Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Jul 9.
Published in final edited form as: Immunity. 2024 May 23;57(7):1514–1532.e15. doi: 10.1016/j.immuni.2024.04.025

A RIPK1-specific PROTAC degrader achieves potent anti-tumor activity by enhancing immunogenic cell death

Jonathan Mannion 1,11, Valentina Gifford 1,11, Benjamin Bellenie 2,11, Winnie Fernando 1,11, Laura Ramos Garcia 1, Rebecca Wilson 1, Sidonie Wicky John 1, Savita Udainiya 1, Emmanuel C Patin 3, Crescens Tiu 1, Angel Smith 1, Maria Goicoechea 1, Andrew Craxton 4, Nathalia Moraes de Vasconcelos 1, Naomi Guppy 1, Kwai-Ming J Cheung 2, Nicholas J Cundy 2, Olivier Pierrat 2, Alfie Brennan 2, Theodoros I Roumeliotis 5, Graeme Benstead-Hume 5, John Alexander 1, Gareth Muirhead 1, Scott Layzell 6, Wenxin Lyu 7, Victoria Roulstone 3, Mark Allen 8, Holly Baldock 8, Arnaud Legrand 1, Florian Gabel 2, Natalia Serrano-Aparicio 2, Chris Starling 1, Hongyan Guo 9, Jason Upton 10, Mads Gyrd-Hansen 7, Marion MacFarlane 4, Benedict Seddon 6, Florence Raynaud 2, Ioannis Roxanis 1, Kevin Harrington 3, Syed Haider 1, Jyoti S Choudhary 5, Swen Hoelder 2, Tencho Tenev 1,*, Pascal Meier 1,12,*
PMCID: PMC11236506  NIHMSID: NIHMS1997081  PMID: 38788712

Abstract

Receptor-interacting serine/threonine-protein kinase 1 (RIPK1) functions as critical stress sentinel that coordinates cell survival, inflammation and immunogenic cell death (ICD). While the catalytic function of RIPK1 is required to trigger cell death, its non-catalytic scaffold function mediates strong pro-survival signaling. Accordingly, cancer cells can hijack RIPK1 to block necroptosis and evade immune detection. We generated a small molecule proteolysis-targeting chimera (PROTAC) that selectively degraded human and murine RIPK1. PROTAC-mediated depletion of RIPK1 deregulated TNFR1- and TLR3/4-signaling hubs, accentuating the output of NF-κB, MAPK and IFN signaling. Additionally, RIPK1 degradation simultaneously promoted RIPK3 activation and necroptosis induction. We further demonstrated that RIPK1 degradation enhanced the immunostimulatory effects of radio- and immunotherapy by sensitizing cancer cells to treatment-induced TNF and interferons. This promoted ICD, anti-tumor immunity and durable treatment responses. Consequently, targeting RIPK1 by PROTACs emerges as a promising approach to overcome radio- or immunotherapy resistance and enhance anti-cancer therapies.

Keywords: RIPK1, cell death, necroptosis, inflammation

eTOC blurb

Tumour cells frequently hijack RIPK1’s scaffolding function to resist cell death and avoid immune detection. Mannion et al. describe the development of a RIPK1-selective PROTAC degrader that boosts the immunostimulatory and anti-tumour activity of radiotherapy (RT) and immune checkpoint blockade (ICB), heating up tumours and driving long-lasting anti-tumour immunity.

Graphical Abstract

graphic file with name nihms-1997081-f0001.jpg

INTRODUCTION

Cell death and inflammation are closely linked arms of the innate immune response to combat infection and drive anti-tumor responses. While the ability to sense danger is integral for any organism to maintain tissue function1, uncontrolled or excessive inflammatory responses can damage tissue and contribute to the pathogenesis of chronic inflammatory diseases, including psoriasis, neurodegenerative diseases, inflammatory bowel disease and asthma2. Further, tumor cells frequently evade immune detection and elimination by suppressing innate immune responses3. Cell death surpasses merely being an endpoint; it facilitates the exchange of information between the dying cell and the surrounding tissue micro-environment. Importantly, alerting and recruiting immune cells to sites of disturbance. Receptor-interacting serine/threonine-protein kinase 1 (RIPK1) is a critical stress sentinel that can positively and negatively regulate cell death, innate immunity, and inflammation4,5. Located downstream of many cytokine receptors and pattern recognition receptors (PRRs), RIPK1 plays a crucial role in determining the outcome between pro-survival NF-κB signaling and cell death69. While the catalytic function of RIPK1 is required to trigger cell death, its non-catalytic scaffolding function is essential to regulate pro-inflammatory and pro-survival signaling1016. Accordingly, controlled activation of RIPK1 contributes to tissue repair and immune surveillance. However, over-exuberant activation of RIPK1 can lead to many immune and autoinflammatory diseases1722. Thus, RIPK1 deregulation and subsequent aberrant cell death is a common feature in chronic inflammatory disease9,23,24. As such, RIPK1 has emerged as a promising therapeutic target24.

While chronic RIPK1 activation is associated with inflammatory disease9,23,24, data demonstrate that cancer cells often hijack RIPK1, promoting cell survival, insensitivity to TNF and resistance to immunotherapy25. This is because RIPK1’s scaffolding function drives NF-κB signaling and NF-κB-dependent induction of pro-survival genes26,27. Further, chronic RIPK1-mediated NF-κB signaling can fuel an immunosuppressive chemokine program, resulting in fewer infiltrating NK and CD8+ T cells, reducing local TNF super family ligands and profound immune checkpoint blockade (ICB) resistance25,28,29.,28,29. Additionally, RIPK1’s scaffold function can sub-lethally activate caspase-8, which in turn cleaves and inactivates RIPK3, CYLD and RIPK1 itself, effectively blocking necroptosis3033. Since RIPK1 suppresses necroptosis signaling downstream of TLR3/4 and ZBP110,11,1316,24,31,3444, targeting RIPK1 has the potential to overcome apoptosis-resistance and trigger more immunogenic forms of cell death8,45,46. At present, most anti-cancer drugs kill cancer cells via apoptosis, which is generally immunologically silent. Necroptosis is a caspase-independent, lytic form of cell death that initiates strong immune responses2,47. It is thought that this immunogenicity originates from the ability of death receptors or PRRs to activate NF-κB and/or interferon signaling while the cell is dying by necroptosis4550. Both interferon signaling and NF-κB activation drive the production of inducible DAMPs (iDAMPs) that, together with constitutive DAMPs, potently alert the immune system of danger51, ensuring that antigen-presenting dendritic cells simultaneously take up dead cells to sample cancer epitopes and become activated, to promote CD8+ T-cell cross-priming6. Therefore, developing therapies that drive necroptosis may benefit from both killing tumor cells directly and (re)activating the immune system of a patient against their cancer46.

Although RIPK1 has emerged as a therapeutic target, its disease-associated activity cannot easily be neutralized by kinase inhibitors alone25. Therefore, alternative strategies, such as the use of PROTAC (proteolysis-targeting chimera) degraders, that can specifically target RIPK1’s scaffolding function, may more effectively treat RIPK1-driven disease. To improve RIPK1 targeting, we generated a series of bifunctional PROTAC molecules. We found that these pharmacological compounds degraded RIPK1 at nanomolar concentrations in human and mouse. Acutely depleting RIPK1 primed TNFR1- and TLR3/4 pathways to over-activate NF-κB, MAPK, and IFN signaling. Simultaneously, RIPK1 degradation deregulated RIPK3 activation and necroptosis, in a cell and tissue-type dependent manner. We demonstrated that RIPK1-PROTAC degraders synergized with immunostimulatory therapies, such as radiotherapy (RT) and ICB. Mechanistically, RIPK1 depletion sensitized cancer cells to RT-induced TNF and interferons. This promoted immunogenic cell death (ICD) and drove long-lasting anti-tumor immunity. Moreover, acutely depleting RIPK1 in the skin protected animals from RIPK1-driven cell death and skin inflammation. Consequently, targeting RIPK1 by PROTACs is a promising approach to alleviate RIPK1-driven pathologies.

RESULTS

RIPK1 PROTACs achieve selective and potent degradation of RIPK1

RIPK1 regulates cell death and immunity through both its catalytic and non-catalytic scaffolding functions. Therefore, its disease-associated activity cannot easily be neutralized by kinase inhibitors alone25. Moreover, while RIPK1 kinase inhibitors are highly effective in mice1016, the selective RIPK1 kinase inhibitors PK6852 and GSK’96353 only partially suppressed RIPK1-induced cell death in human cells as they ineffectively blocked RIPK1-induced apoptosis (Suppl. Fig. S1A,B), yet efficiently blocked necroptosis (Suppl. Fig. S1C). To improve RIPK1 targeting, we generated a series of heterobifunctional PROTAC molecules54 composed of a RIPK1-binding warhead, a linker and a ligand for the von Hippel-Lindau (VHL) E3 ligase (Fig. 1A and Suppl. Fig. S1D). We used PK68 as a RIPK1-binding entity52, which was fused to a VHL ligand55 via linkers of various lengths. RIPK1-PROTAC treatment showed a dose dependent decrease in RIPK1 levels in a panel of human and murine cell lines and primary cells (Fig. 1BE and Suppl. Fig. S1EJ). R1-ICR-5 was the most efficient RIPK1 degrader, depleting RIPK1 at nanomolar concentrations in human and murine cells. RIPK1 degradation by R1-ICR-5 was VHL-mediated as R1-ICR-5S, which has inverted stereochemistry at the proline 4-position that precludes VHL binding56, failed to deplete RIPK1 in a similar manner (Fig. 1F). Moreover, PK68 treatment did not affect RIPK1 protein levels (Suppl. Fig. S1E,F). Together, these data indicate that R1-ICR-5 triggers VHL-mediated degradation of RIPK1.

Figure 1. Development of selective RIPK1-PROTAC degraders.

Figure 1.

(A) Schematic representation of RIPK1-PROTACs.

(B) HT1080RIPK1-HiBiT cells were treated with the indicated PROTACs for 24 h. HiBiT measurements are shown. RLU, relative light unit.

(C) Western blot analysis evaluating RIPK1 degradation. Cells were incubated with the indicated concentrations of R1-ICR-5 for 6 h.

(D) Micro-confocal images of the indicated endogenous proteins in cells treated with the indicated PROTACs for 20 h. Scale bars: 100 μm (HT1080/HT29) and 50 μm (EMT6/L929).

(E) Quantification of relative endogenous RIPK1 levels from (D).

(F) Western blot analyzis of cells treated with the indicated agents for 6 h.

(G) Western blot analyzis of primary BMDMs treated as indicated. Where indicated, cells were pre-treated with VH298 (1 μM) or bortezomib (100 nM) for 1 h before R1-ICR-5 exposure. RIPK1 degradation was quantified by densitometry (right panel).

(H) Volcano plot depicting whole proteome of BMDMs treated with R1-ICR-5 (1 μM, 5 h) vs non-treated controls. Log2 fold change and −log10 adjusted P values (Benjamin-Hochberg procedure) are shown along the x- and y-axis, respectively.

(I) Washout experiment. Mlkl−/− BMDMs were treated with DMSO or R1-ICR-5 (1 μM) for 24 h before washout. Mlkl−/− cells were used to avoid loss of cellular material. Samples were harvested at the indicated time points, and analyzed by western blot (left panel) and quantified by densitometry (right panel). Data shown are technical replicates and are representative of 3 independent biological repeats. Data show ± SD and are representative of ≥2 independent biological repeats. Statistical analysis (E,I) was calculated by two-way ANOVA with Sidak’s multiple comparison test and (G) one-way ANOVA with Bonferroni’s multiple comparison test.

At effective RIPK1-PROTAC concentrations, we noticed no apparent changes in protein levels of related kinases, such as RIPK2, RIPK3, BRAF and TrkA, a potential ‘off-target’ binder of PK68 (Fig. 1G and Suppl. Fig. S2AE)52. Co-treatment with PK68 effectively outcompeted RIPK1 PROTACs, preventing RIPK1 degradation (Suppl. Fig. S2F,G). R1-ICR-5 degraded RIPK1 as early as 2 hrs after treatment and was nearly complete at 6 hrs (Fig. 1G). Whole proteome analysis demonstrated that only RIPK1 was significantly degraded by the RIPK1-PROTACs in BMDMs and U937s (Fig. 1H, Suppl. Fig. S2H). Treatment with a VHL or proteasome inhibitor confirmed the requirement for VHL-binding and proteasomal proteolysis for degradation (Fig. 1G, Suppl. Fig. S2AG). Washout experiments indicated that RIPK1 has a low re-synthesis rate, taking more than 72 hrs to reach pre-treatment levels (Fig. 1I and Suppl. Fig. S2I). Although R1-ICR-5’s lipophilicity is currently unfavorable for systemic treatments in animals, local administration of R1-ICR-5 effectively depleted RIPK1 in vivo (Suppl. Fig. S2J).

RIPK1 degraders deregulate innate immune signaling

Next, we evaluated whether acutely depleting RIPK1 compromised TNF or TLR3 signaling57,58. Unexpectedly, R1-ICR-5 treatment deregulated the transcriptional response of TNF-treated primary BMDMs and triple negative breast cancer (TNBC) EO771 cells, enhancing TNF-induced cytokine expression (Fig. 2AC and Suppl. Fig. S3AC). Most notable among the TNF-stimulated genes were Tnf, Il6 and A20 (Tnfaip3). While acute loss of RIPK1 accentuated TNF-induced NF-κB signaling, we noticed that depleting RIPK1 in resting BMDMs induced the transcription of Tnf, A20 and Sod2 (Fig. 2C and Suppl. Fig. S3C). R1-ICR-5-mediated TNF production depended on MK2-mediated TNF biosynthesis59 and subsequent autocrine TNF-mediated signaling (Fig. 2D). Consistent with deregulation of TNF signaling, we noticed enhanced recruitment of TRADD to TNFR1 when RIPK1 was depleted (Fig. 2D and Suppl. Fig. S3D), likely due to the competitive dynamics for TNFR1 binding between TRADD and RIPK160. Enhanced TRADD recruitment was accompanied with accentuated ubiquitylation of TRADD, TRAF2, cIAP1 and HOIP (Fig. 2E). Since ubiquitylation of complex-I components mediates NF-κB activation, it is likely that enhanced ubiquitylation of complex-I results in deregulated TNF signaling in BMDMs, L929, EO771 and human LIM1215 and HT29 cells (Fig. 2F and Suppl. Fig. S3B,C,EG).

Figure 2. Acute degradation of RIPK1 deregulates TNFR1 and TLR3 signaling.

Figure 2.

(A) Schematic representation depicting RIPK1’s regulation of TNFR1 and TLR3/4-induced signaling and cell death.

(B) Relative mRNA expression of NF-κB target genes, in BMDMs pre-treated with DMSO or R1-ICR-5 for 4 h, followed by indicated TNF treatment.

(C) Relative Tnf mRNA expression in BMDMs treated for 4 h with the indicated conditions. MK2i refers to an MK2 inhibitor.

(D) Western blot analysis of TNFR1 signaling complex-I. Cells were treated with DMSO or R1-ICR-5 (overnight).

(E) L929 cells were treated as in (D) before anti-GST-TUBE pulldown to isolate the ubiquitylated proteome. *Indicates non-specific signal.

(F) Western blot analysis of BMDMs pre-treated with DMSO or R1-ICR-5 for 4 h, followed by TNF exposure for the indicated time points.

(G) Relative mRNA expression of NF-κB or IFN target genes. BMDMs were pre-treated with DMSO or R1-ICR-5 for 4 h, followed by stimulation with Poly(I:C).

Data show mean ± SD and are representative of (C,E) two, (B,G) three, (F) four or (D) five independent biological repeats. P values were calculated using (B) two-way ANOVA (Sidak’s multiple comparison test) or (C,G) one-way ANOVA (Bonferroni’s multiple comparison test).

RIPK1-PROTAC treatment also deregulated TLR3 signaling, enhancing the induction of Il-6, Tnf, Ccl2, Cxcl9, Cxcl10 and Ifnβ in BMDMs and EO771 (Fig. 2G and Suppl. Fig. S3H,I). Likewise, acutely removing RIPK1 genetically, using BMDMsLysM-Cre;Ripk1fl/fl cells, also accentuated innate immune signaling (NF-κB and interferon) in response to TLR3 stimulation (Suppl. Fig. S3J). Moreover, R1-ICR-5 treatment did not accentuate innate immune signaling in EO771 Ripk1-KO cells (Suppl. Table. S1 and S2). These data suggest that R1-ICR-5’s impact on signalling is on-target, and that RIPK1 is required for fine-tuned activation of TNFR1 and TLR3 signaling, preventing hyper-activation of these pathways.

RIPK1 PROTACs facilitate TNFR1- and TLR3/4-mediated activation of RIPK3

Acutely depleting RIPK1 also sensitized cells to cell death, accompanied by enhanced phosphorylation and activation of RIPK3 and MLKL (Fig. 3AC). Likewise, acutely depleting RIPK1 also enhanced TLR3- and TLR4-induced necroptosis that was mediated by TRIF (also known as Ticam1), independent of TNFR1 and ZBP1 (Fig. 3D,E and Suppl. Fig. S3K,L). TLR3/4-mediated necroptosis partly required IFNAR1, as Ifnar1-KO suppressed this death (Suppl. Fig. S3K,L). Therefore, acutely degrading RIPK1 not only causes hyper-activation of innate immune signaling pathways (e.g. TNFR1 and TLR3), but also triggers unhindered activation of cell death.

Figure 3. RIPK1 degraders drive TNFR1-driven necroptosis, independent of TRIF and ZBP1.

Figure 3.

(A, B) Quantification of propidium iodide positive (PI+) cells, treated with the indicated conditions. Cells were pre-treated with DMSO, R1-ICR-5 or RIPK2 degrader (A,18 h; B,5 h), before stimulation with the indicated conditions (A,5 h; B,7 h).

(C) Western blot analysis monitoring RIPK3 and MLKL activation. Cells were pre-treated for 18 h, before exposure to TE for the indicated time points. *Indicates non-specific signal.

(D, E) Quantification of PI+ cells. Cells were pre-treated with DMSO, R1-ICR-3 or R1-ICR-5 for 4 h, followed by the indicated treatments (3 h).

(F) Quantification of PI+ BMDMs. Cells were pre-treated with DMSO or R1-ICR-5 for 4 h, followed by the indicated treatment.

(G) Quantification of PI+ L929 cells. Cells were untreated or pre-treated with R1-ICR-5 for 12 h, followed by treatment with the indicated agents. RIPK1 kinase inhibitors were added 30 min prior to TE (6.5 h).

(H-K) Quantification of PI+ cells. The indicated cells were treated with R1-ICR-5, R1-ICR-5S, or MK2 inhibitor for 24 h.

(L) Quantification of PI+ cells. Ripk3−/− cells were reconstituted with Dox-inducible WT or RHIM-mutant RIPK3 (RHIMm). Cells were induced with Dox and incubated with R1-ICR-5 for 12 h, before treatment with TE for 2.5 h.

(M) Quantification of PI+ cells. Cells were pre-treated with DMSO or R1-ICR-5 for 18 h, following treatment with TE (5 h). Trif and Zbp1 deficiency was confirmed by western blot analysis.

(N) Quantification of PI+ BMDMs. Cells were treated with the indicated agents for 24 h (left panel). Right panel: western blot analysis of BMDMs following treatment with DMSO or R1-ICR-5 for 6 h.

(O) Quantification of PI+ BMDMs. The indicated cells were treated with R1-ICR-5 for 24 h.

Data show ± SD and are representative of three (A,D-O), four (B) or two (C) independent biological repeats. P values were calculated using (F,H,K,O) one-way ANOVA (Bonferroni multiple comparison test) or (A,B,D,E,G,I,J,L-N) two-way ANOVA (Sidak’s multiple comparison test).

TNFR1 but not TNFR2 was required for TNF-induced cell death following depletion of RIPK1, because treatment with human TNF, which only binds to murine TNFR1, was fully capable of inducing necroptosis in RIPK1-depleted BMDMs (Fig. 3F). TNF/R1-ICR-5-induced cell death was entirely RIPK1-independent because co-treatment with numerous RIPK1 kinase inhibitors did not block this death (Fig. 3G). However, when RIPK1 was present, these RIPK1 kinase inhibitors potently blocked TNF-induced cell death, suggesting that the scaffold function of RIPK1 blocks the ability of TNFR1 to trigger cell death.

Depleting RIPK1 also sensitized cells to autocrine-produced TNF. Accordingly, primary BMDMs were sensitive to RIPK1-PROTAC treatment alone, and this effect was prevented by genetic deletion of Tnfr1 or co-treatment with Enbrel, a TNF-neutralizing biologic (Fig. 3H,I and Suppl. Fig. S3M). Inhibition of MK2- mediated TNF biosynthesis59 also suppressed R1-ICR-5 killing in primary BMDMs. The inactive control compound R1-ICR-5S, or engagement of VHL using a RIPK2-targeting PROTAC, had no effect on cell viability (Fig. 3B,I,J), indicating that the cytotoxic effect of R1-ICR-5 was specific to RIPK1 depletion and relied on engagement of the TNFR1 pathway.

The cytotoxicity of the PROTACs correlated with their ability to degrade RIPK1, with R1-ICR-5 being the most potent (Suppl. Fig. S1G and S3N). R1-ICR-5 not only killed primary BMDMs, but also mouse dermal fibroblasts and peritoneal macrophages (Suppl. Fig. S3O,P), expanding this observation to other cell types. PROTAC treatment alone predominantly caused necroptosis in sensitive cells (Fig. 3J,K and Suppl. Fig. S3P), indicating that TNFR1 signaling can trigger RIPK3 activation when RIPK1 is acutely depleted (Suppl. Fig. S3Q), via an unknown mechanism, an observation that was noted previously6164. Although RIPK1-PROTAC-induced activation of RIPK3 occurred in a range of cell types, the response to acute depletion of RIPK1 was cell and tissue type dependent, as some were unable to drive autocrine TNF-mediated RIPK3 activation, in RIPK1’s absence. For example, naïve CD4+ and CD8+ T cells and keratinocytes10,15 resisted cell death triggered by acute depletion of RIPK1 (Suppl. Fig. S3R).

To corroborate the effects of R1-ICR-5, we genetically and conditionally deleted RIPK1, using Doxycycline (Dox)-Cre;Ripk1fl/fl MDFs and LysM-Cre;Ripk1fl/fl BMDMs. Akin to R1-ICR-5, Dox-induced deletion of Ripk1 in MDFsDox-Cre;Ripk1fl/fl triggered RIPK3-dependent cell death (Suppl. Fig. S3S). RNAi-mediated depletion of Ripk1 did not potentiate this death. Yet, in RIPK1-proficient, non-Dox treated MDFs, RNAi-mediated depletion of RIPK1 did indeed cause cell death, indicating that RIPK1 acts as pro-survival factor in these cells. Likewise, BMDMsLysM-Cre;Ripk1fl/fl were more sensitive to TNFR1- and TLR3/4-induced necroptosis than their control counterparts (Suppl. Fig. S3T). Additionally, EO771Dox-Ripk1shRNAi cells, harboring a Dox-inducible Ripk1-targeted shRNA, also became acutely sensitive to TNF-induced necroptosis upon shRNA-mediated depletion of RIPK1 (Suppl. Fig. S3U). Together, these data demonstrate that genetic, acute deletion of RIPK1 fully recapitulates the phenotypes triggered by R1-ICR-5.

TNF/RIPK1-PROTAC-induced RIPK3 activation occurs independent of TRIF and ZBP1

Next, we evaluated how TNF drives RIPK3 activation. The recruitment of RIPK3 to the RIP Homotypic Interaction Motif (RHIM) of either RIPK1, TRIF, or ZBP1 can initiate RIPK3 activation and necroptosis65,66. To evaluate the significance of RIPK3’s RHIM, we reconstituted RIPK3-deficient cells with wild-type RIPK3 or a RHIM-mutant form of RIPK367. While RIPK3WT readily reconstituted TNF-induced necroptosis in RIPK1’s absence, the RIPK3RHIMm did not (Fig. 3L), demonstrating the indispensable role of RIPK3’s RHIM, in its activation.

As TRIF and ZBP1 are the only other RHIM-containing proteins, we investigated whether TRIF and/or ZBP1 mediated TNFR1-induced RIPK3 activation upon RIPK1 depletion. Double deficiency of Trif and Zbp1 in primary lung fibroblast (LF) did not impact TNF-induced cell death upon R1-ICR-5 treatment (Fig. 3M,N), ruling out any involvement of these RHIM-containing proteins. While Trif−/− partially reduced R1-ICR-5-induced cell death in primary BMDMs, it did not prevent it entirely (Fig. 3N). ZBP1 deficiency did not affect R1-ICR-5-induced cell death. Under more potent cell death conditions, such as in the presence of the pan-caspase inhibitor Emricasan (E) or upon treatment with TNF/Smac mimetic (SM)/E or TNF/cycloheximide (CHX), Trif and Zbp1 deficiency had negligible impact on TNF-induced necroptosis in RIPK1-depleted BMDMs (Fig. 3N and Suppl. Fig. S3V,W). Our findings are unexpected because whole body or skin-specific deletion or RHIM mutation of RIPK1 in mice, leads to necroptosis in the skin and lethality mediated by ZBP1 and, to a lesser extent, TRIF10,11,15,68. However, we did not observe changes in ZBP1 levels upon acute removal of RIPK1 in primary LFs and BMDMs (Fig. 3M,N), which contrasts with in vivo models where ZBP1 expression is prominently induced at the age of P2815. This suggests that the ZBP1-dependent in vivo phenotype of Ripk1E-KO and Ripk1mRHIM/E-KO mice might be an indirect, tissue-integrated response to long-term inactivation of RIPK1 function, rather than a direct cell-intrinsic response to RIPK1 loss. We noticed that Trif−/− BMDMs had lower basal protein expression of interferon-responsive gene products, ISG15, MLKL, and ZBP1 (Fig. 3N), suggesting that loss of Trif might reduce the sensitivity to TNF indirectly, perhaps by reducing MLKL and TNF69. Consistently, Ifnar1−/− reduced autocrine-TNF and TLR3/4-induced cell death in RIPK1-depleted BMDMs (Fig. 3O and Suppl. Fig. S3K,L). Taken together, while we find that the RIPK3’s RHIM domain is required for TNF- and TLR3/4-induced necroptosis following R1-ICR-5 treatment, the RHIM-containing proteins TRIF and ZBP1 are dispensable.

The death domain of RIPK1 limits TRADD fibrillation

Next, we tested the involvement of complex-I components in RIPK3 activation. Depletion of TRADD fully protected cells from TNF-induced necroptosis upon PROTAC or genetic depletion of RIPK1 (Fig. 4A). While genetic deletion and RNAi-mediated depletion of Spata2 and Cyld partially protected cells under these conditions, depletion or pharmacological inhibition of no other signaling component downstream of TNFR1 suppressed TNFR1-mediated RIPK3 activation (Fig. 4B,C and Suppl. Fig. S4A,B). This indicates that TRADD plays a critical role in driving R1-ICR-5-mediated activation of RIPK3.

Figure 4. RIPK1 degradation facilitates TRADD fibrillation and TRADD-RIPK3 interaction.

Figure 4.

(A, B) Quantification of PI+ L929s. Cells were treated with the indicated RNAis for 48 h, followed by treatment with control or R1-ICR-5 for 24 h. Subsequently, cells were treated with TE for 2 h.

(C) Quantification of PI+ BMDMs. Cells were pre-treated with DMSO or R1-ICR-5 for 4 h, followed by treatment with TZ or TE. Data represent 2 biological replicates and are representative of three independent experiments.

(D) TNFR1 complex-II analysis using L929Dox-Flag-TRADD cells pre-treated with DMSO or R1-ICR-5 overnight. FLAG-TRADD was induced for 1 h (Dox), followed by treatment with TE (1 h). Lysates were subjected to anti-FLAG IP before western blot and densitometry analyzes.

(E) Western blot analysis of L929Dox-Flag-TRADD cells pre-treated with DMSO or R1-ICR-5 for 18 h, followed by 1 h induction of FLAG-TRADD (Dox). Subsequently, cells were treated with TE for the indicated time points. *Indicates non-specific signal.

(F) Quantification of PI+ L929Dox-Flag-TRADD cells. Cells were pre-treated with DMSO or R1-ICR-5 for 18 h, followed by 1 h induction of TRADD (Dox). Subsequently, cells were treated with TE (2 h).

(G) Confocal microscopy images of TRADD fibrils using L929Dox-Flag-TRADD. Cells were treated with DMSO or R1-ICR-5 overnight, followed by 1 h Dox-induction of FLAG-TRADD (in the presence of E). Subsequently, cells were treated with TNF for 10 minutes. i) and ii) are magnifications of the indicated areas. Scale bars: 50 μm and magnification 10 μm. Quantification of the number of TRADD aggregates per cell (~70 cells/condition) (right panel).

(H) Analysis of the ubiquitylated proteome. cells were pre-treated with DMSO or R1-ICR-5 overnight, followed by treatment with TE for the indicated time points. Cells were subjected to TUBE pull-down. Samples were split and boiled with or without β-mercaptoethanol (reducing or non-reducing). *Indicates non-specific signal.

(I) Predicted AlphaFold structure of mTRADD (AF-Q3U0V2-F1, left panel)90. C198 has a confidence of 45–58 %, whereas all other cysteines have a >85 % confidence. Right panel, schematic representations of mTradd constructs used to reconstitute L929 Tradd−/− cells in (J,K). DD, Death Domain.

(J,K) Quantification of PI+ cells, reconstituted with the indicated Dox-inducible Tradd transgenes. Cells were treated with DMSO or R1-ICR-5 overnight, prior to treatment with Dox/E for 2 h. Subsequently, cells were treated with TNF for 3h.

(L) Quantification of PI+ cells, stably expressing Dox-inducible Ripk1 constructs. Cells were treated with DMSO or R1-ICR-5 overnight, before incubation with Dox/E for 3 h. Subsequently, cells were treated as indicated.

(M) Schematic diagram depicting rewiring of TNFR1-mediated activation of RIPK3 upon R1-ICR-5 treatment. RIPK1, through its DD (Death domain), competes with TRADD for the binding of TNFR1. Upon depletion of RIPK1, TRADD is enriched at the TNFR1 signaling complex-I, ultimately leading to accentuated formation of complex-II, RIPK3 activation and necroptosis.

Data show ± SD and are representative of (a-c,f-h,j-l) 3 or (d,e) 2 independent biological repeats. P values were calculated using (d,k) one-way ANOVA (Bonferroni multiple comparison test) or (a-c,f,j,m) two-way ANOVA (Sidak’s multiple comparison test) or (g) unpaired t-tests.

RIPK1 not only suppressed the recruitment of TRADD to TNFR1 complex-I (Fig. 2D), but also prevented its association with RIPK3 in the death-inducing complex-II (Fig. 4D). Enhanced recruitment of RIPK3 to TRADD correlated with enhanced activation of RIPK3, MLKL and cell death (Fig. 4DF and Suppl. Fig. S4C). Consistently, proximity ligation assay (PLA) and confocal co-localization analysis indicated that TRADD and RIPK3 come into close proximity upon R1-ICR-5 treatment (Suppl. Fig. S4D,E). Since RIPK3 also interacted with TRADD in RIPK1-deficient cells (Suppl. Fig. S4F), we next evaluated whether TRADD can directly bind to RIPK3. However, reciprocal in vitro binding assays established that recombinant TRADD did not directly bind to RIPK3, suggesting that the interaction between TRADD and RIPK3 is indirect, or might require post-translational modifications (Suppl. Fig. S4FI).

RIPK1 suppressed TRADD aggregation and fibrillation in response to TNF (Fig. 4G), since treatment with TNF caused the time-dependent accumulation of TRADD aggregates when RIPK1 was degraded. Depletion of RIPK1 by RNAi similarly caused TNF-mediated TRADD fibrillation (Suppl. Fig. S4J,K). These data are consistent with a model whereby the recruitment of RIPK3 to TRADD fibrils causes a conformational change of RIPK3 that allows RHIM-mediated homo-oligomerization, ubiquitylation and auto-activation. Consistently, TNF stimulation markedly enhanced the oligomerization, ubiquitylation and activation of RIPK3 and MLKL, which was preceded by TRADD ubiquitylation and oligomerization (Fig. 4H).

To elucidate how TRADD initiates RIPK3 activation upon R1-ICR-5 treatment, we created several TRADD variants and assessed their capacity to restore TNF-induced RIPK3 activation in TRADD-deficient cells (Fig. 4I). While Dox-induced expression of TRADD-WT or -DD alone had no effect on cell viability, such cells became acutely sensitive to TE when RIPK1 was depleted, demonstrating that the DD of TRADD is sufficient to drive TNF-induced activation of necroptosis (Fig 4I,J and Suppl. Fig. S4L). Next, we assessed the requirement of TRADD oligomerisation for RIPK3 activation. We noticed that TRADD readily formed higher order oligomers (Suppl. Fig. S4I) that were destabilised by reducing agents (Fig. 4H), suggesting that di-sulphide bridges might contribute to the formation of TRADD oligomers. To test this, we generated TRADD C>S mutants with substitution mutations on surface exposed Cysteines (Cys) (Fig. 4I). We also included a TRAF-binding mutant70. While such mutants were still recruited to TNFR1 complex-I, they were severely impaired in driving RIPK3-mediated necroptosis upon R1-ICR-5 treatment (Fig 4I,K and Suppl. Fig. S4M). Particularly, TRADDCall>S, in which all surface exposed Cys were substituted to Ser, was strongly impaired in driving RIPK3 activation, even though this mutant was recruited to TNFR1 as efficiently as the TRAF-binding mutant (TRADDY16A/F18A) (Suppl. Fig. S4M). While the TRADDCall>S and TRADDY16A/F18A mutants failed to recruit TRAF2, cIAPs and LUBAC to complex-I, TRADDY16A/F18A was proficient in activating RIPK3 upon R1-ICR-5 treatment. Under the same conditions, however, TRADDCall>S was unable to drive RIPK3-mediated necroptosis. Together, these data are consistent with the notion that di-sulphide bridges are required for TRADD oligomerisation and RIPK3 activation.

Next, to map the domain of RIPK1 that suppressed TRADD fibrillation, we generated Dox-inducible RIPK1 truncation mutants (RIPK1ΔKDΔRHIM and RIPK1DD-only), carrying the DD but lacking the RHIM. Both mutants efficiently suppressed TNF-mediated activation of necroptosis yet had no impact on TLR3/TRIF-driven necroptosis upon R1-ICR-5 treatment (Fig. 4L), as expected. Together, our data suggest that RIPK1, through its DD, regulates TRADD by competing for TNFR1 occupancy in complex-I and additionally, may suppress TRADD:TRADD homo-oligomerization, to prevent further accumulation and fibrillation of TRADD and resultant RIPK3 activation (Fig. 4M).

PROTAC-mediated degradation of RIPK1 achieves anti-tumor activity

The coordinated exposure to iDAMPs and dead cells can activate immune cells, driving anti-tumor immunity45,47. Since depletion of RIPK1 concomitantly enhances NF-κB/interferon signaling and responsiveness to necroptosis, we explored the potential of using PROTAC-mediated degradation of RIPK1 to trigger ICD and boost anti-cancer therapies. Upon R1-ICR-5 treatment, several distinct cancer cell lines were capable of driving TNFR1-, TLR3 and IFNR-mediated necroptosis (Fig. 5AC, Suppl. Fig. S5A). Ripk1−/− deficiency caused resistance to TNF-induced necroptosis upon R1-ICR-5 treatment (Suppl. Fig. S5B). The observation that cells become vulnerable to TNF-induced necroptosis following acute pharmacological or genetic removal of RIPK1, yet are resistant to the same stimulus when RIPK1 is permanently deleted, implies that cells ultimately adapt to long-term absence of RIPK1. Treatment with R1-ICR-5 also sensitized cancer cells to IFN-induced necroptosis (Fig. 5C,D), which agrees with a previous report11. TRADD efficiently bound to RIPK3 following R1-ICR-5 treatment, leading to increased activation of RIPK3 and necroptosis (Fig. 5EG). Similar to L929 cells, RIPK1’s DD effectively suppressed TNFR1- but not TLR3-induced necroptosis, in EO771 TNBC cells, corroborating the notion that these cancer cells are similarly wired (Suppl. Fig. S5C).

Figure 5. RIPK1 protects cancer cells from TNF and IFN-induced cell death.

Figure 5.

(A,B) Quantification of PI+ cells. Cells were pre-incubated with DMSO or R1-ICR-5 for 4 h, cells were left untreated or stimulated with TNF or TE in the presence and absence of RIPK3 inhibitors (6, 48 and 24 h for EO771, MC38 and MCA-205, respectively).

(C) Quantification of PI+ cells. Cells were pre-treated with DMSO or R1-ICR-5 (4 h), before 24 h of IFNβ or IFNγ. MCA-205 and MC38 were pre-treated overnight with IFNγ before incubation with DMSO or R1-ICR-5 for 24 h (MCA-205) or 48 h (MC38).

(D) Quantification of PI+ cells. Cells were pre-treatment with IFNβ in the presence of E overnight. Subsequently, cells were treated with R1-ICR-5 for 5 h, before TNF treatment (24 h).

(E) Purification of TNFR1 complex-II from EO771Dox-FLAG-TRADD cells. Cells were treated with DMSO or R1- ICR-5 for 2 h, before induction of Tradd for 2 h (Dox). Subsequently, cells were treated as indicated and analyzed by western blotting. Densitometry was used to quantify P-RIPK3. P-RIPK3 signal was normalized to purified TRADD.

(F) Western blot analysis of the indicated proteins in EO771Dox-FLAG-TRADD. Cells were pre-treated with DMSO or R1-ICR-5 for 4 h. Subsequently, TRADD was induced with Dox and cells were treated with TE for the indicated time points.

(G) Quantification of PI+ cells, treated as in (F). Data are triplicate technical repeats and are representative of two independent biological repeats.

(H) IFNβ and TNF gene expression analysis of EO771 cells left untreated or exposed to 8 Gy irradiation. Data show mean ± SD and are representative of three biological repeats. Statistical analysis was performed by unpaired t test.

(I-L) Quantification of PI+ cells, subjected to the indicated dose of irradiation. 24 h after treatment, cells were incubated with DMSO or R1-ICR-5 for 24 h. (K) Enbrel was added 30 minutes prior to irradiation.

(m) Quantification of PI+ cells, stably expressing the indicated shRNA constructs, treated as in (K) in the presence of Dox.

Data show ± SD and are representative of (A-D,F,H-M) three, (E) two or (G) four independent biological repeats. P values were calculated using two-way ANOVA (Sidak’s multiple comparison).

Since PROTAC-mediated depletion of RIPK1 sensitized cancer cells to TNF and IFN (Fig. 5AD), we hypothesized that R1-ICR-5 may synergize with therapies that generate a TNF and IFN-rich tumor micro-environment, such as RT and ICB. We focused on TNBC, where RT and ICB are standard-of-care treatments. Exposing EO771 cells to RT caused dose-dependent DNA damage (Suppl. Fig. S5D), which in turn markedly induced NF-κB and IFN-responsive genes, including genes associated with ICD (Cxcl10 & Ifnβ)71 and TNFRSF signaling (Tnf & Tnfsf10 (Trail)) (Fig. 5H, Suppl. Fig. S5E,F). RT-induced cytokine production was entirely TRIF-dependent, as Dox-induced depletion of Trif abrogated RT-induced NF-κB and IFN target gene expression (Suppl. Fig. S5G). RT not only stimulated NF-κB- and IFN-driven signalling responses, but also caused necroptosis in EO771 and MC38 cells, that was blocked by Mlkl deficiency and enhanced by RIPK1-PROTAC-treatment (Fig. 5I,J). Together, this indicates that RIPK1 acts as a survival factor, suppressing RT-mediated cell death. RT-induced necroptosis was partly mediated by TNF, because treatment with Enbrel or Tnfr1 deficiency suppressed the treatment response (Fig. 5K,L). We also noticed that TRIF contributed to the treatment response, because RNAi-mediated depletion of Trif suppressed RT-induced necroptosis, which was further reduced by concomitantly blocking TNF signaling (Fig. 5M). In contrast, depletion of Zbp1 had a relatively minor impact on RT-induced necroptosis (Suppl. Fig. S5H). Together, these observations suggest that cancer cells can hijack RIPK1 to suppress the cellular response to RT.

Next, we tested whether targeting RIPK1 could boost the ability of radiotherapy to ‘heat up’ tumors in vivo. To this end, EO771 TNBC cells were injected into the mammary fat pad of immune competent mice. Upon tumor formation, image-guided RT (8 Gy) was administered, followed by three intra-tumoral injections of R1-ICR-5 (Fig. 6A and Suppl. Fig. S6A,B,E). While RT and R1-ICR-5 had negligible effects as monotherapies, RT/R1-ICR-5 achieved therapeutic responses in 50% of mice (Fig. 6BD and Suppl. Fig. S6CE). While three out of ten mice were tumor-free beyond 70 days, one mouse relapsed at day 76 (Fig. 6BD). Tumor analysis revealed that RT/R1-ICR-5 reshaped the tumor immune microenvironment, promoting TNF+IFNγ+ lymphocyte infiltration (Fig. 6EG and Suppl. Fig. S6F,O and Suppl. Data S1) and favoring the recruitment of adaptive and innate lymphocytes that exhibited key features of activation (CD69+, CD44+, CD62L) (Suppl. Fig. S6GJ) and anti-tumor function (TNF+, IFNγ+, Granzyme B+ and CD107a+) (Fig. 6E,F and Suppl. Fig. S6KN). The emergence of CD8+ and CD4+ effector memory (TEM; CD44hiCD62L) populations at early time points (Suppl. Fig. S6G,H), suggested that RIPK1 degradation enhanced RT-induced immunity, which was confirmed by cured animals (Fig. 6C,D) being fully resistant to tumor re-challenge (Fig. 6H,I). Together, these data indicate the R1-ICR-5 may extend the survival of RT-treated mice by enhancing the recruitment of activated TNF+IFNy+ lymphocytes to the tumor microenvironment, while simultaneously rendering EO771 cancer cells vulnerable to TNF/IFNy-induced cell death.

Figure 6. RIPK1 functions as a protective factor for cancer cells against the effects of RT.

Figure 6.

(A) Schematic depicting the treatment regimen of tumor bearing mice. I.T, Intratumoral injection.

(B) Tumor growth curves of tumor-bearing mice treated as depicted in (A): sham (n = 8), RT (n = 11), RT/R1-ICR-5 (n = 10). Thick lines represent average tumor growth. Curves represent two independent experiments.

(C) Survival curves of EO771 tumor bearing mice treated as depicted in (A,B). Curves represent two independent experiments. Median survival (RT = 24 days; RT/R1-ICR-5 = 35 days) (Logrank (Mantel-cox) P=0.0290).

(D) Pie-charts depicting the response of treated mice from (A,C). Chi-square test – Sham Vs RT/R1-ICR-5, P=0.0186; RT Vs RT/R1-ICR-5, P=0.0382.

(E-G) Flow cytometric analysis of tumors treated as in (A) and harvested on day 13 post-RT. Sham (n=10), RT (n=9) and RT/R1-ICR-5 (n=8). Data are representative of two independent experiments.

(E) The number of TNFα+IFNγ+ immune (CD45+) and non-immune cells (CD45) per gram of tumor.

(F) The number of TNFα+IFNγ+ lymphocytes per gram of tumor.

(G) The number of CD45+, CD8+ T, CD4+ conventional T (CD4cv), γδ T, NK and NK T cells per gram of tumor.

(H) Tumor rechallenge experiment. Data show the growth curves of EO771 mammary tumors, in naïve mice (n=7, black lines) or RT/R1-ICR-5-treated tumor-free mice from (A-D) (100 days post-treatment (n=2, red lines). Each line represents 1 animal, thick lines denote average tumor growth. I.P, intraperitoneal injection; I.T, intratumoral injection.

(I) Pie-charts depicting the proportion of mice bearing tumors, 42-days after re-challenge with EO771 cells (H). Chi-square test, P=0.0027.

(J) Schematic depicting the treatment regimen of tumor bearing mice.

(K) Tumor growth curves of mice treated as in (J). Thick lines represent average tumor growth. Treated mice: IgG (n = 5), anti-CTLA4 (n = 7), RT (n = 10), RT/R1-ICR-5 (n=10), RT/anti-CTLA-4 (n=10) and RT/anti-CTLA-4/R1-ICR-5 (n=10).

(L) Tumor growth kinetics (day 0–30) of mice treated as in (J-K), measured by area under the curve (AUC). Each point represents the AUC of individual mice, from (K).

(M) Survival curves of mice treated as in (J,K). Curves are representative of one biological replicate. Median survival RT/anti-CTLA-4 = 70.5 days; RT/anti-CTLA-4/R1-ICR-5 = undefined.

(N) Pie-charts depicting the response of tumor-bearing mice treated as in (I-M).

Data show ± SD. P values were calculated using (C,M) Log-rank (Mantel-Cox), (D,I,N) Chi-square test (Comparing progression Vs complete response), (E-G) or Kruskal Wallis test or (L) one-way ANOVA (Bonferroni’s multiple comparison test).

Next, we tested whether R1-ICR-5 boosted RT/ICB combinations, using lower doses of RT (4 Gy) followed by α-CTLA-4 ± R1-ICR-5 treatment (Fig 6JN). While RT, α-CTLA-4, and RT/α-CTLA-4 had negligible impact in the first 30 days, combining RT/α-CTLA-4 with R1-ICR-5 strongly inhibited tumor growth (Fig. 6K,L), with nine out of ten tumor-bearing mice responding to therapy and eight being completely cured (Fig. 6M,N).

We also determined whether R1-ICR-5 could enhance the anti-tumor efficacy of anti-PD-1 treatment alone. While neither R1-ICR-5 or anti-PD-1 ICB proved efficacious as single agents, their combination significantly slowed the growth kinetics of treated tumors (Fig. 7AD). Combination-treated mice benefitted from improved response rates (60% response) and overall survival, with a third of treated mice being completely cured (Fig. 7E).

Figure 7. RIPK1 PROTACs enhance response to immune checkpoint blockade.

Figure 7.

(A) Schematic depicting the treatment regimen of tumo-bearing mice. I.P, intraperitoneal injection; I.T, intratumoral injection.

(B) Tumor growth curves of tumor-bearing mice treated as in (A). Thick lines represent average tumor growth. Treated mice: IgG (n = 8), R1-ICR-5 (n = 9), anti-PD-1 (n = 8), R1-ICR-5/anti-PD-1 (n=10).

(C) Tumor growth kinetics (day 0–21) of mice treated as in (A), measured by area under the curve (AUC). Each point represents the AUC of individual mice, from (B).

(D) Survival curves of tumor-bearing mice treated as in (A). Curves are representative of one independent experiment. R1-ICR-5 improves the median survival of mice treated with anti-PD-1 (median survival: anti-PD-1 = 28.5 days; R1-ICR-5/anti-PD-1 = 36.5 days).

(E) Pie-charts depicting the response of tumor-bearing mice treated as in (A-D). Chi-square test – Captisol/IgG Vs PD-1, P=0.0209; Captisol/IgG Vs PD-1/R1-ICR-5, P=0.0073.

(F) Association of RIPK1 copy number alterations (CNA) with disease free survival in TCGA patients (n=2,601) across multiple tumor types.

(G) Overall survival in RIPK1-low/NK-high versus RIPK1-high/NK-low patient groups from SCAN-B TNBC dataset (n=148).

(H) Gene set enrichment analysis (GSEA) of indicated gene sets in RIPK1-low/NK-high versus RIPK1-high/NK-low TNBC patients (n=148). FDR, False discovery rate q-value; NES, Normalised enrichment score.

Data show ± SD. P values were calculated using (C) one-way ANOVA (Bonferroni’s multiple comparison test), (D,F,G) Logrank (Mantel-Cox) or (E) Chi-square test (Comparing progression Vs complete response).

Our data indicate that RIPK1 confers resistance to innate immune signaling and ICD, functioning as a protective factor for cancer cells and hampering the immunostimulatory effects of RT. Consistently, analyzes of The Cancer Genome Atlas (TCGA) revealed a strong correlation between increased RIPK1 copy number alterations and poor disease-free survival (Fig. 7F). Moreover, stratifying TNBC patients based on RIPK1 status and NK cell infiltration, found that RIPK1-low/NK cell-high was associated with better overall survival (Fig. 7G). Correspondingly, RIPK1-low/NK-high patients differentially induced genes relating to Type-I/II IFN, cell death and inflammatory responses (Fig. 7H and Suppl. Fig. S6P). Therefore, targeting RIPK1 by PROTACs emerges as a promising approach to heat up tumors and overcome resistance to immunostimulatory therapies.

Acute depletion of RIPK1 suppresses RIPK1-driven skin inflammation

Previous work established that aberrant RIPK1-mediated keratinocyte cell death can lead to skin pathologies22. Since keratinocytes are somewhat resistant to RIPK1-independent activation of RIPK310,15, we evaluated whether PROTAC-mediated degradation of RIPK1 in vivo (Suppl. Fig. S7A), could suppress RIPK1-induced skin inflammation. Subcutaneous injection of R1-ICR-3 or R1-ICR-5 alone did not cause skin toxicity (Suppl. Fig. S7B,C), indicating that acute depletion of RIPK1 is well tolerated and did not cause RIPK3 activation in the skin. Consistently, conditional, skin-specific deletion of Ripk1 had little effect in 7–11 weeks old mice, whereas Casp8 deletion caused deep ulceration and epidermal loss, which was rescued by co-deletion of Ripk1 (Suppl. Fig. 7D,E). To test the therapeutic effects of RIPK1-PROTACs, we used two skin inflammation models. First, we caused RIPK1-dependent cell death and tissue injury by subcutaneous injection of SM and E (SM/E), which mimics inflammatory diseases caused by IAP loss72,73. While subcutaneous SM/E injection caused significant skin ulceration73, co-injection of RIPK1-PROTACs protected animals from tissue injury (Suppl. Fig. S7B,C). The SM/E-treated mice achieved the highest Histological multivariant Lesion Score (HLS) of mean 214 (range 175–257), while RIPK1-PROTAC-treated animals reached an HLS mean 49 (range 39–58) and 55 (range 30–70), respectively (Suppl. Fig. S7C). Single injections of SM or E alone had no effect73. In contrast, subcutaneous injection of SM/E caused deep ulceration of the epidermis and subepidermal layer of dermis and showed formation of dense collagenous fibrotic tissue (Suppl. Fig. 7B,C)73. Animals also displayed cellular necrosis, including the presence of nuclear dust mostly at superficial or mid dermis. Co-treatment with RIPK1-PROTACs blocked the appearance of the aforementioned features (Suppl. Fig. 7B,C).

We also tested whether PROTAC-mediated degradation of RIPK1 suppressed the inflammatory pathology driven by TBK1 inactivation. Human TBK1 deficiency leads to severe inflammation that is driven by TNF-induced RIPK1-dependent cell death7476. Since biallelic loss of TBK1 is embryonically lethal in mice74,77, we pharmacologically inhibited TBK1 in mature skin. Subcutaneous injection of MRT6730778 (subsequently referred to as TBK1i) caused deep ulceration and tissue injury in combination with TNF (Suppl. Fig. 7F,G), which was fully protected by R1-ICR-5. Together, these data demonstrate that RIPK1-mediated inflammatory skin disease can be suppressed by RIPK1-PROTACs. Unlike RIPK1 kinase inhibitors, which only efficiently blocked necroptosis in human cells, RIPK1-PROTACs potently suppressed RIPK1-induced caspase activation and apoptosis in a panel of human cell lines (Suppl. Fig. S1A,B and Suppl. Fig. 7H,I). In contrast, the RIPK1 kinase inhibitors PK68 and GSK’963 were ineffective to do so in human cells (and S7H,I). Therefore, RIPK1-PROTACs might be effective for treating human pathologies driven by RIPK1-induced apoptosis and/or necroptosis, particularly in tissues inherently devoid of RIPK3 activation, when RIPK1 is depleted.

DISCUSSION

Although RIPK1 has emerged as a therapeutic target, its successful targeting has proved to be difficult, at least in part, due to its bifunctional scaffolding and kinase signaling properties. Here we report the development of R1-ICR-5, a highly selective and efficacious PROTAC degrader of both human and murine RIPK1. Unexpectedly, acute depletion of RIPK1 leads to abnormal activation of NF-κB/IRF-IFN signaling, and simultaneous induction of necroptosis. In the context of TNFR1 signaling, RIPK1 depletion enables TRADD’s accumulation at the TNFR1, which in turn causes enhanced recruitment of TRAF2, cIAPs and LUBAC. This amplifies Ub-mediated activation of NF-κB/MAPK signaling and cytokine production. Additionally, unhindered accumulation of TRADD also triggers lethal activation of RIPK3. Although this process requires RIPK3’s RHIM domain, it seems to operate independently of RIPK1, TRIF and ZBP1. While our experiments cannot categorically rule out a role for ‘residual’ RIPK1, TNF-induced activation of RIPK3 occurs independent of ‘residual’ RIPK1 kinase activity, as treatment with RIPK1 kinase inhibitors did not impact TNF-induced necroptosis, following R1-ICR-5 treatment. Further, combining RNAi-mediated depletion of RIPK1 with R1-ICR-5 treatment fails to ameliorate TRADD-mediated RIPK3 activation. Therefore, if indeed residual RIPK1 contributes to TNF-mediated RIPK3 activation, it does so in a non-conventional manner. We conclude that PROTAC-mediated depletion of RIPK1 facilitates the formation of TRADD aggregates/polymers that drive RIPK3 activation and necroptosis. Together, our data indicate that RIPK1 licenses tuned activation of TNFR1 and TLRs signaling (TLR3 and TLR4) by functioning as a nucleation barrier for self-templating polymerization of TRADD and TRIF, thereby preventing these signaling hubs from ‘overheating’. Consequently, RIPK1 functions as a universal suppressor of necroptosis triggered by death receptors (this study and6164) and PRRs15,16,6164,79,80.

The combination of enhanced immunostimulatory signaling and necroptosis are hallmark features of "ICD"8,45,46,81. Targeting ICD has emerged as a promising strategy in cancer therapy, as it simultaneously kills apoptosis-resistant cancer cells, while also stimulating an immune response against tumor cells, potentially enhancing the efficacy and durability of treatments46. While RIPK1-PROTACs might be useful to enhance ICD, removal of RIPK1 alone is not sufficient because RIPK1 merely functions as a brake of immunogenic pathways. Therefore, ligands will be required to engage these pathways. Such ligands can be provided by RT and ICB, which inherently cause the production of TNF and IFNs, sensitizing cancer cells to necroptosis when RIPK1 is depleted. Additionally, RT also stimulates the production of CXCL10, an immunostimulatory chemokine that enhances the recruitment and cross-priming of T lymphocytes82,83. Consistently, we find that RT/R1-ICR-5 reshapes the tumor immune microenvironment, by favoring the recruitment of TNF+IFNγ+ lymphocytes, exhibiting key features of activation and anti-tumor function (enhanced degranulation and Granzyme-B+). Accordingly, RT/R1-ICR-5 achieved durable treatment responses, rendering cured mice resistant to tumor-rechallenge.

While loss of sensitivity to TNF/IFN cytotoxicity perpetuates immune evasion and resistance to immunotherapy25,8486, we find that acute depletion of RIPK1 re-sensitizes cancer cells to the effect of TNF/IFN, and in combination with RT, promotes the influx of TNF+IFNy+ lymphocytes. Correspondingly, stratifying TNBC patients based on tumor RIPK1 and TNF/IFNy-secreting lymphocytes (NK cells) status, revealed that RIPK1-low/NK-high TNBC patients exhibited prolonged overall survival and differentially expressed genes associated with IFN, TNF and regulated cell death signaling, when compared to RIPK1-high/NK-low patients. RT is currently employed to treat around 50% of all cancer patients, and done so with curative intent for head and neck, prostate and lung cancers87. RT is usually not an effective treatment for TNBC patients, which are known to face the worst prognosis, compared to other breast cancer sub-types88. However, our findings provide potential new therapeutic strategies to improve the effectiveness of RT in the context of TNBC and other cancer types, where RT is not used with curative intent. While the use of immunotherapies has revolutionized the treatment of some cancers, most patients remain refractory to treatment89. In concordance with R1-ICR-5’s ability to restore sensitivity to TNF/IFNs, we also provide evidence that RIPK1 PROTACs enhance the efficiency of anti-cancer immunotherapy (ICB). As such, RIPK1 PROTACs could offer a means of dually boosting the number of patients that are eligible for such therapies, while improving the durability of treatment responses.

In summary, we provide pharmacological proof-of-concept that acutely depleting RIPK1 with PROTACs can potentiate the immunostimulatory effects and therapeutic responses caused by RT and ICB. We envisage that targeting RIPK1 with PROTACs may become even more important in the future, as improved PROTAC molecules are advanced into the clinic

Limitation of the study

In this study, we demonstrate the enhanced immunostimulatory and anti-tumor effects of RIPK1-selective PROTACs when used in combination with radiotherapy (RT) and immune checkpoint blockade (ICB). Further, we show that local injection of RIPK1 PROTACs can effectively reduce inflammatory skin lesions. However, to further evaluate RIPK1 degraders as potential therapeutic agents and to assess their systemic tolerability, a tool compound that can sufficiently degrade RIPK1 on systemic dosing is needed. Encouraging results from IHC studies of tumor slices, intra-tumorally treated with R1-ICR-5, show that the degradation of RIPK1 within tumors is localized and incomplete, yet associated with inhibited tumor growth, improved survival, and increased immune cell infiltration when combined with RT and/or ICB. Moreover, our data indicate that the effects of RIPK1 degradation persist for at least 24 hours post compound removal, suggesting that a complete and continuous degradation of RIPK1 may not be essential to initiate an immune response. Nonetheless, a thorough toxicological assessment using a systemically dosed compound in preclinical mouse models will be essential to advance the development of RIPK1 degraders for therapeutic use.

STAR METHODS

Resource availability

Lead contact

Further information and reasonable requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Pascal Meier (pmeier@icr.ac.uk).

Materials availability

Materials generated in this study are available upon reasonable request and will be fulfilled under a material transfer agreement (MTA).

Data and code availability

  • Raw RNA-Seq data for the mammary tumor cell line (EO771) have been deposited in the Sequence Read Archive under the accession number PRJNA1094427. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE91 partner repository with the dataset identifier PXD043560.

  • Original immunohistochemistry, microscopy and western blot images have been deposited at Mendeley and are publicly available (DOI: 10.17632/822syk52yw.1). All other raw data reported in this paper will be shared by the lead contact upon reasonable request.

  • This paper analyses existing, publicly available data. These accession numbers for the datasets are listed in the key resources table.

  • This paper does not report original code.

  • Any additional information required to reanalyse the data reported in this paper is available from the lead contact upon request.

KEY RESOURCES TABLE.
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
α-cleaved-caspase-3 Cell Signaling Technology Cat #9664S
α-phospho-ERK1/2 Cell Signaling Technology Cat#9101S
α-FLAG Cell Signaling Technology Cat#8146
α-γH2AX Cell Signaling Technology Cat#9718P
α-IKKβ Cell Signaling Technology Cat#8943S
α-phospho-IKK α/β Cell Signaling Technology Cat#2697S
α-ISG15 Cell Signaling Technology Cat#2743
α-MK2 Cell Signaling Technology Cat#3042
α-phospho-MK2 Cell Signaling Technology Cat#3007
α-p38 Cell Signaling Technology Cat#9212
α-phospho-p38 Cell Signaling Technology Cat#4511
α-p65 Cell Signaling Technology Cat#8242s
α-phospho-p65 Cell Signaling Technology Cat#3033
α-TRADD Cell Signaling Technology Cat#3694S
α-TRAF2 Cell Signaling Technology Cat#4724S
α-phospho-mRIPK3 T231/S232 Cell Signaling Technology Cat#91702
α-mouse RIPK1 N-terminal Cell Signaling Technology Cat#3493
α-human RIPK1 N-terminal Cell Signaling Technology Cat#73271
α-mouse RIPK2 Cell Signaling Technology Cat#4142S
α-mouse RIPK2 Cell Signaling Technology Cat#4928
α-mouse RIPK3 Cell Signaling Technology Cat#15828
α-human RIPK3 Cell Signaling Technology Cat#13526S
α-TrkA Cell Signaling Technology Cat#2505S
α-B-raf Santa Cruz Biotechnology Cat#sc-5284
α-IkBa Santa Cruz Biotechnology Cat#sc-371
α-Ubiquitin Santa Cruz Biotechnology Cat#sc-8017
α-phospho-MLKL S345 Abcam Cat#ab196436
α−TNFR1 Abcam Cat#19139
α-RIPK1 BD Bioscience Cat#610459
α-RIPK2 BD Bioscience Cat#612348
α-MLKL Millipore Cat#MABC604
α-ZBP1 Adipogen Cat#AG-20B0010-C100
α-FADD Assay designs Cat#AAM-212
α-HOIP Bethyl laboratories Cat#A303–560A
α-Sharpin Proteintech Cat#14626–1-AP
α-ERK1/2 Gift from Prof. Chris Marshall N/A
α-cIAP1 Enzo Cat#ALX-803–335-C100
α-mouse IgG (H+L)-HRP Jackson Immuno Research Cat #115–035-003
α-rabbit IgG (H+L)-HRP Jackson Immuno Research Cat#111–035-003
α-rat IgG (H+L)-HRP Jackson Immuno Research Cat#112–035-003
Phalloidin Alexa 633 Thermo Fisher Scientific Cat#A22284
Alexa 488 α-rabbit secondary antibody Thermo Fisher Scientific Cat#A-11034
DAPI Sigma Aldrich Cat#10236276001
Alexa 488 α-rabbit secondary antibody Thermo Fisher Scientific Cat#A21206
α-IgG2a (in vivo) 2B scientific Cat#BE0085
α-DYKDDDDK tag Thermo Fisher Scientific Cat#8146
α-CTLA-4 (in vivo) 2B scientific Cat#BE0164
α-PD-1 (in vivo) 2B scientific Cat#BE0146
α-mouse CD107a-BUV395 BD Cat#565533; Clone#1D4B
α-mouse CD107a-PE Biolegend Cat#121611; Clone#1D4B
α-mouse CD44-BUV395 BD Cat#740215; Clone#IM7
α-mouse CD25-BV650 Biolegend Cat#102037; Clone#PC61
α-mouse CD4-BV496 BD Cat#741050; Clone#RM4–4
α-mouse MHCII-PE-Dazzle-594 Biolegend Cat#107647; Clone#M5/114.15.2
α-mouse CD3-BUV563 BD Cat#741319; Clone#17A2
α-mouse TCRδ-BUV615 BD Cat#751183; Clone#GL3
α-mouse TCRδ-PerCpCy5.5 Biolegend Cat#118117; Clone#GL3
α-mouse CD11c-BUV615 BD Cat#751222; Clone#N418
α-mouse CD11c-PECy7 Biolegend Cat#117317; Clone#N418
α-mouse Singlec-F-AF488 Biolegend Cat#55523; Clone#S17007L
α-mouse Singlec-F-BV605 BD Cat#121612; Clone#E50–2440
α-mouse CD69-PECy7 Biolegend Cat#104511; Clone#H1.2F3
α-mouse CD69-BV785 Biolegend Cat#740388; Clone# H1.2F3
α-mouse CD19-BUV661 BD Cat#612971; Clone#1D3
α-mouse NK1.10BUV737 BD Cat#741715; Clone#PK136
α-mouse NK1.1-PECy5 Biolegend Cat#108715; Clone#PK136
α-mouse CD45-BUV805 BD Cat#748370; Clone#30F11
α -mouse F4/80-BV650 Biolegend Cat#123149; Clone#BM8
α-mouse FoxP3-eFlour450 Thermo Fisher Scientific Cat#17–5773-82; Clone#FJK-16s
α-mouse Ly6G-BV510 Biolegend Cat#127633; Clone#1A8
α-mouse CD62L-PECy5 Biolegend Cat#104410; Clone#MEL-14
α-mouse CD8α-BV570 Biolegend Cat#100739; Clone#53–6.7
α-mouse Ly6C-AF700 Biolegend Cat#128023; Clone#HK1.4
α-mouse CD11b-BV750 Biolegend Cat#101267; Clone#M1/70
α-mouse TNFα-APC Biolegend Cat#506307; Clone#MP6-XT22
α-mouse Grzmb-AF647 Biolegend Cat#515405; Clone#GB11
α-mouse IFNγ-AF488 Biolegend Cat#505815; Clone#HM61.2
α-mouse TCRβ-PerCP-Cy5 Biolegend Cat#109228; Clone#H57–597
α-mouse CD8α-BUV395 BD Biosciences Cat#563786; Clone#53–6.7
α-mouse CD4-BV650 Biolegend Cat#100555; Clone#RM4–5
α-mouse CD44-BV785 Biolegend Cat#103059; Clone#IM7
α-mouse CD25-EF450 Thermo Fisher Scientific Cat#48–0251-82; Clone#PC61–5
LIVE/DEAD Fixable Near-IR Thermo Fisher Scientific Cat#L34976
α-FLAG tag Cell Singalling Technology Cat#8146
α-mouse HRP Abcam Cat #ab131368
Mouse Fc Block (CD16/CD32) BD Biosciences Cat #553141
Bacterial and virus strains
BL21(DE3) E. Coli New England Bioscience Cat #C2527
One Shot TOP10 E. Coli Thermo Fisher Scientific Cat #C404010
Biological samples
Chemicals, peptides, and recombinant proteins
Propidium Iodide Sigma-Aldrich Cat#P4864
Hoechst-33342, Trihydrochloride, Trihydrate Thermo Fisher Scientific Cat#H3570
Glutathione Sepharose 4B beads GE Healthcare Cat#17075601
Recombinant mouse M-CSF Peprotech Cat#300–25
Gentle Collagenase/Hyaluronidase Stemcell Technology Cat#07919
RIPK1 inhibitor GlaxoSmithKline GSK’963 Stratech Scientific Cat#HY-103028A; CAS#:2049868–46-2
RIPK1 inhibitor (PK68) Insight Bio Cat#HY-128348; CAS#:2173556–69-7
RIPK3 inhibitor GlaxoSmithKline GSK’872 Stratech Scientific Cat#S8465; CAS: 1346546–69-7
Necrostatin-1s MedChemExpress Cat#HY-103028A; CAS#: 4311–88-0
RIPK2 PROTAC degrader 2 Cambridge Bioscience Cat#HY-111866–10 mg; CAS#1801547–16-9
SM-164 Caltag Medsystems Cat#TAR-T12932L; CAS#957135–43-2
ASTX660 Insight Bio Cat#HY-109565; CAS#1799328–86-1
Recombinant human TNFa Enzo Cat#ALX-522–008-C050
Recombinant mouse TNFa Enzo Cat# ALX-522–009-C050
Emricasan, pan-caspase inhibitor Medkoo Cat#510230; CAS#254750–02-2
Z-VAD-FMK, pan-caspase inhibitor Apex Bio Cat#A1902; CAS #187389–52-2
Bortezomib, proteasome inhibitor Stratech Cat#S1013; CAS#179324–69-7
VH298, VHL inhibitor Abcam Cat#ab230370
Human recombinant INFβ Peprotech Cat#300–02BC
Murine recombinant INFβ Biomol Cat#RP0487M
Murine recombinant IFNγ Peprotech Cat#315–05
Poly(I:C) HMW Invivogen Cat#tlr-pic; CAS#31852–29-6
Riboxxol Riboxx Cat#A-00102; CAS#63231–63-0
LPS EK Ultrapure Invivogen Cat#tlrl-peklps
Enbrel (Etanercept) Cambridge Bio Cat#HY-108847–10
5Z-7-Oxozeaenol, TAK1 inhibitor Bio-techne Cat#3604
BX795, TBK1/IKKε inhibitor Invivogen Cat#tlrl-bx7–2; CAS#1472611–45-2
p38 inhibitor (Ralimetinib LY2228820 dimesylate) Selleckchem Cat#862507–23-1; CAS#862507–23-1
PF-3644022 (MK2 inhibitor) Bio-Techne Cat#HY-107427; CAS #1276121–88-0
TPCA-1 (IKK2 inhibitor) Sigma-Aldrich Cat#T1452; CAS#507475–17-4
NIK SMI1 (NIK inhibitor) Stratech Cat#S8941-SEL; CAS#1660114–31-7
Cycloheximide Tocris Cat#0970–100; CAS#66–81-9
HOIPIN-8 (HOIP inhibitor) Axon MedChem Cat#2972; CAS#2519537–69-8
Tpl2 kinase inhibitor Insight biotechnology Cat#HY-12358; CAS#871307–18-5
XIAP degrader Insight biotechnology Cat#HY-115865
DL-Dithiothreitol (DTT) Sigma-Aldrich Cat#10708984001; CAS#3483-12-3
PR-619 (DUB inhibitor) 2BScientific Cat#SI-9619–0005
Recombinant human USP2 Catalytic domain protein Bio-Techne, R&D Cat#E504050
Anti-FLAG M2 affinity agarose beads Sigma-Aldrich Cat#A2220
Strep-Tactin Sepharose resin beads IBA lifesciences Cat#2–1201-025
Lenti-X concentrator Clontech Takara Cat#621231
Polybrene Merk Cat#TR-1003-G
Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific Cat#13778150
Blasticidin Invivogen Cat#ant-bl-05
Collagenase type VI Sigma Aldrich Cat#7919
Tryton X-100 Thermo Fisher Scientific Cat#28314
PR-619 DUB inhibitor 2B Scientific Cat# SI-9619–0005
PhosSTOP easypack Sigma Aldrich Cat#4906837001
Complete protease inhibitor cocktail Roche Cat# 11836153001
GSH beads Sigma Aldrich Cat#GE17–0756-01
Protein G beads Sigma Aldrich Cat#P3296
Clean-Blot IP Detection Reagent (HRP) Thermo Fisher Scientific Cat#21230
Dispase Sigma Aldrich Cat#D4693–1G
DNase type I Sigma Aldrich Cat#DN25
Corning Matrigel GFR SLS N/A
Ionomycin from Streptomyces Conglobatus Sigma Aldrich Cat#I9657
MRT3767, TBK1i Sigma Aldrich Cat#SML0702
HALT Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat#78447
Dako REAL peroxidase block Agilent Cat#S202386–2
Dako rabbit EnVision polymer-HRP Agilent Cat#K400311–2
Dako DAB+ Agilent Cat#K346811–2
Dako FLEX Haematoxylin Agilent Cat#K800821–2
Rabbit ImmPRESS polymer-HRP Vector Laboratories Cat#MP-7401–50
Dako Target Retrival Solution Agilent Cat#K800421–2
Target retrieval solution (TRS) Agilent Cat#K800521–2
Critical commercial assays
Effectene Transfection Kit Qiagen Cat#301427
Nano-Glo HiBiT Lytic Detection KitP Promega Cat#N3030
NaveniFlex MR Bethyl Laboratories Cat#NF.MR.100
CellTiter-GLO Promega Cat#G9681
RNeasy RNA extraction kit Qiagen Cat#74106
QuantiTec Reverse Transcription kit Qiagen Cat#205314
Pierce BCA protein assay kit Thermo Fisher Scientific Cat#23227
Deposited data
Bulk RNA-seq (Sham Vs RT-treated EO771 cells) Sequence read archive ID: PRJNA1094427
Mass spectrometry: Human and mouse whole proteome analysis PRIDE ID: PXD043560
TCGA Pan-cancer analyses cBioPortal N/A
SCAN-B TNBC patient data GEO Database ID: GSE96058
GSEA analyses (hallmark gene set collection) The Molecular Signatures Database (MSigDB) N/A
Raw western blots and image from this paper Mendeley DOI: 10.17632/822syk52yw.1
Experimental models: Cell lines
HEK293T ATCC Cat#CRL-3216
HT1080 ATCC Cat#CCL-121
U937 ATCC Cat#CRL-3253
HT29 ATCC Cat#HTB-38
MDA-MB-231 ATCC Cat#CRM-HTB-26
MDA-MB-361 ATCC Cat#HTB-27
MDA-MB-468 ATCC Cat#HTB-132
HaCaT ATCC Cat#PCS-200–011
LLC ATCC Cat#CL-101
L929 ATCC Cat#CRL-2148
THP-1 ATCC Cat#TIB-202
EMT6 ATCC Cat#CRL-2755
Lim1215 Laboratory of Prof. Chris Marshall N/A
A431 ATCC Cat#CRL-1555
F3II Laboratory of Prof. Daniel Alonso N/A
D2A1 Laboratory of Prof. Clare Isacke N/A
Kym-1 Laboratory of Prof. John Silke N/A
Immortalized MDFs Charles River (Cells generated in house) N/A
MCA-205 Sigma Aldrich Cat#SCC-173
EO771 CH3 Biosystems Cat#94A001
MC38 Kerafast Cat#ENH204-FP
Wildtype BMDMs and Lung fibroblasts (C57BL/6) Charles River (Cells generated in house) N/A
Spata2-/- BMDMs (C57BL/6) Laboratory of Prof. Mads Gyrd-Hansen’s N/A
Trif-/- BMDMs (C57BL/6) (Ticam1-/-) Laboratory of Prof. Manolis Pasparakis N/A
Zbp1-/- BMDMs (C57BL/6) Laboratory of Prof. Manolis Pasparakis N/A
Trif-/-Zbp1-/- BMDMs and LFs (C57BL/6) (Ticam1-/-Zbp1-/-) Laboratory of Prof. Manolis Pasparakis N/A
L929 Tradd -/- This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD WT This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD DD-only This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD Y16A/F18A This Manuscript N/A
L929Tradd-/- reconstituted with TRADD C239S This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD Call>S This Manuscript N/A
L929 GFP-RIPK1ΔKDΔRHIM This Manuscript N/A
L929 GFP-RIPK1 DD-only This Manuscript N/A
E0771 GFP-RIPK1ΔKDΔRHIM This Manuscript N/A
E0771 GFP-RIPK1 DD-only This Manuscript N/A
293T-Ripk1-/- This Manuscript N/A
E0771-Ripk1-/- This Manuscript N/A
E0771-Tnfr1-/- This Manuscript N/A
E0771-Mlkl-/- This Manuscript N/A
Experimental models: Organisms/strains
C57BL/6-Mlkl-/- Laboratory of Prof. Henning Walczak N/A
C57BL/6-Casp8-/-Ripk3-/- Laboratory of Prof. Henning Walczak N/A
C57BL/6-Casp8tm1Hed/J The Jackson Laboratory RRID:IMSR_JAX: 027002
C57BL/6.Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/1J The Jackson Laboratory RRID:IMSR_JAX: 007001
C57BL/6-Tnfrsf1atm1Imx/J The Jackson Laboratory RRID:IMSR_JAX: 003242
C57BL/6-Ifnar1tm1.2Ees/J The Jackson Laboratory RRID:IMSR_JAX: 028288
C57BL/6-Ripk1fl/fl Laboratory of Prof. Manolis Pasparakis N/A
Oligonucleotides
SMART vector inducible non-targeting (Nt) shRNA Dharmacon VSC11502
SMART vector inducible Ripk1 shRNA Dharmacon V3SM11253–237881699
SMART vector inducible Trif shRNA (Ticam1) Dharmacon V3SM11253–235355483
SMART vector inducible Zbp1 shRNA Dharmacon V3SM11253–235538171
See Table S2 for PCR primers, Taqman probes, siRNAs & CRISPR gRNAs
Recombinant DNA
pTRIBZ This Manuscript N/A
pTIBZ-Cre This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-WT This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-DD This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-Y16A/F18A This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-Call>S This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-C239S This Manuscript N/A
pMA-RQ-N2xFLAG-mTradd-WT This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-DD This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-Y16A/F18A This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-Call>S This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-C239S This Manuscript Synthetic, Invitrogen
pTIBZ-mRipk3-WT This Manuscript N/A
pTIBZ-mRipk3-RHIMm This Manuscript N/A
pTIBZ-EGFP-mRipk1 ΔKDΔRHIM This Manuscript N/A
pTIBZ-EGFP-mRipk1 DD-only This Manuscript N/A
pMA-RQ-mRipk1 ΔKDΔRHIM This Manuscript Synthetic, Invitrogen
pMA-RQ-mRipk1 DD-only This Manuscript Synthetic, Invitrogen
pTRIPZ Open Biosystems Cat#RHS4696
pTIPZ-hRipk1 ΔRHIMΔDD-HiBiT This Manuscript N/A
pTYB1 New England BioLabs Inc. Cat#N6701
pTYB1-FLAG-mTradd WT This Manuscript N/A
pT7CFE1-CHis ThermoFisher 88860
T7CFE-mRipk3 This Manuscript N/A
pcDNA3.1 Invitrogen Cat#V79520
pcDNA3-GFP-2xHA/2xStrep This Manuscript N/A
pcDNA3.5-N2xHA-mRipk1 This Manuscript N/A
pcDNA3-N3xHA-mZbp1 This Manuscript N/A
pcDNA3-N3xHA-mRipk3 This Manuscript N/A
pcDNA3-mTrif-C3xHA (Ticam1) This Manuscript N/A
pcDNA3-N2xFLAG-mTradd This Manuscript N/A
pLC-EGFP Gift from B. Bornhauser Addgene Cat# 75159
pLC-Cherry Gift from B. Bornhauser Addgene Cat# 75161
pSpCas9(BB)-2A-GFP Addgene 48138
pLC-EGFP-mTradd gRNA (CGCAACTGGACGATGAGCTG) This Manuscript N/A
pLC-EGFP-mTnfr1 gRNA (CGGACAGTCACTCACCAAGT) This Manuscript N/A
pLC-Mlkl gRNA-CGM25 (CTGGCAGCAGGAAGATCGAC) This Manuscript N/A
pLC-Ripk1 gRNA-CGM19 (AGGGAACTATTCGCTGGTGA) This Manuscript N/A
pMA-hRipk1-gRNA (GCTCGGGCGCCATGTAGTAG) This Manuscript Synthetic, Invitrogen
psPAX2 Addgene Cat# 12260
pMD2.G Addgene Cat# 12259
pBABE SV40 (Δ89–93) Gift from Parmjit Jat (Cotsiki et al, 2004) https://doi.org/10.1073/pnas.0308006100
Software and algorithms
Dotmatics Dotmatics N/A
Harmony High Content Analysis Software Perkin Elmer N/A
ImageLab (v6.1.0) Bio-Rad N/A
GraphPad Prism (v10.2.1) (339) Dotmatics N/A
Adobe Illustrator (v28.0) (2024) Adobe N/A
R studio package (v4.3.0) Limma N/A
Fiji (v2.9.0) ImageJ N/A
FlowJo (v.10) BD Biosciences N/A
FACSDIVA software (v6.1.3) BD Biosciences N/A
Other

Experimental model and study participant details

Cell lines

293T, HT1080, U937, HT29, MDA-MB-231, MDA-MB-361, MDA-MB-468, HaCaT, LLC, L929, THP-1 and EMT6 were from ATCC. F3II cells (kindly provided by Daniel Alonso), D2A1 cells (kindly provided by Clare Isacke), Kym-1 (kindly provided by John Silke), and MC38 (Kerafast). Aforementioned cell lines were cultured in DMEM. E0771 cells (CH3 BioSystems) and MCA-205 (Sigma) were cultured in RPMI 1640 medium (Thermo Fisher Scientific). Culture media were supplemented with 10% FBS (Sigma Aldrich, #A2153) and 1% penicillin/streptomycin.MCA-205 were additionally cultured with 2-mercaptoethanol (50 μm) and MC38s and EO771s were additionally cultured in the presence of Hepes (5mM). All cell lines were maintained at 37°C, in 10% CO2.

Primary cells

Primary bone marrow-derived macrophages (BMDMs) and mouse dermal fibroblasts (MDFs) of indicated genotypes were isolated as previously described73,76. In brief, bone marrows were isolated form tibia and femur of 8–12-week-old mice and plated in non-coated Petri dishes and cultured for 6 days in DMEM (+10% FCS and Penicillin and Streptomycin) supplemented with recombinant M-CSF (20 ng/mL) or L929 mouse fibroblast conditioned medium (20%, v/v). Primary MDFs were isolated from the tail of adult 2 months old mice (Laura’s paper). In brief the skin of the tail was cut in small pieces and digested with 3ml of trypsin for 45min at 37°C. Medium was added and digested skin pieces were filtered through a 100μm strainer. The strained medium was placed in 10cm dish and incubated at 37°C/5% CO2 for 2–3 days. Next MDFs were immortalized with pBABE SV40 (large T antigen Δ89–97-missing Bub192). Lung fibroblasts (LFs) were obtained by homogenizing lungs of 8–12-week-old mice in neat DMEM and 1X Gentle Collagenase/Hyaluronidase, before shaking (2000 rpm) for 45 min at 37°C. Suspensions were filtered (70 μm cell strainer), before pelleting (250G). Suspensions were cultured in DMEM (+10% FBS and 1% Penicillin/Streptomycin). Indicated LFs were immortalized as above with pBABE SV 40. All cells were cultured in DMEM supplemented with 10% FBS (Sigma Aldrich, #A2153) and 1% penicillin/streptomycin and maintained at 37°C, in 10% CO2. Primary naïve T-cells (CD4+ and CD8+) cells were 93.

Mice

C57BL/6 Wt (Charles River), UBC-Cre-ERT2 (referred to as CreERT2), Casp8fl/fl, Tnfr1−/− and Ifnar1−/− were from The Jackson Laboratory, Mlkl−/− and Casp8−/−Ripk3−/− (Kind gifts from Prof. Henning Walczak) and Ripk1fl/fl (Kind gifts from Prof. Manolis Pasparakis) (See key resources table for more information). All mice were maintained on C57BL/6 background. For tumor treatments, 5 – 6 weeks old female C57BL/6 mice were purchased from Charles River and were enrolled in the study post an acclimatization period of at least one week. Mice were randomly assigned to treatment groups and studies were performed in a blinded fashion. All animal procedures were conducted within the guidelines of UK Home Office in accordance with Animals (Scientific Procedure) Act (ASPA) 1986, amended 2012 and the institutional guidelines of the Institute of Cancer Research. The Animal Welfare Ethical Review Body (AWERB) reviewed the protocols within the project license.

Method details

PROTAC degrader chemical synthesis

Synthesis of R1-ICR-3 [cyclohexyl (5-(2-((S)-15-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-16,16-dimethyl-13-oxo-4,7,10-trioxa-14-azaheptadecanamido)benzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate]

To a solution of cyclohexyl (5-(2-aminobenzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate (115 mg, 0.30 mmol) and (S)-15-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-16,16-dimethyl-13-oxo-4,7,10-trioxa-14-azaheptadecanoic acid (50 mg, 0.075 mmol) in DMF (5 mL), was added DIPEA (0.039 mL, 0.226 mmol) followed by COMU (64.6 mg, 0.151 mmol). The reaction was heated to 50 °C for 18 hours then purified via HPLC (C18, 35–55% acetonitrile in 10mM ammonium bicarbonate, 0.1% ammonia) to give the title compound as an off white solid (37.7 mg, 0.037 mmol, 48.6%; m/z 1027.4422, expected 1027.4416 for C52H66N8O10S2 [M+H]+).

Synthesis of R1-ICR-5: cyclohexyl (5-(2-(12-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-12-oxododecanamido)benzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate

Step 1: cyclohexyl (5-(2-aminobenzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate (0.4 g, 1.05 mmol), 12-(tert-butoxy)-12-oxododecanoic acid (0.31 g, 1.1 mmol) and TCFH (0.88 g, 3.14 mmol) was dissolved in DMF (10 mL) then diluted with acetonitrile (60 mL). 1-Methylimidazole (0.74 mL, 9.4 mmol) was then added and the resulting solution was stirred at 23 °C for 17 h. Volatiles were removed by evaporation under reduced pressure. The resulting mixture was quenched with water (20 mL) and precipitate collected via suction filtration. The solid was redissolved in DCM, dried, filtered and concentrated to yield tert-butyl 12-((6-(5-(((cyclohexyloxy)carbonyl)amino)-6-methylpyridin-3-yl)benzo[d]thiazol-2-yl)amino)-12-oxododecanoate (R1-ICR-5a, 680 mg, 100%, 1.05 mmol; m/z: 651.4).

Step 2: Trifluoroacetic acid (4 mL, 52 mmol) was added to a solution of R1-ICR-5a (680 mg, 1.05 mmol) in DCM (10mL) and the resulting solution was stirred at 23 °C for 1h then concentrated under reduced pressure to yield 12-((6-(5-(((cyclohexyloxy)carbonyl)amino)-6-methylpyridin-3-yl)benzo[d]thiazol-2-yl)amino)-12-oxododecanoic acid (R1-ICR-5b, 621 mg, 100%, 1.04 mmol; m/z: 595.3).

Step 3: HATU (1.19 g, 3.13 mmol) was added to a 0 °C solution of R1-ICR-5b (0.62 g, 1.04 mmol) and DIPEA (1.82 mL, 10.4 mmol) in DMF (10mL) and the resulting mixture was maintained at 0 °C. After 15 min (2S,4R)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (0.49 g, 1.15 mmol) was added and the resulting solution was stirred at 23 °C for 17 h, then cooled to 0 °C before water (50 mL) was added to precipitate the product. The white solid was collected via suction filtration and the filter cake was washed with water (3 × 50 mL), then dissolved in DCM, dried over magnesium sulfate, filtered and concentrated. Sequential purification using Isolute-NH2 column, reverse phase chromatography (C18, 40–100% methanol in water, 0.1% formic acid) then SCX column gave R1-ICR-5 as a white solid (887 mg, 83%, 0.87 mmol, m/z 1007.4894, expected 1007.4887 for C54H71N8O7S2 [M+H]+).

Synthesis of R1-ICR-6 [cyclohexyl (5-(2-(3-(3-(3-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-3-oxopropoxy)propoxy)propanamido)benzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate]

Step 1: To 3-(3-(3-ethoxy-3-oxopropoxy)propoxy)propanoic acid (33 mg, 0.13 mmol) in DMF (0.5 mL) was added sequentially DIPEA (35 μL, 0.20 mmol) then HATU (55 mg, 0.15 mmol). After 15 minutes cyclohexyl (5-(2-aminobenzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate (45 mg, 0.12 mmol) in DMF (0.7 mL) was added. The resulting mixture was stirred at room temperature for 5 days. Added water (0.5mL) and evaporated under reduced pressure at 50 °C, then purified by reverse-phase flash chromatography (C18, 70–100% methanol in water, 0.1% formic acid) to give 3-(3-(3-((6-(5-(((cyclohexyloxy)carbonyl)amino)-6-methylpyridin-3-yl)benzo[d]thiazol-2-yl)amino)-3-oxopropoxy)propoxy)propanoic acid (R1-ICR-6a, 13.6 mg, 20%, 0.0233 mmol; m/z 585.2375 expected 585.2377 for C29H37N4O7S [M+H]+)

Step 2: To a mixture of R1-ICR-6a (5 mg, 0.0086 mmol), (2S,4R)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide hydrochloride (4 mg, 0.0086 mmol) in DMF (0.3 mL) at 0 °C under nitrogen was added DIPEA (3 μL, 0.017 mmol) then COMU (4 mg, 0.0093 mmol) in DMF (0.2 mL). The mixture was stirred for 2 days at rt. Additional DIPEA (0.01 mL) and COMU (4 mg) was added and stirred for 3 hours then purified by reverse phase flash chromatography (C18, 10–100% methanol in water, 0.1% formic acid) to give R1-ICR-6 (4 mg, 47%, 0.004 mmol; m/z 997.4341 expected 997.4310 for C51H65N8O9S2 [M+H]+)

Synthesis of R1-ICR-7 [cyclohexyl (5-(2-((S)-16-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-17,17-dimethyl-14-oxo-3,6,9,12-tetraoxa-15-azaoctadecanamido)benzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate]

Step 1: To 3,6,9,12-tetraoxatetradecanedioic acid (120 mg, 0.45 mmol) in DMF (0.5 mL) was added sequentially DIPEA (35 μl, 0.20 mmol) then HATU (65 mg, 0.17 mmol). After 15 minutes cyclohexyl (5-(2-aminobenzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate (45 mg, 0.12 mmol) in DMF (0.7 mL) was added. The resulting mixture was stirred at room temperature for 5 days, and was then purified by reverse-phase flash chromatography (C18, 10–100% methanol in water, 0.1% formic acid) to give 14-((6-(5-(((cyclohexyloxy)carbonyl)amino)-6-methylpyridin-3-yl)benzo[d]thiazol-2-yl)amino)-14-oxo-3,6,9,12-tetraoxatetradecanoic acid (R1-ICR-7a, 21.5 mg, 29%, 0.0341 mmol, m/z 631.2434 expected 631.2432 for C30H39N4O9S [M+H]+).

Step 2: Starting from R1-ICR-7a (5.4mg, 0.0086 mmol), followed method used for synthesis of R1-ICR-6 to obtain R1-ICR-7 (5 mg, 56%, 0.0048 mmol; m/z 1043.4432 expected 1043.4370 for C52H67N8O11S2 [M+H]+.)

Synthesis of R1-ICR-5S [cyclohexyl (5-(2-(12-(((S)-1-((2S,4S)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-12-oxododecanamido)benzo[d]thiazol-6-yl)-2-methylpyridin-3-yl)carbamate]

Prepared from R1-ICR-5b (36 mg, 0.06 mmol) using the same method as for R1-ICR-5, except purified by HPLC (C18, 40–100% methanol in water, 0.1% formic acid) to obtain R1-ICR-5S (24 mg, 39%, 0.0236 mmol; m/z 1007.4899, expected 1007.4887 for C54H71N8O7S2 [M+H]+).

Generation of lentiviral particles

To generate lentiviral particles, HEK293T cells were transfected with packaging construct psPAX, pMD2.G and the relevant lentiviral plasmid employing the Effectene transfection kit (301427, Qiagen). Viral supernatants were harvested, passed through a 0.45 μm filter, concentrated with the Lenti-X concentrator (621231, Clontech Takara) and supplemented with Polybrene (10 μg/ml).

Constructs

SMART vector inducible lentiviral shRNAs targeting Trif (Also known as Ticam1, V3SM11253–235355483), Zbp1 (V3SM11253–235538171, Ripk1 (V3SM11253–237881699) and non-targeting (NT) shRNA control (VSC11502) were purchased from Dharmacon. Cells were infected and stable cells were selected with Puromycin (1 μg/ml). Mouse Flag-TRADD constructs were cloned into Dox-inducible lentiviral pTIBZ vector and pool of stable cells was generated after selection with Blasticidin (10 μg/ml). Mouse RIPK3 and RHIM domain mutant of RIPK3 were cloned into the lentiviral vector pTIBZ and stable cell lines were created after infection of transformed LF-Ripk3−/− and selection with Blasticidin (10 μg/ml). For generation of inducible Ripk1 deletion, immortalized MDFs-Ripk1fl/fl were infected with lentivirus expressing inducible CRE (pTIBZ-Cre) and stable clones were isolated after Blasticidin (10 μg/ml) selection. Human RIPK1ΔRHIMΔDD-HiBiT construct was generated by PCR and cloned in lentiviral vector (pTIPZ) and expressed under a Dox-inducible promoter. Stable HT1080 cells were isolated after infection and selection with Puromycin (1 μg/ml). Mouse cDNAs of Ripk1, Ripk3, Tradd, Trif (also known as ticam1) and Zbp1 were cloned in mammalian expression vector pcDNA3 with corresponding tags and sequence verified. Mouse RIPK3 was generated by coupled in vitro transcription/translation reactions using HeLa extracts following synthesis of a PCR fragment which included a 5’ T7 promoter, IRES and kozak sequence and a 3’ poly A tail according to the application notes of the manufacturer’s protocol (Thermofisher Inc.). For bacterial expression, mouse Flag-TRADD was cloned into pTYB1 vector (NEB).

CRISPR gene targeting

Guide RNAs were designed using crispr.mit.edu portal (sequence can be obtained upon request). sgRNA for mouse genes Mlkl, Tnfr1, Tradd and Ripk1 were cloned into pLC-GFP plasmid (plasmid expressing Cas9 and GFP, kind gift from B.C. Bornhauser). For targeting human Ripk1 gene, co-transfection was done with two plasmids, Cas9 plasmid (Addgene #48138) and plasmid expressing sgRNA for human Ripk1 (Invitrogen synthesis). Control cell lines were created by transfection with corresponding Cas9 expressing plasmids without sgRNA. Cells were transfected with electroporation and 72 h after, GFP positive cells were FACS sorted and single clones were screened for gene knockout by western blot for respective proteins. See Key resources table and Supplementary Table S3 for more information.

mTradd gRNA: CGCAACTGGACGATGAGCTG

mRipk1 gRNA: AGGGAACTATTCGCTGGTGA

hRipk1 gRNA: GCTCGGGCGCCATGTAGTAG

mMlkl gRNA: CTGGCAGCAGGAAGATCGAC

mTnfr1 gRNA: CGGACAGTCACTCACCAAGT

RNA interference

All siRNAs were purchased from Qiagen or Dharmacon (product information can be found in supplementary table S3). In brief, transfection of cells was performed in 96 or 384 well plates using RNAiMAX transfection reagent (Thermo Fisher Scientific). Cells were incubated with transfection mix for 18h and medium was replaced. All experiments were done between 48h-72h post transfection.

Bioluminescence-based RIPK1ΔRHIMΔDD-HiBiT degradation assay

Protein degradation parameters DC50 values (compound concentration at which 50% of RIPK1ΔRHIMΔDD-HiBiT protein is degraded) and Dmax (maximal degradation level relative to positive control R1-ICR-5) were determined in HT1080 cells (ATCC) stably expressing Dox-inducible RIPK1ΔRHIMΔDD-HiBiT in a bioluminescence-based assay. Compounds were dispensed in 384 well Cell Culture Microplates (Greiner catalogue 781091) using an ECHO550 acoustic dispenser (Beckman Coulter). HT1080-RIPK1ΔRHIMΔDD-HiBiT cells were subsequently plated on top of the compounds. Cells were incubated with compounds for 24 h at 37°C/10%CO2. RIPK1ΔRHIMΔDD-HiBiT was detected using the Nano-Glo HiBiT Lytic Detection Kit (Promega catalogue N3030) according to the manufacturer’s instructions. The % response at each concentration was calculated by normalizing RIPK1ΔRHIMΔDD-HiBiT expression in the presence of the compound to the appropriate high (DMSO) and low (1.5μM R1-ICR-5) controls. The compound DC50 and Dmax values were determined using Dotmatics (Bishops Stortford, UK) software by fitting the normalized data to a sigmoidal four-parameter logistic (removed “fit”) equation.

Immunofluorescence

Cytoplasmic RIP1 protein degradation parameters were quantified in an immunofluorescence-based assay using an Opera Phenix Plus High Content Imaging System (Perkin Elmer). Briefly, 40 μL of cells cultured in DMEM-10% FBS (Thermo Fisher Scientific) were plated in 384-well Phenoplates (Perkin Elmer) and treated with R1-ICR-5 or DMSO control. After 20 hours at 37°C/CO2 incubator, cells were fixed in 2% formaldehyde at room temperature for 15 mins, then washed in PBS (Phosphate Buffered Saline) using a Multidrop Combi (Thermo Fisher Scientific). Fixed cells were permeabilized for 15 mins at room temperature in 1xPBS/0.2% Triton X-100 (Thermo Fisher Scientific #28314), before 1hr blocking in PBS/0.5% BSA (Sigma Aldrich, A2153). After washing with PBS (Multidrop Combi), cells were incubated overnight at 4°C in PBS/BSA with anti-hRIPK1 (Cell Signaling Technology, #73271) or anti-mRIPK1 (Cell Signaling Technology, #3493) primary antibodies, in the presence of DAPI (Thermo Fisher Scientific, D3571) and Phalloidin-Alexa 633 (Thermo Fisher Scientific, A22284). After washing with PBS, cells were incubated for 1 h at room temperature in PBS/BSA plus donkey anti-rabbit Alexa 488 (Thermo Fisher Scientific, A21206). To visualize TRADD fibrillation, L929Dox-FlagTRADD cells were plated as described above, and protein was induced with 100ng/ml Dox 1h prior to treatment. TRADD was visualized using anti-DYKDDDDK tag (Cell Signaling Technology, #8146) and a Leica SP8 Point Scanning Confocal microscope equipped with a 63X objective. Quantification of TRADD aggregates was performed using Harmony High Content Imaging and Analysis software (Perkin Elmer).

Proximity ligation assay (PLA) and co-localisation assay

L929 Dox-Flag-TRADD cells were treated overnight with R1-ICR-5 (1 μM). The next day, cells were treated with Doxycycline (100 ng/ml) for 2h and TNF (10 ng/ml) for 30min. Cells were fixed with 2% paraformaldehyde (Santa Cruz, # sc-281692) for 20 min, permeabilized with 0.5 % Triton x-100 for 5 min and PLA was performed according to the manufacture’s protocol, using the NaveniFlex MR (Navinci Diagnostics AB, USA) kit. Primary antibodies against RIPK3 (Cell Signaling Technologies, D8J3L) and FLAG-tag (Cell Signaling Technologies, 8146) were used at a dilution of 1:500 and 1:1000 respectively, and cells were counter-stained with DAPI. Z-stacks of six to nine fields per well were acquired in the ImageXpress Micro Confocal (Molecular Devices) with an CFI Plan Fluor 40x (0.75NA) objective and analyzed with a custom module editor within MetaXpress (Molecular Devices). Each dot on the graph represents the total number of PLA foci (sum intensity projection of the FITC channel) divided by the total number of nuclei (maximum intensity projection of the DAPI channel) per field of a representative experiment of two independent repeats. Representative images of one experiment are shown as an overlay of the sum intensity projection obtained on the FITC channel and the maximum intensity projection obtained on the DAPI channel. Scale bars represent 20 μm.

Caspase activity and cell viability assays

Caspase activity was measured by DEVDase assay and was performed as previously described94. In brief, 1.0×104 cells were plated in 96-well plates and after treatment, medium was removed, and plates were placed at −80C for few hours. Next, 20μl of DISC lysis buffer was added to each well and after 20min on ice, 180μl of DEVDase assay mix (add info) was added. Plates were incubated at room temperature for several hours and DEVDase activity was read at 380nM excitation/460nM emission. Cell viability was measured by CellTiter-GLO assay (Promega) and was performed according to the manufacturer’s instructions. In brief, cells were plated in 96 well plates and treated with indicated conditions and cell survival was measured using Victor X plate reader (PerkinElmer). Drug concentrations used in both assays: Emricasan (5 μM), RIPK1 inhibitors PK68 or GSK’963 (100 nM), R1-ICR-5 (1 μM) SMAC mimetic (SM164, 100 nM) and TNF (10 ng/ml).

In vitro treatments (Cell death & signaling assays)

To measure cell death, cells were seeded in 96 well plates (#655090, Greiner) or 384 well plates (#781091, Greiner), before indicated treatments for specified times. Hoechst (0.5 μg/ml) and PI (1 μg/ml) were added and the % of dead cells was measured using the Celigo S Cell Imaging Cytometer (Nexcelom Bioscience). Cell death measurement of Naïve CD4+ and CD8+ T cells was performed as previously described93. Drug concentrations used: Cycloheximide (25 μg/mL), Doxycycline (100 ng/mL), Emricasan (1–5 μM), Enbrel (50 μg/mL), HOIPIN-8 (30 μM), mIFNβ/γ (100 ng/mL), hIFNβ (25 ng/mL), IKK2 inhibitor (TPCA-1, 250 nM), LPS (0.1–10 μg/mL), MK2 inhibitor (PF3644022, 250 nM), NIK1 inhibitor (NIK-SMI1, 1 μM), Poly(I:C) (10 μg/mL), P38 inhibitor (LY2228820, 250 nM), RIPK1 inhibitors (Nec1, PK68 and GSK’693: 100 nM), RIPK3 inhibitor (GSK’872, 10 μM), RIPK2 PROTAC (1 μM), R1-ICR-3 (1 μM), R1-ICR-5S (Non-VHL binder, 1 μM), R1-ICR-5 (Murine cells, 1 μM; Human cells, 200 nM), TAK1i (5Z-7-Oxozeaenol, 1 μM), TNFα (10 ng/mL), TPL2 inhibitor (Cot inhibitor-2, 1 μM), XIAP degrader-1 (10 μM), and zVAD (20 μM). To analyze TNFR1 and TLR3-induced inflammatory and necroptotic signaling, cells were seeded into 6-well plates overnight, before treatment and subsequent western blot or RT-qPCR analysis, as indicated. Drug concentrations used: Doxycycline (100 ng/mL), Emricasan (1 μM), Enbrel (50 μg/mL), MK2 inhibitor (PF3644022, 500 nM), SMAC mimetic (ASTX660, 1 μM), TNFα (10 ng/mL), Poly(I:C) (10 μg/mL), Riboxxol (10 μg/mL), hIFNβ (25 ng/mL), RIPK2 PROTAC (1 μM), R1-ICR-5 (Murine cells, 1 μM; Human cells, 200 nM).

In vitro irradiation

Cells were plated overnight before irradiation (AGO 250 kV X-ray machine, 1.62 Gy/min, single doses of 4 or 8 Gy). Enbrel (50μg/mL) was added 30 minutes before irradiation. R1-ICR-5 (1 μM) was added 24 hours after irradiation. Doxycycline (Dox)-inducible shNt, shTrif (Also known as Ticam1) and shZbp1-expressing EO771 cells were Dox-induced 36 h before irradiation. Cell death was measured 48 – 72 h after irradiation. To measure DNA damage by immunofluorescence, EO771 cells (2 × 103) were seeded overnight in a 96 well plate (#655090, Greiner) and subjected to single doses of irradiation, as indicated. After 30 minutes, cells were washed (PBS) and fixed (4% paraformaldehyde, 10 minutes). Cells were washed three times (PBS), incubated for 1 hour with blocking solution (0.3% Triton X100, 5% normal goat serum, 1% BSA in PBS) and then with α-γ-H2AX overnight at 4°C. Cells were washed three times with PBS and incubated with the α-rabbit secondary antibody and DAPI for 1 hour at room temperature. Cells were washed and imaged by a Zeiss 710 confocal microscope (Zeiss 40X objective). The average γ-H2AX intensity per nucleus was quantified by Fiji software. For bulk RNA-seq, EO771 cells were seeded overnight before exposure to a single fraction of 8 Gy. 48 hours later, total RNA was extracted using RNeasy kit (Qiagen).

RT-qPCR

RNA was extracted from cells using RNeasy (Qiagen) and converted to cDNA using QuantiTec Reverse Transcription Kit (Qiagen), according to manufacturer’s instructions. RT-qPCR and data analysis was performed as previously described95. For EO771 cells, mRNA was extracted 48 h after irradiation (0, 8 Gy). The relative mRNA expression of indicated genes was measured using Taqman probes (See Key resources table and supplementary table S3 for more details).

Mass Spectrometry

Sample preparation and TMT labelling - For total proteome analysis, U937 cells were treated with DMSO or R1-ICR-3 (100nM) for 6 h by trypsin digestion and TMTpro 15-plex labelling96. For total proteome analysis of BMDMs, cells were treated with DMSO or R1-ICR-05 (1μM) for 5 h. Cell lysates were digested97 and peptides were labelled with TMTpro 12-plex according to manufacturer’s instructions. Basic reverse-phase peptide fractionation and LC-MS analysis - The TMTpro labelled peptides were fractionated with high-pH Reversed-Phase (RP) chromatography using the XBridge C18 column (2.1 × 150 mm, 3.5 μm, Waters) on a Dionex UltiMate 3000 HPLC system. LC-MS analysis was performed on a Dionex UltiMate 3000 UHPLC system coupled with the Orbitrap Lumos Mass Spectrometer (Thermo Fisher Scientific). Peptides were loaded onto the Acclaim PepMap 100, 100 μm × 2 cm C18, 5 μm, trapping column at flow rate 10 μL/min and analyzed with an Acclaim PepMap (75 μm × 50 cm, 2 μm, 100 Å) C18 capillary column connected to a stainless-steel emitter on an EASY-Spray source via a PSS2 adapter (MSWIL). Mobile phase A was 0.1% formic acid and mobile phase B was 80% acetonitrile, 0.1% formic acid. For total proteome analyses, a 95 min gradient 5%-38% B was used. MS scans were acquired in the range of 375–1,500 m/z with mass resolution of 120K, AGC 4×105 and max IT 50 ms. Precursors were selected with the top speed mode in 3 sec cycles and isolated for HCD fragmentation with quadrupole isolation width 0.9 Th (IMAC) or 0.7 Th, collision energy at 36% at 50K or 30K resolution. Targeted precursors were dynamically excluded for further fragmentation for 30 seconds or 45 sec with 7 ppm mass tolerance. Database search and protein quantification - The mass spectra were analyzed in Proteome Discoverer 2.4 (Thermo Scientific) with the SequestHT search engine for peptide identification and quantification. The precursor and fragment ion mass tolerances were 20 ppm and 0.02 Da respectively. Spectra were searched for fully tryptic peptides with maximum 2 missed cleavages. TMTpro at N-terminus/K and Carbamidomethyl at C were selected as static modifications. Spectra were searched against reviewed UniProt Mus musculus (BMDMs) or Homo Sapiens (U937 cells) protein entries, peptide confidence was estimated with the Percolator node and peptides were filtered at q-value<0.01 based on target-decoy database search. The reporter ion quantifier node included a TMTpro quantification method with an integration window tolerance of 15 ppm. Only peptides with average reporter signal-to-noise>3 were used for quantification. Differential protein expression analysis was performed using the R package limma (v3.50.1), R version 4.1.0.

Purification of TNFR1 complex I & II

The composition of TNFR1 signaling complex I and -II was analysed as previously described98,99. In short, complex I was purified from cells using FLAG-hTNF (800 ng/mL) or STREP-hTNF (1 μg/mL). Cells were lysed in DISC buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 10% glycerol) supplemented with cOmplete protease (Roche) and phosSTOP phosphatase (Sigma) inhibitors, and PR619 DUB inhibitor (2B Scientific, 10 μM). Lysates were harvested and clarified by rotating (20 minutes) then centrifuging (15 minutes, 14,000 rpm) at 4 °C. Untreated control samples were treated with 800ng/mL 3xFLAG-TNF or 1 μg/mL 2xSTREP-TNF, post-lysis. Complex I was purified overnight, by incubating lysates with anti-FLAG M2 (Sigma) or Strep-Tactin (IBA lifesciences) beads. Immunocomplexes were washed with DISC buffer supplemented with PR619 (10 μM), before eluting with 1X SDS sample buffer. For USP2 digestion, after the final wash, beads were additionally washed with DUB reaction buffer (50mM Tris pH 7.5 and 150nM NaCl). 20 μL DUB reaction buffer (50mM Tris pH 7.5 and 150nM NaCl) + 5mM DTT + 2uM USP2) was added to the dried beads and digestion was performed for 1 h at 37°C. Complex II was purified from cell lines harbouring a Dox-inducible FLAG-TRADD transgene, which was induced (L929Dox-Flag-TRADD, 1h; EO771Dox-Flag-TRADD, 2 h) before TE treatment (L929Dox-Flag-TRADD, 1h; EO771Dox-Flag-TRADD, 2 h). Complex II was purified from cell lysates, with anti-FLAG M2 beads (Sigma) overnight at 4°C, before washing with lysis buffer supplemented with PR619 DUB inhibitor (10 μM) and eluting with SDS sample buffer. Samples were analysed by SDS-PAGE.

Ubiquitin pulldown (TUBE assay)

Stimulation-induced ubiquitylation of indicated proteins was assessed by total ubiquitin pulldown, using GST-TUBE (Tandem Ubiquitin Binding Entities), as previously described73. In brief, after treatments cells were washed with ice cold PBS and lysed with DISC lysis buffer (50mM Tris pH 7.8, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 10% glycerol) supplemented protease and phosphatase inhibitors (as in complex-I/II), 1 mM DTT, PR619 (10 μM) and GST-TUBE (50 μg/ml; 50 μg TUBE/mg protein lysate). Lysates were cleared by centrifugation (4°C, 16000 g, 15 min) and immunocomplexes were purified by overnight rotation at 4 °C, in the presence of 20μL GSH beads (Sigma). Beads were washed four times with TUBE wash buffer (PBS and 1% Triton X-100) supplemented with PR619 (10 μM). To visualize higher order proteins, beads were split in two prior to elution, and incubated with either reducing or non-reducing sample buffer (with or without β-mercaptoethanol, respectively) to enable higher order oligomers to be visualised, by SDS-PAGE.

Immunoprecipitation and immunoblot analysis

Co-purification was conducted as previously described100. In brief, cells were lysed in 1% Triton lysis buffer (50mM Tris pH7.5, 150mM NaCl, 1% Triton X-100 and protease/phosphate inhibitors (Roche). Lysates were centrifuged (16000 g, 20 min) and supernatants were incubated with either α-HA or α-FLAG beads (SIGMA). Subsequently, beads were washed three times with IPPG150 wash buffer (0.1% Triton X-100, 50 mM Tris pH 7.5, 150 mM NaCl,). Beads were boiled in Laemmli buffer for 10 min and proteins were resolved by SDS-PAGE.

In vitro binding assay

N-terminal FLAG-tagged murine TRADD was amplified by PCR using pcDNA3-FLAG-mTradd as a template and subcloned in frame with chitin binding protein using the NdeI and EcoRI sites of pTYB1 (New England BioLabs Inc.). Transformed E. Coli BL21(DE3) cells were induced overnight at 15°C with 0.1 mM IPTG to express FLAG-mTRADD-CBP fusion protein. FLAG-mTRADD was subsequently isolated by sequential purification using FLAG (M2) agarose and chitin beads followed by Intein-mediated cleavage/elution with Intein Lysis Buffer containing 50 mM DTT. Protein purity was assessed by silver staining and identity confirmed by immunoblotting with both FLAG (M2) mAb and TRADD antibodies (Cell Signaling Technology). mRIPK3 was generated by coupled in vitro transcription/translation reactions using HeLa extracts following synthesis of a PCR fragment which included a 5’ T7 promoter, IRES and kozak sequence and a 3’ poly A tail according to the application notes of the manufacturer’s protocol (Thermofisher Inc.). Purified FLAG-mTRADD and mRIPK3 were incubated with either anti-FLAG (M2) conjugated agarose or alternatively, anti-RIPK3 (Cat # 15828, Cell Signaling Technology) and Protein G dynabeads in 30 mM TrisHCl, pH7.4, 150 mM NaCl, 10% glycerol, 1 % Triton X-100 overnight at 4°C. Beads were washed with 4 × 1 ml buffer and aliquots resolved on 10 % precast TGX gels (Bio-Rad Inc.). Immunoblotting was performed using FLAG (F3165) mAb and rabbit anti-RIPK3 (Cat # 15828, Cell Signaling Technology) combined with either anti-mouse-HRP (veriblot ab131368, Abcam) or clean-blot IP detection reagent (#21230, Thermofisher) respectively. See supplementary Table S3 for primers used in PCR reactions.

Size exclusion chromatography

FLAG-mTRADD (50 ml) expressed and purified from E. Coli as described was resolved on a Superdex 200 increase 3.2/300 size-exclusion column in 30 mM TrisHCl, pH7.4, 150 mM NaCl, 10 % glycerol, 1% (w/v) Triton X-100 using an AKTA Pure protein purification system (Cytiva) and 100 ml fractions collected, essentially as described previously101. Aliquots from the indicated fractions, denatured in Laemmli sample buffer, were resolved on 18-well Criterion TGX gels and immunoblotted with FLAG (M2) mAb. The column was calibrated using a high molecular weight gel filtration calibration kit (Cytiva # 28403842).

Western blot analysis

Western blot analyses were performed as previously described73. Briefly, cells were lysed with DISC lysis buffer (1 M Tris pH 7.8, 5 M NaCl, 0.5 M EDTA, 40% Glycerol and 1% Triton X-100) supplemented with protease inhibitor cocktail and phosphatase inhibitors before clearing by centrifugation and quantification by Pierce BCA protein assay kit (ThermoFisher). Whole cell lysates were harvested with 1X SDS sample buffer (6x sample buffer: 3 ml 20% SDS, 4 ml 100% glycerol, 3 ml β-ME and 1 g bromophenol blue). To assess RIPK1 depletion in vivo, tumor and skin samples were collected 24 h after intra-tumoral or subcutaneous injection. Single cell suspensions were prepared from tumors as described below and from skin by homogenization, using 2.4mm bead mill tubes (ThermoFisher) and the Precellys evolution tissue homogenizer (Bertin Technologies). Lysates and homogenates were collected with RIPA buffer (10mM Tris(-HCL) pH8, 1mM EDTA, 0.5 mM EGTA, 1 % Triton, 0.1 % Sodium deoxycholate, 0.1 % SDS & 140 nM NaCl) + HALT protease & phosphatase inhibitor cocktail (ThermoFisher) before centrifugation (20000 xg, 20 mins at 4°C). All samples were boiled with Laemmli buffer (100°C, 10 min), then resolved by SDS-PAGE (NuPAGE Novex 4–12% Bis-Tris 1.0 mm gels in MOPS buffer (ThermoFisher)), transferred onto polyvinylidene difluoride (PVDF) membranes, blocked (5% BSA or milk in TBST) and probed with indicated antibodies (See key resource table). All primary antibodies were diluted in 5% BSA-TBST + 0.01% NaN3 and secondary antibodies diluted 1:10000 in 5 % non-fat milk-TBST. Densitometry was performed using ImageJ software.

Flow cytometry

Mammary tumors were harvested in ice-cold PBS from mice 13 days after irradiation. Tumors were mechanically dissociated with scissors and enzymatically digested (30 min, 37°C), in PBS containing Trypsin-Versene, 1 mg/ml collagenase type VI (Sigma-Aldrich), 100 μg/ml dispase (Sigma-Aldrich), 1 mg/ml DNase type I (Roche). Tumor suspensions were passed through a cell strainer (70 μm) into PBS (2% FBS & 2 mM EDTA), before centrifugation (1200 rpm, 5 min, 4°C). Pellets were resuspended in PBS-FBS 2% + Fc block (CD16/CD32) for 10 min (4°C), before surface staining (30 min, 4°C). To detect intracellular cytokines and surface CD107a, cells were restimulated in IMDM containing Golgi Plug (BD Biosciences), 100 ng/ml PMA (Thermo Fisher Scientific) and 1 μg/ml ionomycin (Thermo Fisher Scientific) ( 4 h at 37°C). After, cells were fixed by IC fixation buffer (Thermo Fisher Scientific), permeabilised with permeabilization buffer (Thermo Fisher Scientific) and stained with α-IFN-γ, α-TNFα, α-Granzyme B, α-Foxp3 and α-Ki67 antibodies. Flow cytometric analyses were carried out with the LSR II FACSymphony A5 (BD Biosciences) with FACSDiva software. Data were analysed with FlowJo V.10 software. The full list of antibodies used in this study can be found in the key resources table.

In vivo tumor treatments

For tumor treatments, 5 – 6 weeks old female C57BL/6J mice were purchased from Charles River and were enrolled in the study post an acclimatization period of at least one week. Mice were injected in the 4th right mammary fat pad with 1×105 EO771 cells in RPMI supplemented with 10% FBS, 5 mM Hepes, penicillin/streptomycin, and containing 50% Matrigel matrix (Corning). Tumor growth was monitored twice a week using a digital caliper, and volumes (0.52 × length × width × width) were expressed in mm3. Mice were culled before the average tumor size reached 15 mm. Tumor treatment was started when tumors reached an average of 50 – 100 mm3. Tumors were irradiated with the Small Animal Radiotherapy Research Platform (SARRP, Xstrahl), employing a parallel opposed beam arrangement with a 10 mm × 10 mm collimator for each beam. In all experiments, beams were equally weighted, and the radiation dosage was 4 or 8 Gy, administered in a single fraction. R1-ICR-5 was solubilized in captisol (Ligand’s Pharmaceutical) and administered by intra-tumoral injection (40 μg/injection) at indicated intervals (See Fig. 6,7 and Suppl. Fig. S6). Anti-IgG2a, anti-CTLA-4 and anti-PD-1 antibodies were injected intraperitoneally (200μg) at indicated intervals (See Fig. 6 & 7). (Sourced from 2B Scientific, see key resources table). Response rates of treated mice were classified as complete response (tumor free for at least 2 months), partial response (tumor volume drops to <100 mm3) and progression (no response to treatment). P values were calculated using the Chi-square test, comparing progression (those that progressed after treatment) against response (those that showed both complete and partial responses to treatment). To assess immune memory, mice that were tumor free for at least two months (cured mice) were re-challenged together with naïve mice by injecting EO771 in the 4th left mammary fat pad, as described above. To measure RIPK1 depletion by WB (24h after a single injection) and IHC analysis, R1-ICR-5 was injected intra-tumorally on days 0, 2, 4 and 6 and samples were collected 24 hours post final injection. To measure CASP3 cleavage by IHC, EO771 tumors were irradiated and treated with R1-ICR-5 every 3 days as described above. Tumors were harvested 13 days after irradiation and fixed before staining.

Chemical and genetic skin inflammation models

The skin injection experiments were performed as previously described73. Briefly, mice were injected subcutaneously in the flank with 100 μL of SM (ASTX660, 3 mM) and E (Emricasan, 1 mM) or TNF (1 μg) and TBK1i (MRT67307, 150 μg), combined with R1-ICR-3 (10 mM), R1-ICR-5 (10 mM) or vehicle. Mice were culled 3 days after the injection and the regions of injections were macroscopically assessed. Hair removal cream was used to remove the fur in the lesion area before taking a skin biopsy. Biopsies were processed as previously reported73. Genetically induced skin inflammation models employed UBC-CreRTT2 mice to locally induce loss of Casp8fl/fl, Ripk1fl/fl or Casp8fl/fl/Ripk1fl/fl on the nape, by topical treatment with 4-OHT (250 μg per dose) on d0 and d3. Skin biopsies were harvested on d23 and were processed and analyzed as below.

Immunohistochemistry

For IHC analyses, staining was carried on the Dako Autostainer Link48 platform (Agilent Technologies) with epitope retrieval carried out using the Dako PT Link module at 97°c for 20 minutes using Dako Target Retrieval Solution pH9 (Agilent, K800421–2) for RIPK1 and TRS pH6 (Agilent, K800521–2) for cleaved CASP3, according to manufacturer's instructions. Endogenous peroxidases were blocked using Dako REAL peroxidase block (Agilent, S202386–2) then primary antibody RIPK1 (D94C12, Cell Signaling #3493) was diluted 1/50 and applied (60min at room temperature and detected using Dako rabbit EnVision polymer-HRP (Agilent,K400311–2)). The reaction was visualized using Dako DAB+ (Agilent, K346811–2) and nuclei counterstained using Dako FLEX haematoxylin (Agilent, K800821–2) according to manufacturer's instructions. CASP 3 cleavage was measured with anti-Cleaved Caspase 3 (ASP175) primary antibody (Cell Signaling #9664, clone 5A1E, 1/100 dilution). Detection using Rabbit ImmPRESS polymer-HRP (Vector Laboratories, MP-7401–50).

Quantification and statistical analysis

Survival analyses

For TCGA patient data analysis, RIPK1 DNA copy number and RNA-seq data from ACC, BRCA, CESC, STAD, LIHC, LUSC, SKCM, SARC, and UCEC patients of TCGA were downloaded from cBioPortal (https://www.cbioportal.org/). To analyse the SCAN-B patient data, we obtained RNA-sequencing and patient survival data from the GEO database using the accession ID GSE96058. The R package org.Hs.eg.db (v3.7.0) was utilized to map HGNC gene symbols to EntrezIDs. Survival differences among groups were evaluated using the Kaplan-Meier method, and the p-value was determined using the log-rank test, using the R package survival (v3.5.5).

Gene set enrichment analyses (GSEA)

Using the ConsensusTME R package (v0.0.1.9000) on the SCAN-B dataset, patient groups were categorized by assessing the expression differences of RIPK1 and the levels of NK cell infiltration. Gene Set Enrichment Analysis (GSEA)102 was then carried out on these groups to investigate the differential expression of immune response gene sets. These gene sets were obtained from the hallmark gene set collection of The Molecular Signatures Database (MSigDB)103.

Bulk RNA-seq analysis

Total RNA sequencing was performed by Azenta (Genewiz), employing Illumina NovaSeq, 2 × 150 base pairs as sequencing configuration. Samples and genes were clustered using agglomerative hierarchical clustering with '1-Pearson correlation coefficienť as distance measure followed by complete-linkage clustering.

Histopathological assessment of murine skin samples

Histopathological sample analysis was carried out as previously described73. Skin sections were scanned at x40 (0.23 μm/pixel) using a NanoZoomer-XR Hamamatsu Photonics (Japan). The analysis of digitized skin samples involved assessment of the vicissitudes in epidermal and dermal region of the skin identifiable on haematoxylin and eosin (H&E) stained samples. First, a Histopathological (multivariate) Lesion Score (HLS) was used to assess the proportion and severity of histopathological changes. This assessment was performed on the entire length of the skin sample (epidermal and immediate dermal level). To increase precision of the assessment, each sample was divided using a grid with equal size of fields of view (FOV) (0.04mm2/800μm perimeter). Each FOV was assessed for presence of regular epidermis or any pathological changes to regular epidermis and dermis. A final calculation took into account the proportion [%] of given skin lesions within each sample, multiplied by a power score ranging from 0 to 4. Score 0 was associated with regular epidermis with no changes to any of the strata. Score 1 with thickening of the epidermis represented by any of the strata. Score 2 with epidermal erosion (partial loss of the epidermis), with the stratum basale left intact. Score 3 with ulcer-loss of epidermis, including the stratum basale. Score 4 with deep ulceration of the epidermis and subepidermal dermis. The final score (HLS) indicates the severity following the formula: [(0x % Score 0) + (1× % Score 1) + (2× % Score 2) + (3× % Score 3) + (4x % Score 4)]. The lowest possible HLS is ‘0’ which is equal to 100% of normal/regular epidermis in the whole sample, and a maximum HLS of ‘400’ equal to 100% of deep ulceration.

Statistical analysis

Graphs and statistical analyses were generated and performed using GraphPad Prism V9.4.1. The statistical analysis performed for each data set is described in the corresponding figure legend. Error bars indicate standard deviation (SD). No data were excluded.

Supplementary Material

1

Highlights.

  • RIPK1’s scaffolding function protects cancer cells from immune detection and death

  • RIPK1-specific PROTAC degraders enhance innate immune signalling and necroptosis

  • RIPK1 PROTACs boost the immunostimulatory and anti-tumour effects of RT and ICB

  • PROTAC-mediated RIPK1 depletion suppresses skin inflammation

Acknowledgements

The authors are indebted to Clare Isacke, John Silke, Henning Walczak, Geert van Loo, Ulrich Maurer, B.C. Bornhauser, John Caldwell, Angela Hayes, Kai Betteridge, Queenie Lai, Ross Scrimgeour, Jin Wang, Daniel Glynn, Philip Clarke, James Krupa, Tom Pesnot, Peter John-Baptiste, Steven Lumbard and the ICR Flow cytometry core facility, who provided support and helpful discussions. Zbp1−/−, Trif−/− and Trif−/−Zbp1−/− BMDMs and LF were kind gifts from Manolis Pasparakis. The Guo lab is supported by NIH-R21-R21AI175590. The Meier lab is funded by Breast Cancer Now (CTR-QR14–007) and CRUK (C26866/A24399 and CRM089X). We acknowledge NHS funding to the NIHR Biomedical Research Centre.

Footnotes

Declaration of interests

The authors declare no competing interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Medzhitov R (2008). Origin and physiological roles of inflammation. Nature 454, 428–435. 10.1038/nature07201. [DOI] [PubMed] [Google Scholar]
  • 2.Pasparakis M, and Vandenabeele P (2015). Necroptosis and its role in inflammation. Nature 517, 311–320. 10.1038/nature14191. [DOI] [PubMed] [Google Scholar]
  • 3.Rothlin CV, and Ghosh S (2020). Lifting the innate immune barriers to antitumor immunity. J Immunother Cancer 8. 10.1136/jitc-2020-000695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Orozco S, Yatim N, Werner MR, Tran H, Gunja SY, Tait SW, Albert ML, Green DR, and Oberst A (2014). RIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis. Cell Death Differ 21, 1511–1521. 10.1038/cdd.2014.76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Weinlich R, and Green DR (2014). The two faces of receptor interacting protein kinase-1. Mol Cell 56, 469–480. 10.1016/j.molcel.2014.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Legrand AJ, Konstantinou M, Goode EF, and Meier P (2019). The Diversification of Cell Death and Immunity: Memento Mori. Mol Cell 76, 232–242. 10.1016/j.molcel.2019.09.006. [DOI] [PubMed] [Google Scholar]
  • 7.Peltzer N, and Walczak H (2019). Cell Death and Inflammation - A Vital but Dangerous Liaison. Trends Immunol 40, 387–402. 10.1016/j.it.2019.03.006. [DOI] [PubMed] [Google Scholar]
  • 8.Yatim N, Cullen S, and Albert ML (2017). Dying cells actively regulate adaptive immune responses. Nat Rev Immunol 17, 262–275. 10.1038/nri.2017.9. [DOI] [PubMed] [Google Scholar]
  • 9.Liu L, and Lalaoui N (2021). 25 years of research put RIPK1 in the clinic. Seminars in cell & developmental biology 109, 86–95. 10.1016/j.semcdb.2020.08.007. [DOI] [PubMed] [Google Scholar]
  • 10.Dannappel M, Vlantis K, Kumari S, Polykratis A, Kim C, Wachsmuth L, Eftychi C, Lin J, Corona T, Hermance N, et al. (2014). RIPK1 maintains epithelial homeostasis by inhibiting apoptosis and necroptosis. Nature. 10.1038/nature13608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dillon CP, Weinlich R, Rodriguez DA, Cripps JG, Quarato G, Gurung P, Verbist KC, Brewer TL, Llambi F, Gong YN, et al. (2014). RIPK1 blocks early postnatal lethality mediated by caspase-8 and RIPK3. Cell 157, 1189–1202. 10.1016/j.cell.2014.04.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kelliher MA, Grimm S, Ishida Y, Kuo F, Stanger BZ, and Leder P (1998). The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity. 8, 297. [DOI] [PubMed] [Google Scholar]
  • 13.Rickard JA, O'Donnell JA, Evans JM, Lalaoui N, Poh AR, Rogers T, Vince JE, Lawlor KE, Ninnis RL, Anderton H, et al. (2014). RIPK1 regulates RIPK3-MLKL-driven systemic inflammation and emergency hematopoiesis. Cell 157, 1175–1188. 10.1016/j.cell.2014.04.019. [DOI] [PubMed] [Google Scholar]
  • 14.Takahashi N, Vereecke L, Bertrand MJ, Duprez L, Berger SB, Divert T, Goncalves A, Sze M, Gilbert B, Kourula S, et al. (2014). RIPK1 ensures intestinal homeostasis by protecting the epithelium against apoptosis. Nature 513, 95–99. 10.1038/nature13706. [DOI] [PubMed] [Google Scholar]
  • 15.Lin J, Kumari S, Kim C, Van TM, Wachsmuth L, Polykratis A, and Pasparakis M (2016). RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature 540, 124–128. 10.1038/nature20558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Newton K, Wickliffe KE, Maltzman A, Dugger DL, Strasser A, Pham VC, Lill JR, Roose-Girma M, Warming S, Solon M, et al. (2016). RIPK1 inhibits ZBP1-driven necroptosis during development. Nature 540, 129–133. 10.1038/nature20559. [DOI] [PubMed] [Google Scholar]
  • 17.Berger SB, Kasparcova V, Hoffman S, Swift B, Dare L, Schaeffer M, Capriotti C, Cook M, Finger J, Hughes-Earle A, et al. (2014). Cutting Edge: RIP1 kinase activity is dispensable for normal development but is a key regulator of inflammation in SHARPIN-deficient mice. J Immunol 192, 5476–5480. 10.4049/jimmunol.1400499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kondylis V, Polykratis A, Ehlken H, Ochoa-Callejero L, Straub BK, Krishna-Subramanian S, Van TM, Curth HM, Heise N, Weih F, et al. (2015). NEMO Prevents Steatohepatitis and Hepatocellular Carcinoma by Inhibiting RIPK1 Kinase Activity-Mediated Hepatocyte Apoptosis. Cancer Cell 28, 830. 10.1016/j.ccell.2015.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Vlantis K, Wullaert A, Polykratis A, Kondylis V, Dannappel M, Schwarzer R, Welz P, Corona T, Walczak H, Weih F, et al. (2016). NEMO Prevents RIP Kinase 1-Mediated Epithelial Cell Death and Chronic Intestinal Inflammation by NF-kappaB-Dependent and -Independent Functions. Immunity 44, 553–567. 10.1016/j.immuni.2016.02.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Duprez L, Takahashi N, Van Hauwermeiren F, Vandendriessche B, Goossens V, Vanden Berghe T, Declercq W, Libert C, Cauwels A, and Vandenabeele P (2011). RIP kinase-dependent necrosis drives lethal systemic inflammatory response syndrome. Immunity 35, 908–918. S1074–7613(11)00508–5 [pii] 10.1016/j.immuni.2011.09.020. [DOI] [PubMed] [Google Scholar]
  • 21.Polykratis A, Martens A, Eren RO, Shirasaki Y, Yamagishi M, Yamaguchi Y, Uemura S, Miura M, Holzmann B, Kollias G, et al. (2019). A20 prevents inflammasome-dependent arthritis by inhibiting macrophage necroptosis through its ZnF7 ubiquitin-binding domain. Nat Cell Biol 21, 731–742. 10.1038/s41556-019-0324-3. [DOI] [PubMed] [Google Scholar]
  • 22.van Loo G, and Bertrand MJM (2022). Death by TNF: a road to inflammation. Nat Rev Immunol, 1–15. 10.1038/s41577-022-00792-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Annibaldi A, and Meier P (2018). Checkpoints in TNF-Induced Cell Death: Implications in Inflammation and Cancer. Trends Mol Med 24, 49–65. 10.1016/j.molmed.2017.11.002. [DOI] [PubMed] [Google Scholar]
  • 24.Mifflin L, Ofengeim D, and Yuan J (2020). Receptor-interacting protein kinase 1 (RIPK1) as a therapeutic target. Nat Rev Drug Discov 19, 553–571. 10.1038/s41573-020-0071-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cucolo L, Chen Q, Qiu J, Yu Y, Klapholz M, Budinich KA, Zhang Z, Shao Y, Brodsky IE, Jordan MS, et al. (2022). The interferon-stimulated gene RIPK1 regulates cancer cell intrinsic and extrinsic resistance to immune checkpoint blockade. Immunity 55, 671–685 e610. 10.1016/j.immuni.2022.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kondylis V, Kumari S, Vlantis K, and Pasparakis M (2017). The interplay of IKK, NF-kappaB and RIPK1 signaling in the regulation of cell death, tissue homeostasis and inflammation. Immunol Rev 277, 113–127. 10.1111/imr.12550. [DOI] [PubMed] [Google Scholar]
  • 27.Bertrand MJ, and Vandenabeele P (2010). RIP1's function in NF-kappaB activation: from master actor to onlooker. Cell Death Differ 17, 379–380. 10.1038/cdd.2009.213. [DOI] [PubMed] [Google Scholar]
  • 28.Xia Y, Shen S, and Verma IM (2014). NF-kappaB, an active player in human cancers. Cancer Immunol Res 2, 823–830. 10.1158/2326-6066.CIR-14-0112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Betzler AC, Theodoraki MN, Schuler PJ, Doscher J, Laban S, Hoffmann TK, and Brunner C (2020). NF-kappaB and Its Role in Checkpoint Control. Int J Mol Sci 21. 10.3390/ijms21113949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Smyth P, Sessler T, Scott CJ, and Longley DB (2020). FLIP(L): the pseudo-caspase. FEBS J 287, 4246–4260. 10.1111/febs.15260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Newton K, Wickliffe KE, Dugger DL, Maltzman A, Roose-Girma M, Dohse M, Komuves L, Webster JD, and Dixit VM (2019). Cleavage of RIPK1 by caspase-8 is crucial for limiting apoptosis and necroptosis. Nature 574, 428–431. 10.1038/s41586-019-1548-x. [DOI] [PubMed] [Google Scholar]
  • 32.Oberst A, Dillon CP, Weinlich R, McCormick LL, Fitzgerald P, Pop C, Hakem R, Salvesen GS, and Green DR (2011). Catalytic activity of the caspase-8-FLIP(L) complex inhibits RIPK3-dependent necrosis. Nature 471, 363–367. 10.1038/nature09852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.O'Donnell MA, Perez-Jimenez E, Oberst A, Ng A, Massoumi R, Xavier R, Green DR, and Ting AT (2011). Caspase 8 inhibits programmed necrosis by processing CYLD. Nat Cell Biol 13, 1437–1442. ncb2362 [pii] 10.1038/ncb2362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tummers B, Mari L, Guy CS, Heckmann BL, Rodriguez DA, Ruhl S, Moretti J, Crawford JC, Fitzgerald P, Kanneganti TD, et al. (2020). Caspase-8-Dependent Inflammatory Responses Are Controlled by Its Adaptor, FADD, and Necroptosis. Immunity 52, 994–1006 e1008. 10.1016/j.immuni.2020.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tao P, Sun J, Wu Z, Wang S, Wang J, Li W, Pan H, Bai R, Zhang J, Wang Y, et al. (2020). A dominant autoinflammatory disease caused by non-cleavable variants of RIPK1. Nature 577, 109–114. 10.1038/s41586-019-1830-y. [DOI] [PubMed] [Google Scholar]
  • 36.Schwarzer R, Jiao H, Wachsmuth L, Tresch A, and Pasparakis M (2020). FADD and Caspase-8 Regulate Gut Homeostasis and Inflammation by Controlling MLKL- and GSDMD-Mediated Death of Intestinal Epithelial Cells. Immunity 52, 978–993 e976. 10.1016/j.immuni.2020.04.002. [DOI] [PubMed] [Google Scholar]
  • 37.Laurien L, Nagata M, Schunke H, Delanghe T, Wiederstein JL, Kumari S, Schwarzer R, Corona T, Kruger M, Bertrand MJM, et al. (2020). Autophosphorylation at serine 166 regulates RIP kinase 1-mediated cell death and inflammation. Nature communications 11, 1747. 10.1038/s41467-020-15466-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lalaoui N, Boyden SE, Oda H, Wood GM, Stone DL, Chau D, Liu L, Stoffels M, Kratina T, Lawlor KE, et al. (2020). Mutations that prevent caspase cleavage of RIPK1 cause autoinflammatory disease. Nature 577, 103–108. 10.1038/s41586-019-1828-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Jiao H, Wachsmuth L, Kumari S, Schwarzer R, Lin J, Eren RO, Fisher A, Lane R, Young GR, Kassiotis G, et al. (2020). Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation. Nature 580, 391–395. 10.1038/s41586-020-2129-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Priem D, Devos M, Druwe S, Martens A, Slowicka K, Ting AT, Pasparakis M, Declercq W, Vandenabeele P, van Loo G, and Bertrand MJM (2019). A20 protects cells from TNF-induced apoptosis through linear ubiquitin-dependent and -independent mechanisms. Cell Death Dis 10, 692. 10.1038/s41419-019-1937-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kondylis V, and Pasparakis M (2019). RIP Kinases in Liver Cell Death, Inflammation and Cancer. Trends Mol Med 25, 47–63. 10.1016/j.molmed.2018.10.007. [DOI] [PubMed] [Google Scholar]
  • 42.Cuchet-Lourenco D, Eletto D, Wu C, Plagnol V, Papapietro O, Curtis J, Ceron-Gutierrez L, Bacon CM, Hackett S, Alsaleem B, et al. (2018). Biallelic RIPK1 mutations in humans cause severe immunodeficiency, arthritis, and intestinal inflammation. Science 361, 810–813. 10.1126/science.aar2641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Vlantis K, Wullaert A, Polykratis A, Kondylis V, Dannappel M, Schwarzer R, Welz P, Corona T, Walczak H, Weih F, et al. (2016). NEMO Prevents RIP Kinase 1-Mediated Epithelial Cell Death and Chronic Intestinal Inflammation by NF-kappaB-Dependent and -Independent Functions. Immunity 44, 553–567. 10.1016/j.immuni.2016.02.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kaiser WJ, Daley-Bauer LP, Thapa RJ, Mandal P, Berger SB, Huang C, Sundararajan A, Guo H, Roback L, Speck SH, et al. (2014). RIP1 suppresses innate immune necrotic as well as apoptotic cell death during mammalian parturition. Proc Natl Acad Sci U S A 111, 7753–7758. 10.1073/pnas.1401857111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yatim N, Jusforgues-Saklani H, Orozco S, Schulz O, Barreira da Silva R, Reis e Sousa C, Green DR, Oberst A, and Albert ML (2015). RIPK1 and NF-kappaB signaling in dying cells determines cross-priming of CD8(+) T cells. Science 350, 328–334. 10.1126/science.aad0395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Meier P, Legrand AJ, Adam D, and Silke J (2024). Immunogenic cell death in cancer: targeting necroptosis to induce antitumour immunity. Nat Rev Cancer. 10.1038/s41568-024-00674-x. [DOI] [PubMed] [Google Scholar]
  • 47.Aaes TL, Kaczmarek A, Delvaeye T, De Craene B, De Koker S, Heyndrickx L, Delrue I, Taminau J, Wiernicki B, De Groote P, et al. (2016). Vaccination with Necroptotic Cancer Cells Induces Efficient Anti-tumor Immunity. Cell reports 15, 274–287. 10.1016/j.celrep.2016.03.037. [DOI] [PubMed] [Google Scholar]
  • 48.Orozco SL, Daniels BP, Yatim N, Messmer MN, Quarato G, Chen-Harris H, Cullen SP, Snyder AG, Ralli-Jain P, Frase S, et al. (2019). RIPK3 Activation Leads to Cytokine Synthesis that Continues after Loss of Cell Membrane Integrity. Cell Rep 28, 2275–2287.e2275. 10.1016/j.celrep.2019.07.077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Snyder AG, Hubbard NW, Messmer MN, Kofman SB, Hagan CE, Orozco SL, Chiang K, Daniels BP, Baker D, and Oberst A (2019). Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity. Sci Immunol 4. 10.1126/sciimmunol.aaw2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Workenhe ST, Nguyen A, Bakhshinyan D, Wei J, Hare DN, MacNeill KL, Wan Y, Oberst A, Bramson JL, Nasir JA, et al. (2020). De novo necroptosis creates an inflammatory environment mediating tumor susceptibility to immune checkpoint inhibitors. Communications biology 3, 645. 10.1038/s42003-020-01362-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Parker BS, Rautela J, and Hertzog PJ (2016). Antitumour actions of interferons: implications for cancer therapy. Nat Rev Cancer 16, 131–144. 10.1038/nrc.2016.14. [DOI] [PubMed] [Google Scholar]
  • 52.Hou J, Ju J, Zhang Z, Zhao C, Li Z, Zheng J, Sheng T, Zhang H, Hu L, Yu X, et al. (2019). Discovery of potent necroptosis inhibitors targeting RIPK1 kinase activity for the treatment of inflammatory disorder and cancer metastasis. Cell Death Dis 10, 493. 10.1038/s41419-019-1735-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Beal AM, Bertin J, and Reilly MA (2018). Use of RIP1 Kinase Small-Molecule Inhibitors in Studying Necroptosis. Methods Mol Biol 1857, 109–124. 10.1007/978-1-4939-8754-2_11. [DOI] [PubMed] [Google Scholar]
  • 54.Bekes M, Langley DR, and Crews CM (2022). PROTAC targeted protein degraders: the past is prologue. Nat Rev Drug Discov 21, 181–200. 10.1038/s41573-021-00371-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Diehl CJ, and Ciulli A (2022). Discovery of small molecule ligands for the von Hippel-Lindau (VHL) E3 ligase and their use as inhibitors and PROTAC degraders. Chem Soc Rev 51, 8216–8257. 10.1039/d2cs00387b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Crew AP, Raina K, Dong H, Qian Y, Wang J, Vigil D, Serebrenik YV, Hamman BD, Morgan A, Ferraro C, et al. (2018). Identification and Characterization of Von Hippel-Lindau-Recruiting Proteolysis Targeting Chimeras (PROTACs) of TANK-Binding Kinase 1. J Med Chem 61, 583–598. 10.1021/acs.jmedchem.7b00635. [DOI] [PubMed] [Google Scholar]
  • 57.Meylan E, Burns K, Hofmann K, Blancheteau V, Martinon F, Kelliher M, and Tschopp J (2004). RIP1 is an essential mediator of Toll-like receptor 3-induced NF-kappa B activation. Nat Immunol 5, 503–507. 10.1038/ni1061. [DOI] [PubMed] [Google Scholar]
  • 58.Wong WW, Gentle IE, Nachbur U, Anderton H, Vaux DL, and Silke J (2010). RIPK1 is not essential for TNFR1-induced activation of NF-kappaB. Cell Death Differ 17, 482–487. cdd2009178 [pii] 10.1038/cdd.2009.178. [DOI] [PubMed] [Google Scholar]
  • 59.Menon MB, and Gaestel M (2018). MK2-TNF-Signaling Comes Full Circle. Trends Biochem Sci 43, 170–179. 10.1016/j.tibs.2017.12.002. [DOI] [PubMed] [Google Scholar]
  • 60.Michallet MC, Meylan E, Ermolaeva MA, Vazquez J, Rebsamen M, Curran J, Poeck H, Bscheider M, Hartmann G, Konig M, et al. (2008). TRADD protein is an essential component of the RIG-like helicase antiviral pathway. Immunity 28, 651–661. S1074–7613(08)00154–4 [pii] 10.1016/j.immuni.2008.03.013. [DOI] [PubMed] [Google Scholar]
  • 61.Vanlangenakker N, Bertrand MJ, Bogaert P, Vandenabeele P, and Vanden Berghe T (2011). TNF-induced necroptosis in L929 cells is tightly regulated by multiple TNFR1 complex I and II members. Cell Death Dis 2, e230. 10.1038/cddis.2011.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Kearney CJ, Cullen SP, Clancy D, and Martin SJ (2014). RIPK1 can function as an inhibitor rather than an initiator of RIPK3-dependent necroptosis. FEBS J 281, 4921–4934. 10.1111/febs.13034. [DOI] [PubMed] [Google Scholar]
  • 63.Wang L, Chang X, Feng J, Yu J, and Chen G (2019). TRADD Mediates RIPK1-Independent Necroptosis Induced by Tumor Necrosis Factor. Front Cell Dev Biol 7, 393. 10.3389/fcell.2019.00393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Moujalled DM, Cook WD, Okamoto T, Murphy J, Lawlor KE, Vince JE, and Vaux DL (2013). TNF can activate RIPK3 and cause programmed necrosis in the absence of RIPK1. Cell Death Dis 4, e465. 10.1038/cddis.2012.201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Dondelinger Y, Hulpiau P, Saeys Y, Bertrand MJ, and Vandenabeele P (2016). An evolutionary perspective on the necroptotic pathway. Trends Cell Biol. 10.1016/j.tcb.2016.06.004. [DOI] [PubMed] [Google Scholar]
  • 66.Li J, McQuade T, Siemer AB, Napetschnig J, Moriwaki K, Hsiao YS, Damko E, Moquin D, Walz T, McDermott A, et al. (2012). The RIP1/RIP3 necrosome forms a functional amyloid signaling complex required for programmed necrosis. Cell 150, 339–350. 10.1016/j.cell.2012.06.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Ren J, Jia X, Zhao Y, Shi W, Lu J, Zhang Y, Wu J, Liang B, Wu R, Fu G, and Han J (2017). The RIP3-RIP1-NF-kappaB signaling axis is dispensable for necroptotic cells to elicit cross-priming of CD8(+) T cells. Cell Mol Immunol 14, 639–642. 10.1038/cmi.2017.31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Jiao H, Wachsmuth L, Wolf S, Lohmann J, Nagata M, Kaya GG, Oikonomou N, Kondylis V, Rogg M, Diebold M, et al. (2022). ADAR1 averts fatal type I interferon induction by ZBP1. Nature 607, 776–783. 10.1038/s41586-022-04878-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.O'Connell RM, Taganov KD, Boldin MP, Cheng G, and Baltimore D (2007). MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 104, 1604–1609. 10.1073/pnas.0610731104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Park YC, Ye H, Hsia C, Segal D, Rich RL, Liou HC, Myszka DG, and Wu H (2000). A novel mechanism of TRAF signaling revealed by structural and functional analyses of the TRADD-TRAF2 interaction. Cell 101, 777–787. 10.1016/s0092-8674(00)80889-2. [DOI] [PubMed] [Google Scholar]
  • 71.Fucikova J, Kepp O, Kasikova L, Petroni G, Yamazaki T, Liu P, Zhao L, Spisek R, Kroemer G, and Galluzzi L (2020). Detection of immunogenic cell death and its relevance for cancer therapy. Cell Death Dis 11, 1013. 10.1038/s41419-020-03221-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Anderton H, Rickard JA, Varigos GA, Lalaoui N, and Silke J (2017). Inhibitor of Apoptosis Proteins (IAPs) Limit RIPK1-Mediated Skin Inflammation. J Invest Dermatol 137, 2371–2379. 10.1016/j.jid.2017.05.031. [DOI] [PubMed] [Google Scholar]
  • 73.Garcia LR, Tenev T, Newman R, Haich RO, Liccardi G, John SW, Annibaldi A, Yu L, Pardo M, Young SN, et al. (2021). Ubiquitylation of MLKL at lysine 219 positively regulates necroptosis-induced tissue injury and pathogen clearance. Nature communications 12, 3364. 10.1038/s41467-021-23474-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Xu D, Jin T, Zhu H, Chen H, Ofengeim D, Zou C, Mifflin L, Pan L, Amin P, Li W, et al. (2018). TBK1 Suppresses RIPK1-Driven Apoptosis and Inflammation during Development and in Aging. Cell 174, 1477–1491 e1419. 10.1016/j.cell.2018.07.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Lafont E, Draber P, Rieser E, Reichert M, Kupka S, de Miguel D, Draberova H, von Massenhausen A, Bhamra A, Henderson S, et al. (2018). TBK1 and IKKepsilon prevent TNF-induced cell death by RIPK1 phosphorylation. Nat Cell Biol 20, 1389–1399. 10.1038/s41556-018-0229-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Taft J, Markson M, Legarda D, Patel R, Chan M, Malle L, Richardson A, Gruber C, Martin-Fernandez M, Mancini GMS, et al. (2021). Human TBK1 deficiency leads to autoinflammation driven by TNF-induced cell death. Cell 184, 4447–4463 e4420. 10.1016/j.cell.2021.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Bonnard M, Mirtsos C, Suzuki S, Graham K, Huang J, Ng M, Itie A, Wakeham A, Shahinian A, Henzel WJ, et al. (2000). Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-kappaB-dependent gene transcription. EMBO J 19, 4976–4985. 10.1093/emboj/19.18.4976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Clark K, Peggie M, Plater L, Sorcek RJ, Young ER, Madwed JB, Hough J, McIver EG, and Cohen P (2011). Novel cross-talk within the IKK family controls innate immunity. Biochem J 434, 93–104. 10.1042/BJ20101701. [DOI] [PubMed] [Google Scholar]
  • 79.Upton JW, Kaiser WJ, and Mocarski ES (2012). DAI/ZBP1/DLM-1 complexes with RIP3 to mediate virus-induced programmed necrosis that is targeted by murine cytomegalovirus vIRA. Cell Host Microbe 11, 290–297. S1931–3128(12)00058–3 [pii] 10.1016/j.chom.2012.01.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Kaiser WJ, Sridharan H, Huang C, Mandal P, Upton JW, Gough PJ, Sehon CA, Marquis RW, Bertin J, and Mocarski ES (2013). Toll-like receptor 3-mediated necrosis via TRIF, RIP3, and MLKL. J Biol Chem 288, 31268–31279. 10.1074/jbc.M113.462341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Ahmed A, and Tait SWG (2020). Targeting immunogenic cell death in cancer. Molecular oncology 14, 2994–3006. 10.1002/1878-0261.12851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Galluzzi L, Aryankalayil MJ, Coleman CN, and Formenti SC (2023). Emerging evidence for adapting radiotherapy to immunotherapy. Nat Rev Clin Oncol. 10.1038/s41571-023-00782-x. [DOI] [PubMed] [Google Scholar]
  • 83.Chen DS, and Mellman I (2013). Oncology meets immunology: the cancer-immunity cycle. Immunity 39, 1–10. 10.1016/j.immuni.2013.07.012. [DOI] [PubMed] [Google Scholar]
  • 84.Vredevoogd DW, Kuilman T, Ligtenberg MA, Boshuizen J, Stecker KE, de Bruijn B, Krijgsman O, Huang X, Kenski JCN, Lacroix R, et al. (2019). Augmenting Immunotherapy Impact by Lowering Tumor TNF Cytotoxicity Threshold. Cell 178, 585–599 e515. 10.1016/j.cell.2019.06.014. [DOI] [PubMed] [Google Scholar]
  • 85.Kearney CJ, Vervoort SJ, Hogg SJ, Ramsbottom KM, Freeman AJ, Lalaoui N, Pijpers L, Michie J, Brown KK, Knight DA, et al. (2018). Tumor immune evasion arises through loss of TNF sensitivity. Sci Immunol 3. 10.1126/sciimmunol.aar3451. [DOI] [PubMed] [Google Scholar]
  • 86.Manguso RT, Pope HW, Zimmer MD, Brown FD, Yates KB, Miller BC, Collins NB, Bi K, LaFleur MW, Juneja VR, et al. (2017). In vivo CRISPR screening identifies Ptpn2 as a cancer immunotherapy target. Nature 547, 413–418. 10.1038/nature23270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Baskar R, Lee KA, Yeo R, and Yeoh KW (2012). Cancer and radiation therapy: current advances and future directions. Int J Med Sci 9, 193–199. 10.7150/ijms.3635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Bianchini G, Balko JM, Mayer IA, Sanders ME, and Gianni L (2016). Triple-negative breast cancer: challenges and opportunities of a heterogeneous disease. Nat Rev Clin Oncol 13, 674–690. 10.1038/nrclinonc.2016.66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Morad G, Helmink BA, Sharma P, and Wargo JA (2021). Hallmarks of response, resistance, and toxicity to immune checkpoint blockade. Cell 184, 5309–5337. 10.1016/j.cell.2021.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Zidek A, Potapenko A, et al. (2021). Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589. 10.1038/s41586-021-03819-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Perez-Riverol Y, Bai J, Bandla C, Garcia-Seisdedos D, Hewapathirana S, Kamatchinathan S, Kundu DJ, Prakash A, Frericks-Zipper A, Eisenacher M, et al. (2022). The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res 50, D543–D552. 10.1093/nar/gkab1038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Cotsiki M, Lock RL, Cheng Y, Williams GL, Zhao J, Perera D, Freire R, Entwistle A, Golemis EA, Roberts TM, et al. (2004). Simian virus 40 large T antigen targets the spindle assembly checkpoint protein Bub1. Proc Natl Acad Sci U S A 101, 947–952. 10.1073/pnas.0308006100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Blanchett S, Dondelinger Y, Barbarulo A, Bertrand MJM, and Seddon B (2022). Phosphorylation of RIPK1 serine 25 mediates IKK dependent control of extrinsic cell death in T cells. Front Immunol 13, 1067164. 10.3389/fimmu.2022.1067164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Jaco I, Annibaldi A, Lalaoui N, Wilson R, Tenev T, Laurien L, Kim C, Jamal K, Wicky John S, Liccardi G, et al. (2017). MK2 Phosphorylates RIPK1 to Prevent TNF-Induced Cell Death. Mol Cell 66, 698–710 e695. 10.1016/j.molcel.2017.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Feltham R, Jamal K, Tenev T, Liccardi G, Jaco I, Domingues CM, Morris O, John SW, Annibaldi A, Widya M, et al. (2018). Mind Bomb Regulates Cell Death during TNF Signaling by Suppressing RIPK1's Cytotoxic Potential. Cell Rep 23, 470–484. 10.1016/j.celrep.2018.03.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Sialana FJ, Roumeliotis TI, Bouguenina H, Chan Wah Hak L, Wang H, Caldwell J, Collins I, Chopra R, and Choudhary JS (2022). SimPLIT: Simplified Sample Preparation for Large-Scale Isobaric Tagging Proteomics. J Proteome Res 21, 1842–1856. 10.1021/acs.jproteome.2c00092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Cutler JA, Udainiya S, Madugundu AK, Renuse S, Xu Y, Jung J, Kim KP, Wu X, and Pandey A (2020). Integrative phosphoproteome and interactome analysis of the role of Ubash3b in BCR-ABL signaling. Leukemia 34, 301–305. 10.1038/s41375-019-0535-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Ciuffa R, Uliana F, Mannion J, Mehnert M, Tenev T, Marulli C, Satanowski A, Keller LML, Rodilla Ramirez PN, Ori A, et al. (2022). Novel biochemical, structural, and systems insights into inflammatory signaling revealed by contextual interaction proteomics. Proc Natl Acad Sci U S A 119, e2117175119. 10.1073/pnas.2117175119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Annibaldi A, Wicky John S, Vanden Berghe T, Swatek KN, Ruan J, Liccardi G, Bianchi K, Elliott PR, Choi SM, Van Coillie S, et al. (2018). Ubiquitin-Mediated Regulation of RIPK1 Kinase Activity Independent of IKK and MK2. Mol Cell 69, 566–580 e565. 10.1016/j.molcel.2018.01.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Tenev T, Bianchi K, Darding M, Broemer M, Langlais C, Wallberg F, Zachariou A, Lopez J, MacFarlane M, Cain K, and Meier P (2011). The Ripoptosome, a signaling platform that assembles in response to genotoxic stress and loss of IAPs. Mol Cell 43, 432–448. S1097–2765(11)00420–5 [pii] 10.1016/j.molcel.2011.06.006. [DOI] [PubMed] [Google Scholar]
  • 101.Cain K, Bratton SB, Langlais C, Walker G, Brown DG, Sun XM, and Cohen GM (2000). Apaf-1 oligomerizes into biologically active approximately 700-kDa and inactive approximately 1.4-MDa apoptosome complexes. J Biol Chem 275, 6067–6070. [DOI] [PubMed] [Google Scholar]
  • 102.Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, et al. (2003). PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34, 267–273. 10.1038/ng1180. [DOI] [PubMed] [Google Scholar]
  • 103.Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, and Tamayo P (2015). The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst 1, 417–425. 10.1016/j.cels.2015.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Data Availability Statement

  • Raw RNA-Seq data for the mammary tumor cell line (EO771) have been deposited in the Sequence Read Archive under the accession number PRJNA1094427. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE91 partner repository with the dataset identifier PXD043560.

  • Original immunohistochemistry, microscopy and western blot images have been deposited at Mendeley and are publicly available (DOI: 10.17632/822syk52yw.1). All other raw data reported in this paper will be shared by the lead contact upon reasonable request.

  • This paper analyses existing, publicly available data. These accession numbers for the datasets are listed in the key resources table.

  • This paper does not report original code.

  • Any additional information required to reanalyse the data reported in this paper is available from the lead contact upon request.

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
α-cleaved-caspase-3 Cell Signaling Technology Cat #9664S
α-phospho-ERK1/2 Cell Signaling Technology Cat#9101S
α-FLAG Cell Signaling Technology Cat#8146
α-γH2AX Cell Signaling Technology Cat#9718P
α-IKKβ Cell Signaling Technology Cat#8943S
α-phospho-IKK α/β Cell Signaling Technology Cat#2697S
α-ISG15 Cell Signaling Technology Cat#2743
α-MK2 Cell Signaling Technology Cat#3042
α-phospho-MK2 Cell Signaling Technology Cat#3007
α-p38 Cell Signaling Technology Cat#9212
α-phospho-p38 Cell Signaling Technology Cat#4511
α-p65 Cell Signaling Technology Cat#8242s
α-phospho-p65 Cell Signaling Technology Cat#3033
α-TRADD Cell Signaling Technology Cat#3694S
α-TRAF2 Cell Signaling Technology Cat#4724S
α-phospho-mRIPK3 T231/S232 Cell Signaling Technology Cat#91702
α-mouse RIPK1 N-terminal Cell Signaling Technology Cat#3493
α-human RIPK1 N-terminal Cell Signaling Technology Cat#73271
α-mouse RIPK2 Cell Signaling Technology Cat#4142S
α-mouse RIPK2 Cell Signaling Technology Cat#4928
α-mouse RIPK3 Cell Signaling Technology Cat#15828
α-human RIPK3 Cell Signaling Technology Cat#13526S
α-TrkA Cell Signaling Technology Cat#2505S
α-B-raf Santa Cruz Biotechnology Cat#sc-5284
α-IkBa Santa Cruz Biotechnology Cat#sc-371
α-Ubiquitin Santa Cruz Biotechnology Cat#sc-8017
α-phospho-MLKL S345 Abcam Cat#ab196436
α−TNFR1 Abcam Cat#19139
α-RIPK1 BD Bioscience Cat#610459
α-RIPK2 BD Bioscience Cat#612348
α-MLKL Millipore Cat#MABC604
α-ZBP1 Adipogen Cat#AG-20B0010-C100
α-FADD Assay designs Cat#AAM-212
α-HOIP Bethyl laboratories Cat#A303–560A
α-Sharpin Proteintech Cat#14626–1-AP
α-ERK1/2 Gift from Prof. Chris Marshall N/A
α-cIAP1 Enzo Cat#ALX-803–335-C100
α-mouse IgG (H+L)-HRP Jackson Immuno Research Cat #115–035-003
α-rabbit IgG (H+L)-HRP Jackson Immuno Research Cat#111–035-003
α-rat IgG (H+L)-HRP Jackson Immuno Research Cat#112–035-003
Phalloidin Alexa 633 Thermo Fisher Scientific Cat#A22284
Alexa 488 α-rabbit secondary antibody Thermo Fisher Scientific Cat#A-11034
DAPI Sigma Aldrich Cat#10236276001
Alexa 488 α-rabbit secondary antibody Thermo Fisher Scientific Cat#A21206
α-IgG2a (in vivo) 2B scientific Cat#BE0085
α-DYKDDDDK tag Thermo Fisher Scientific Cat#8146
α-CTLA-4 (in vivo) 2B scientific Cat#BE0164
α-PD-1 (in vivo) 2B scientific Cat#BE0146
α-mouse CD107a-BUV395 BD Cat#565533; Clone#1D4B
α-mouse CD107a-PE Biolegend Cat#121611; Clone#1D4B
α-mouse CD44-BUV395 BD Cat#740215; Clone#IM7
α-mouse CD25-BV650 Biolegend Cat#102037; Clone#PC61
α-mouse CD4-BV496 BD Cat#741050; Clone#RM4–4
α-mouse MHCII-PE-Dazzle-594 Biolegend Cat#107647; Clone#M5/114.15.2
α-mouse CD3-BUV563 BD Cat#741319; Clone#17A2
α-mouse TCRδ-BUV615 BD Cat#751183; Clone#GL3
α-mouse TCRδ-PerCpCy5.5 Biolegend Cat#118117; Clone#GL3
α-mouse CD11c-BUV615 BD Cat#751222; Clone#N418
α-mouse CD11c-PECy7 Biolegend Cat#117317; Clone#N418
α-mouse Singlec-F-AF488 Biolegend Cat#55523; Clone#S17007L
α-mouse Singlec-F-BV605 BD Cat#121612; Clone#E50–2440
α-mouse CD69-PECy7 Biolegend Cat#104511; Clone#H1.2F3
α-mouse CD69-BV785 Biolegend Cat#740388; Clone# H1.2F3
α-mouse CD19-BUV661 BD Cat#612971; Clone#1D3
α-mouse NK1.10BUV737 BD Cat#741715; Clone#PK136
α-mouse NK1.1-PECy5 Biolegend Cat#108715; Clone#PK136
α-mouse CD45-BUV805 BD Cat#748370; Clone#30F11
α -mouse F4/80-BV650 Biolegend Cat#123149; Clone#BM8
α-mouse FoxP3-eFlour450 Thermo Fisher Scientific Cat#17–5773-82; Clone#FJK-16s
α-mouse Ly6G-BV510 Biolegend Cat#127633; Clone#1A8
α-mouse CD62L-PECy5 Biolegend Cat#104410; Clone#MEL-14
α-mouse CD8α-BV570 Biolegend Cat#100739; Clone#53–6.7
α-mouse Ly6C-AF700 Biolegend Cat#128023; Clone#HK1.4
α-mouse CD11b-BV750 Biolegend Cat#101267; Clone#M1/70
α-mouse TNFα-APC Biolegend Cat#506307; Clone#MP6-XT22
α-mouse Grzmb-AF647 Biolegend Cat#515405; Clone#GB11
α-mouse IFNγ-AF488 Biolegend Cat#505815; Clone#HM61.2
α-mouse TCRβ-PerCP-Cy5 Biolegend Cat#109228; Clone#H57–597
α-mouse CD8α-BUV395 BD Biosciences Cat#563786; Clone#53–6.7
α-mouse CD4-BV650 Biolegend Cat#100555; Clone#RM4–5
α-mouse CD44-BV785 Biolegend Cat#103059; Clone#IM7
α-mouse CD25-EF450 Thermo Fisher Scientific Cat#48–0251-82; Clone#PC61–5
LIVE/DEAD Fixable Near-IR Thermo Fisher Scientific Cat#L34976
α-FLAG tag Cell Singalling Technology Cat#8146
α-mouse HRP Abcam Cat #ab131368
Mouse Fc Block (CD16/CD32) BD Biosciences Cat #553141
Bacterial and virus strains
BL21(DE3) E. Coli New England Bioscience Cat #C2527
One Shot TOP10 E. Coli Thermo Fisher Scientific Cat #C404010
Biological samples
Chemicals, peptides, and recombinant proteins
Propidium Iodide Sigma-Aldrich Cat#P4864
Hoechst-33342, Trihydrochloride, Trihydrate Thermo Fisher Scientific Cat#H3570
Glutathione Sepharose 4B beads GE Healthcare Cat#17075601
Recombinant mouse M-CSF Peprotech Cat#300–25
Gentle Collagenase/Hyaluronidase Stemcell Technology Cat#07919
RIPK1 inhibitor GlaxoSmithKline GSK’963 Stratech Scientific Cat#HY-103028A; CAS#:2049868–46-2
RIPK1 inhibitor (PK68) Insight Bio Cat#HY-128348; CAS#:2173556–69-7
RIPK3 inhibitor GlaxoSmithKline GSK’872 Stratech Scientific Cat#S8465; CAS: 1346546–69-7
Necrostatin-1s MedChemExpress Cat#HY-103028A; CAS#: 4311–88-0
RIPK2 PROTAC degrader 2 Cambridge Bioscience Cat#HY-111866–10 mg; CAS#1801547–16-9
SM-164 Caltag Medsystems Cat#TAR-T12932L; CAS#957135–43-2
ASTX660 Insight Bio Cat#HY-109565; CAS#1799328–86-1
Recombinant human TNFa Enzo Cat#ALX-522–008-C050
Recombinant mouse TNFa Enzo Cat# ALX-522–009-C050
Emricasan, pan-caspase inhibitor Medkoo Cat#510230; CAS#254750–02-2
Z-VAD-FMK, pan-caspase inhibitor Apex Bio Cat#A1902; CAS #187389–52-2
Bortezomib, proteasome inhibitor Stratech Cat#S1013; CAS#179324–69-7
VH298, VHL inhibitor Abcam Cat#ab230370
Human recombinant INFβ Peprotech Cat#300–02BC
Murine recombinant INFβ Biomol Cat#RP0487M
Murine recombinant IFNγ Peprotech Cat#315–05
Poly(I:C) HMW Invivogen Cat#tlr-pic; CAS#31852–29-6
Riboxxol Riboxx Cat#A-00102; CAS#63231–63-0
LPS EK Ultrapure Invivogen Cat#tlrl-peklps
Enbrel (Etanercept) Cambridge Bio Cat#HY-108847–10
5Z-7-Oxozeaenol, TAK1 inhibitor Bio-techne Cat#3604
BX795, TBK1/IKKε inhibitor Invivogen Cat#tlrl-bx7–2; CAS#1472611–45-2
p38 inhibitor (Ralimetinib LY2228820 dimesylate) Selleckchem Cat#862507–23-1; CAS#862507–23-1
PF-3644022 (MK2 inhibitor) Bio-Techne Cat#HY-107427; CAS #1276121–88-0
TPCA-1 (IKK2 inhibitor) Sigma-Aldrich Cat#T1452; CAS#507475–17-4
NIK SMI1 (NIK inhibitor) Stratech Cat#S8941-SEL; CAS#1660114–31-7
Cycloheximide Tocris Cat#0970–100; CAS#66–81-9
HOIPIN-8 (HOIP inhibitor) Axon MedChem Cat#2972; CAS#2519537–69-8
Tpl2 kinase inhibitor Insight biotechnology Cat#HY-12358; CAS#871307–18-5
XIAP degrader Insight biotechnology Cat#HY-115865
DL-Dithiothreitol (DTT) Sigma-Aldrich Cat#10708984001; CAS#3483-12-3
PR-619 (DUB inhibitor) 2BScientific Cat#SI-9619–0005
Recombinant human USP2 Catalytic domain protein Bio-Techne, R&D Cat#E504050
Anti-FLAG M2 affinity agarose beads Sigma-Aldrich Cat#A2220
Strep-Tactin Sepharose resin beads IBA lifesciences Cat#2–1201-025
Lenti-X concentrator Clontech Takara Cat#621231
Polybrene Merk Cat#TR-1003-G
Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific Cat#13778150
Blasticidin Invivogen Cat#ant-bl-05
Collagenase type VI Sigma Aldrich Cat#7919
Tryton X-100 Thermo Fisher Scientific Cat#28314
PR-619 DUB inhibitor 2B Scientific Cat# SI-9619–0005
PhosSTOP easypack Sigma Aldrich Cat#4906837001
Complete protease inhibitor cocktail Roche Cat# 11836153001
GSH beads Sigma Aldrich Cat#GE17–0756-01
Protein G beads Sigma Aldrich Cat#P3296
Clean-Blot IP Detection Reagent (HRP) Thermo Fisher Scientific Cat#21230
Dispase Sigma Aldrich Cat#D4693–1G
DNase type I Sigma Aldrich Cat#DN25
Corning Matrigel GFR SLS N/A
Ionomycin from Streptomyces Conglobatus Sigma Aldrich Cat#I9657
MRT3767, TBK1i Sigma Aldrich Cat#SML0702
HALT Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat#78447
Dako REAL peroxidase block Agilent Cat#S202386–2
Dako rabbit EnVision polymer-HRP Agilent Cat#K400311–2
Dako DAB+ Agilent Cat#K346811–2
Dako FLEX Haematoxylin Agilent Cat#K800821–2
Rabbit ImmPRESS polymer-HRP Vector Laboratories Cat#MP-7401–50
Dako Target Retrival Solution Agilent Cat#K800421–2
Target retrieval solution (TRS) Agilent Cat#K800521–2
Critical commercial assays
Effectene Transfection Kit Qiagen Cat#301427
Nano-Glo HiBiT Lytic Detection KitP Promega Cat#N3030
NaveniFlex MR Bethyl Laboratories Cat#NF.MR.100
CellTiter-GLO Promega Cat#G9681
RNeasy RNA extraction kit Qiagen Cat#74106
QuantiTec Reverse Transcription kit Qiagen Cat#205314
Pierce BCA protein assay kit Thermo Fisher Scientific Cat#23227
Deposited data
Bulk RNA-seq (Sham Vs RT-treated EO771 cells) Sequence read archive ID: PRJNA1094427
Mass spectrometry: Human and mouse whole proteome analysis PRIDE ID: PXD043560
TCGA Pan-cancer analyses cBioPortal N/A
SCAN-B TNBC patient data GEO Database ID: GSE96058
GSEA analyses (hallmark gene set collection) The Molecular Signatures Database (MSigDB) N/A
Raw western blots and image from this paper Mendeley DOI: 10.17632/822syk52yw.1
Experimental models: Cell lines
HEK293T ATCC Cat#CRL-3216
HT1080 ATCC Cat#CCL-121
U937 ATCC Cat#CRL-3253
HT29 ATCC Cat#HTB-38
MDA-MB-231 ATCC Cat#CRM-HTB-26
MDA-MB-361 ATCC Cat#HTB-27
MDA-MB-468 ATCC Cat#HTB-132
HaCaT ATCC Cat#PCS-200–011
LLC ATCC Cat#CL-101
L929 ATCC Cat#CRL-2148
THP-1 ATCC Cat#TIB-202
EMT6 ATCC Cat#CRL-2755
Lim1215 Laboratory of Prof. Chris Marshall N/A
A431 ATCC Cat#CRL-1555
F3II Laboratory of Prof. Daniel Alonso N/A
D2A1 Laboratory of Prof. Clare Isacke N/A
Kym-1 Laboratory of Prof. John Silke N/A
Immortalized MDFs Charles River (Cells generated in house) N/A
MCA-205 Sigma Aldrich Cat#SCC-173
EO771 CH3 Biosystems Cat#94A001
MC38 Kerafast Cat#ENH204-FP
Wildtype BMDMs and Lung fibroblasts (C57BL/6) Charles River (Cells generated in house) N/A
Spata2-/- BMDMs (C57BL/6) Laboratory of Prof. Mads Gyrd-Hansen’s N/A
Trif-/- BMDMs (C57BL/6) (Ticam1-/-) Laboratory of Prof. Manolis Pasparakis N/A
Zbp1-/- BMDMs (C57BL/6) Laboratory of Prof. Manolis Pasparakis N/A
Trif-/-Zbp1-/- BMDMs and LFs (C57BL/6) (Ticam1-/-Zbp1-/-) Laboratory of Prof. Manolis Pasparakis N/A
L929 Tradd -/- This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD WT This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD DD-only This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD Y16A/F18A This Manuscript N/A
L929Tradd-/- reconstituted with TRADD C239S This Manuscript N/A
L929 Tradd-/- reconstituted with TRADD Call>S This Manuscript N/A
L929 GFP-RIPK1ΔKDΔRHIM This Manuscript N/A
L929 GFP-RIPK1 DD-only This Manuscript N/A
E0771 GFP-RIPK1ΔKDΔRHIM This Manuscript N/A
E0771 GFP-RIPK1 DD-only This Manuscript N/A
293T-Ripk1-/- This Manuscript N/A
E0771-Ripk1-/- This Manuscript N/A
E0771-Tnfr1-/- This Manuscript N/A
E0771-Mlkl-/- This Manuscript N/A
Experimental models: Organisms/strains
C57BL/6-Mlkl-/- Laboratory of Prof. Henning Walczak N/A
C57BL/6-Casp8-/-Ripk3-/- Laboratory of Prof. Henning Walczak N/A
C57BL/6-Casp8tm1Hed/J The Jackson Laboratory RRID:IMSR_JAX: 027002
C57BL/6.Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/1J The Jackson Laboratory RRID:IMSR_JAX: 007001
C57BL/6-Tnfrsf1atm1Imx/J The Jackson Laboratory RRID:IMSR_JAX: 003242
C57BL/6-Ifnar1tm1.2Ees/J The Jackson Laboratory RRID:IMSR_JAX: 028288
C57BL/6-Ripk1fl/fl Laboratory of Prof. Manolis Pasparakis N/A
Oligonucleotides
SMART vector inducible non-targeting (Nt) shRNA Dharmacon VSC11502
SMART vector inducible Ripk1 shRNA Dharmacon V3SM11253–237881699
SMART vector inducible Trif shRNA (Ticam1) Dharmacon V3SM11253–235355483
SMART vector inducible Zbp1 shRNA Dharmacon V3SM11253–235538171
See Table S2 for PCR primers, Taqman probes, siRNAs & CRISPR gRNAs
Recombinant DNA
pTRIBZ This Manuscript N/A
pTIBZ-Cre This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-WT This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-DD This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-Y16A/F18A This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-Call>S This Manuscript N/A
pTIBZ-N2xFLAG-mTradd-C239S This Manuscript N/A
pMA-RQ-N2xFLAG-mTradd-WT This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-DD This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-Y16A/F18A This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-Call>S This Manuscript Synthetic, Invitrogen
pMA-RQ-N2xFLAG-mTradd-C239S This Manuscript Synthetic, Invitrogen
pTIBZ-mRipk3-WT This Manuscript N/A
pTIBZ-mRipk3-RHIMm This Manuscript N/A
pTIBZ-EGFP-mRipk1 ΔKDΔRHIM This Manuscript N/A
pTIBZ-EGFP-mRipk1 DD-only This Manuscript N/A
pMA-RQ-mRipk1 ΔKDΔRHIM This Manuscript Synthetic, Invitrogen
pMA-RQ-mRipk1 DD-only This Manuscript Synthetic, Invitrogen
pTRIPZ Open Biosystems Cat#RHS4696
pTIPZ-hRipk1 ΔRHIMΔDD-HiBiT This Manuscript N/A
pTYB1 New England BioLabs Inc. Cat#N6701
pTYB1-FLAG-mTradd WT This Manuscript N/A
pT7CFE1-CHis ThermoFisher 88860
T7CFE-mRipk3 This Manuscript N/A
pcDNA3.1 Invitrogen Cat#V79520
pcDNA3-GFP-2xHA/2xStrep This Manuscript N/A
pcDNA3.5-N2xHA-mRipk1 This Manuscript N/A
pcDNA3-N3xHA-mZbp1 This Manuscript N/A
pcDNA3-N3xHA-mRipk3 This Manuscript N/A
pcDNA3-mTrif-C3xHA (Ticam1) This Manuscript N/A
pcDNA3-N2xFLAG-mTradd This Manuscript N/A
pLC-EGFP Gift from B. Bornhauser Addgene Cat# 75159
pLC-Cherry Gift from B. Bornhauser Addgene Cat# 75161
pSpCas9(BB)-2A-GFP Addgene 48138
pLC-EGFP-mTradd gRNA (CGCAACTGGACGATGAGCTG) This Manuscript N/A
pLC-EGFP-mTnfr1 gRNA (CGGACAGTCACTCACCAAGT) This Manuscript N/A
pLC-Mlkl gRNA-CGM25 (CTGGCAGCAGGAAGATCGAC) This Manuscript N/A
pLC-Ripk1 gRNA-CGM19 (AGGGAACTATTCGCTGGTGA) This Manuscript N/A
pMA-hRipk1-gRNA (GCTCGGGCGCCATGTAGTAG) This Manuscript Synthetic, Invitrogen
psPAX2 Addgene Cat# 12260
pMD2.G Addgene Cat# 12259
pBABE SV40 (Δ89–93) Gift from Parmjit Jat (Cotsiki et al, 2004) https://doi.org/10.1073/pnas.0308006100
Software and algorithms
Dotmatics Dotmatics N/A
Harmony High Content Analysis Software Perkin Elmer N/A
ImageLab (v6.1.0) Bio-Rad N/A
GraphPad Prism (v10.2.1) (339) Dotmatics N/A
Adobe Illustrator (v28.0) (2024) Adobe N/A
R studio package (v4.3.0) Limma N/A
Fiji (v2.9.0) ImageJ N/A
FlowJo (v.10) BD Biosciences N/A
FACSDIVA software (v6.1.3) BD Biosciences N/A
Other

RESOURCES