with the hg + 10% HYWZF serum group, ^cP value < 0.05, ^dP value < 0.01. HYWZF: Heying wuzi formulation; NEG: Negative serum; hg: High glucose; ps: 10% HYWZF serum; Con: Control.

Figure 5.

Effects of heying wuzi formulation on mitochondria and oxidative stress. A and C: JC-1 detected mitochondrial membrane potential; B and D: reactive oxygen species was detected by flow cytometry; E-G: Enzymatic reaction detection of SOD, GSH-PX, and MDA levels. Compared with the high glucose (hg) group, ^aP value < 0.05, ^bP value < 0.01; compared with the hg + 10% heying wuzi formulation serum group, ^cP value < 0.05, ^dP value < 0.01. HYWZF: Heying wuzi formulation; mod: Diabetic model; NEG: Negative serum; hg: High glucose; ps: 10% HYWZF serum; Con: Control.

HYWZF reduces the mitochondrial damage under high glucose conditions

HYWZF rescued mitochondrial swelling and vacuolation (Figure 6A). Western blotting revealed that HYWZF increased the levels of the mitophagy proteins, BNIP3 and BNIP3L, indicating that HYWZF promoted mitophagy. HYWZF also upregulated the levels of claudin-5 and occludin, indicating that HYWZF affected the intercellular interactions (Figure 6B and C). Additionally, HYWZF upregulated the HIF-1α, Beclin1, BNIP3, BNIP3L, Bcl2, and Belin1 levels and LC3I/LC3II ratio and downregulated the caspase-3 and p62 levels in hg-induced cells. However, PX-478 and Mdivi-1 reversed these effects, suggesting that HYWZF targets the HIF-1α/BNIP3/NIX axis to alleviate hg-induced mitophagy in HRCECs. These results demonstrate the protective effects of HYWZF against DR.

Figure 6.

The role of heying wuzi formulation on mitochondrial morphology and function. A: Morphology of mitochondria examined by TEM; B and C: Western blotting analysis of protein level. Compared with the high glucose (hg) group, ^aP value < 0.05, ^bP value < 0.01; compared with the hg + 10% Heying wuzi formulation serum group, ^cP value < 0.05, ^dP value < 0.01. HYWZF: Heying wuzi formulation; NEG: Negative serum; hg: High glucose; ps: 10% HYWZF serum; Con: Control.

HYWZF improves the overall health of diabetic mice

To further investigate the effects of HYWZF, C57BL/6 mice were used as the experimental animal model. Mice with blood glucose levels above 16.7 mmol/L were classified as the diabetic group. After 12 wk of hyperglycemia induction, mice with fundus hemorrhage and exudation were classified as the DR group. Both low (12 g/kg/d)- and high (48 g/kg/d)- dose HYWZF treatment improved the overall state of DR mice compared to that of the model group.

HYWZF reduces the retinal tissues damage in diabetic mice

Body weight gradually increased after HYWZF treatment (Figure 7A), whereas that of the model group decreased. Blood glucose levels also decreased after HYWZF treatment (Figure 7B). Tar violet staining revealed that the numbers of ganglion cells were higher in the HYWZF-L and HYWZF-H groups than in the model group (Figure 7C). Retinal histopathological damage was ameliorated by HYWZF treatment (Figure 7D). Moreover, number of apoptotic cells in the model group was higher than that in the control group (Figure 7E). These data suggest that HYWZF alleviates the pathological damage in the retinal tissues of diabetic mice.

Figure 7.

Heying wuzi formulation reduced pathological damage to retinal tissues. A: The impact of heying wuzi formulation (HYWZF) on weight; B: The impact of HYWZF on blood glucose changes; C: The number of ganglion cells in retinal tissues by tar violet staining (scar bar: 50 μm); D: Hematoxylin and eosin staining was used to observe retinal tissue structure (scar bar: 50 μm); E: Periodic acid-shiff staining was used to detect the number of acellular capillaries in retinal tissues (scar bar: 50 μm). Compared with the con group, ^bP value < 0.01; compared with the diabetic model group, ^dP value < 0.01. HYWZF: Heying wuzi formulation; mod: Diabetic model; Con: Control.

HYWZF mediates mitophagy via the HIF-1Α/BNIP3/NIX axis in diabetic mice

Immunofluorescence analysis revealed increased colocalization of Tom20 with LAMP-2 and LC3B after HYWZF treatment, indicating that HYWZF induced mitochondrial autophagy (Figure 8). Expression levels of VEGF were decreased, whereas those of ZO-1 were increased in the tissues after HYWZF treatment (Figure 9A). Western blotting revealed that the expression levels of tight junction protein (claudin-5), HIF-1α, Beclin1, BNIP3, and BNIP3L were significantly higher in the HYWZF-treated groups than in the model group. However, mmp9 and p62 levels were significantly downregulated by HYWZF (Figure 9B-D). Additionally, the activities of ATP, SOD, and GSH-PX were significantly higher and those of EB and MDA were lower in the retinal samples of the HYWZF-treated groups than in those of the model group (Figure 9E). These results suggest that HYWZF mediates mitophagy via the HIF-1α/BNIP3/NIX axis to reduce oxidative stress, thereby improving the pathological damage in diabetic mice.

Figure 8.

Heying wuzi formulation increased mitophagy. A: Co-localization results of Tom20 and LAMP 2; B: Co-localization results of Tom20 and light chain 3B. Compared with the con group, ^bP value < 0.01; compared with the mod group, ^dP value < 0.01. HYWZF: Heying wuzi formulation; mod: Diabetic model; Con: Control.

Figure 9.

Effects of heying wuzi formulation on C57BL/6 mice. A: Immunohistochemical was performed to quantify the protein expression of vascular endothelial cell growth factor and ZO-1; B-D: Western blotting analysis of protein levels of light chain 3B, BNIP3, HIF-1α, mmp9, and p62, etc. in retinal tissues; E: Enzymatic reaction detection of SOD, GSH-PX, ATP, EB, and MDA levels in the retina. Compared with the control group, ^aP value < 0.05, ^bP value < 0.01; compared with the diabetic model group, ^cP value < 0.05, ^dP value < 0.01. HYWZF: Heying wuzi formulation; VEGF: Vascular endothelial cell growth factor.

DISCUSSION

DR is the most prominent manifestation of diabetic microangiopathy and a serious complication of diabetes[23]. Retinal endothelial cell dysfunction is the main pathological process responsible for DR[24]. Hyperglycemia promotes abnormal cell division and proliferation by affecting the expression levels of cyclins and tumor-related genes, thereby promoting the pathogenesis of DR[25]. Identifying effective methods to prevent and treat abnormal cell division and proliferation is of major clinical importance. In this study, HYWZF alleviated hyperglycemia in diabetic mice and ameliorated the pathological manifestations of DR, including basement membrane thickening, extracellular matrix expansion, and increased vascular permeability[26]. HYWZF decreased MDA content, increased SOD and GSH-PX activities, and inhibited the apoptosis of HRCECs and retinal tissue. Therefore, we hypothesized that the protective effects of HYWZF are associated with the inhibition of oxidative stress and apoptosis; however, the underlying mechanism warrant further investigations.

In diabetes, hyperglycemia causes oxidative damage by stimulating ROS production[27]. The ROS produced during hyperglycemia can directly affect the expression and distribution of tight junction proteins[28]. ZO-1 is a cytoplasmic attachment protein that can connect the transmembrane proteins claudin-1 and claudin-5 to the cytoskeleton and also participates in the process of polymerization to form tight junctions[29,30]. One study has reported reduced ZO-1 expression in diabetic nephropathy[31]. This result found that HYWZF treatment increased the expression levels of ZO-1, occludin, and claudin-5 proteins, indicating that HYWZF affected tissue integrity and barrier function. HE staining revealed that the retinal tissues in the model group were significantly swollen and infiltrated with inflammatory cells, indicating the presence of a large number of free radicals appeared[32]. Flow cytometry analysis further proved that there were a large number of ROS in the model group. SOD, a biological enzyme found in cells, neutralizes superoxide anion free radicals produced during metabolic processes and protects organisms. The level of MDA in the retina reflects the level of tissue cell oxidative damage[33], while SOD activity reflects the ability of the cell to resist oxidation and repair. They remain in a constant state of balance under physiological conditions. An increase in MDA levels or a decrease in SOD levels indicates significant oxidative damage to retinal tissue cells[34]. Ahmed et al[35] found that Solidago virgaurea increased the level of SOD and downregulated MDA in type 1 diabetes. In this study, an increase in SOD and GSH-PX was found after drug treatment, as well as a low MDA level, indicating that HYWZF could enhance the ability of cells to scavenge oxygen free radicals and reduce the damage caused by peroxidation in tissue cells.

A previous study suggested that mitophagy plays a crucial role in eliminating defective or dysfunctional mitochondria, which are important for the preservation of mitochondrial homeostasis[36-38]. Mitochondria contain less cytochrome c and more pro-apoptotic protein, Bcl-2-associated X (Bax); they tend to swell, break, and have lower membrane potential[39,40]. Bax modulates the mitochondrial membrane potential to increase the release of cytochrome C[41]. Dysfunctional mitochondria are also associated with the death of various retinal cells[42]. Consistent with these findings, the present study showed that mitochondria were swollen and mitochondrial damage occurred in HRCEC in DR. Data also showed that high glucose enhanced ROS production and oxidative stress, whereas HYWZF improved ROS production and oxidative stress by increasing mitochondrial autophagy. LC3 and Beclin-1 are important and reliable markers of autophagy[43]. Our data revealed that the protein levels of Beclin-1, LC3, BNIP3, and BNIP3L (NIX) were upregulated in the retinas of the diabetic mice. After HYWZF treatment, compared to the diabetic group, the level of autophagy was further improved, indicating that HYWZF promoted autophagy in the retina of diabetic mice, accelerated the removal of denatured and damaged proteins, and protected the retinal tissue of mice with diabetes. Furthermore, our study demonstrated that HIF-1α/BNIP3-mediated mitophagy protects against DR by reducing apoptosis.

HIF-1α is an important transcription factor affecting mitophagy, and its expression and activity are closely regulated by the cellular oxygen concentration[44]. It is also involved in various physiological processes, such as angiogenesis, cartilage development, neuroembryogenesis, and cancer development[45]. BNIP3 and NIX are the downstream target genes of HIF-1α that are involved in the regulation of autophagosome-lysosome fusion and act as important mitophagy receptors and adaptors. BNIP3 binds to LC3 to promote mitophagy[46]. The chemical structure of HIF-1α is extremely unstable. In the normoxic environment, hypoxia-inducible factor inhibitor 1 prevents the binding of HIF-1α with transcriptional cofactor p300/CBP and inhibits its transcriptional activity[47]. As the oxygen concentration decreases, the activity of FIH-1 also decreases, leading to the stable expression of HIF-1α[48]. In this study, HIF-1α levels increased due to retinal tissue hypoxia, leading to mitophagy. BNIP3 and NIX levels significantly increased after HYWZF treatment. Therefore, we hypothesized that HIF-1α alleviates hg-induced HRCEC apoptosis via mitophagy by enhancing the expression of BNIP3. Although the protective effects of HIF-1α against diabetes have been demonstrated, those of HYWZF against DR via HIF-1α remain unclear. To investigate the protective effects of HIF-1α, we used PX-478 and Mdivi-1 to regulate HIF-1α expression in HRCECs. Our results suggest that increased HIF-1α expression improves the survival of HRCECs.

CONCLUSION

This study demonstrated that HYWZF increases the HIF-1α levels; however, the mechanism underlying HIF-1α regulation remains unclear. HIF-1α stability is regulated by various post-translational modifications, including hydroxylation, ubiquitination, SUMOylation, acetylation, methylation, and phosphorylation[49]. The mechanisms by which HYWZF increases autophagy and regulates the stable expression of HIF-1α under hyperglycemic conditions warrant further investigation. Overall, this study revealed that HYWZF protected against DR by mediating mitophagy via the HIF-1α/BNIP3/NIX pathway, suggesting its potential as a therapeutic agent for DR treatment.

Data sharing statement

Technical appendix, statistical code, and dataset available from the corresponding author at zhangyinj@126.com.