ABSTRACT
Escherichia coli is a diverse pathogen, causing a range of disease in humans, from self-limiting diarrhea to urinary tract infections (UTIs). Uropathogenic E. coli (UPEC) is the most frequently observed uropathogen in UTIs, a common disease in high-income countries, incurring billions of dollars yearly in treatment costs. Although E. coli is easily grown and identified in the clinical laboratory, genotyping the pathogen is more complicated, yet critical for reducing the incidence of disease. These goals can be achieved through whole-genome sequencing of E. coli isolates, but this approach is relatively slow and typically requires culturing the pathogen in the laboratory. To genotype E. coli rapidly and inexpensively directly from clinical samples, including but not limited to urine, we developed and validated a multiplex amplicon sequencing assay, called ColiSeq. The assay consists of targets designed for E. coli species confirmation, high resolution genotyping, and mixture deconvolution. To demonstrate its utility, we screened the ColiSeq assay against 230 clinical urine samples collected from a hospital system in Flagstaff, Arizona, USA. A limit of detection analysis demonstrated the ability of ColiSeq to identify E. coli at a concentration of ~2 genomic equivalent (GEs)/mL and to generate high-resolution genotyping at a concentration of 1 × 105 GEs/mL. The results of this study suggest that ColiSeq could be a valuable method to understand the source of UPEC strains and guide infection mitigation efforts. As sequence-based diagnostics become accepted in the clinical laboratory, workflows such as ColiSeq will provide actionable information to improve patient outcomes.
IMPORTANCE
Urinary tract infections (UTIs), caused primarily by Escherichia coli, create an enormous health care burden in the United States and other high-income countries. The early detection of E. coli from clinical samples, including urine, is important to target therapy and prevent further patient complications. Additionally, understanding the source of E. coli exposure will help with future mitigation efforts. In this study, we developed, tested, and validated an amplicon sequencing assay focused on direct detection of E. coli from urine. The resulting sequence data were demonstrated to provide strain level resolution of the pathogen, not only confirming the presence of E. coli, which can focus treatment efforts, but also providing data needed for source attribution and contact tracing. This assay will generate inexpensive, rapid, and reproducible data that can be deployed by public health agencies to track, diagnose, and potentially mitigate future UTIs caused by E. coli.
KEYWORDS: UTIs, genotyping, E. coli, amplicon sequencing
INTRODUCTION
Escherichia coli is a highly versatile species of bacteria, serving as an essential member of the human gut microbiome (1), a model organism in biotechnology (2) and genetic research (3), and causing a range of disease in humans, including meningitis (4), hemolytic uremic syndrome (5), and urinary tract infections (UTIs) (6). In lower- and middle-income countries, diarrheagenic E. coli causes severe disease and excess mortality through inadequate sanitation, contaminated water sources, and limited access to healthcare (7). UTIs, including bladder infections, are the primary health risk of E. coli in high-income countries (8, 9), where uropathogenic E. coli (UPEC) is the primary uropathogen. In the United States, UTIs result in millions of healthcare visits annually and incur an economic burden well into the billions of dollars (10–12). Untreated or antimicrobial-resistant bladder infections can cause pyelonephritis, which can result in sepsis and death if not treated (13).
A key component to effective management and treatment of UTIs is diagnosis of the infective agent. Clinical labs rarely identify pathogen strains or genotypes and focus instead on rapid detection and phenotypic characterization so that treatment may proceed as soon as possible (14).The detection of UPEC in urine is typically focused on species identification using culture confirmation (15) or metabolite-based methods (16). More rarely, metagenomics (17) or whole-genome sequencing (WGS) (18) are applied which provide high-resolution genotyping but at a higher cost. Shotgun metagenomics requires expensive deep sequencing to overcome the high concentration of host background DNA, and WGS approaches often require culturing, which can substantially delay the time to answer needed for prompt interventions. Consequently, although clinical labs process large collections of samples, they typically are unable to provide the genotype information required to understand larger patterns of transmission, circulation, and coinfection (19, 20). Genotypic information could guide clinicians’ choices of antibiotic regimens or could help differentiate between recurrent and new infections.
Researchers have identified multiple, independent genotypes of UPEC associated with UTIs many of which fall within the B2 phylogroup (21), including the antibiotic-resistant clone, ST131 (22). A recent study used WGS-based methods to identify cases of zoonotic extraintestinal E. coli transfer (23), which illustrates the importance of obtaining strain level information from UTI samples to understand pathogen spread. There is limited information on the frequency of mixed infections, but it is important that health-care professionals are aware of the possible presence of co-infections of multidrug-resistant UPEC strains when treating patients due to the risk of life-threatening complications (24). In some clinical stool samples, mixtures of pathogenic variants (pathovars) or strains within pathovars have been observed (25). Methods have been developed to characterize mixed bacterial infections, including processing colony sweeps (26), single colony screens (27), and haplotype analyses (28). In many cases, these techniques require WGS, which is still not rapid and economical in the clinical setting.
The goal of this study was to develop a rapid, inexpensive, amplicon sequencing (AmpSeq) molecular method to characterize E. coli directly from clinical samples. Other studies that have developed AmpSeq approaches for analyzing clinical samples have focused on the amplification, sequencing, and analysis of the 16S rRNA gene (29), which does not provide the level of resolution needed for accurate species (or subspecies) identification and source attribution. Here, our assay includes multiple targets to determine the presence of E. coli and genotype strains within a sample. The utility of our AmpSeq assay, called ColiSeq, is demonstrated on clinical UTI samples and validated with a range of in silico and in vitro methods.
MATERIALS AND METHODS
Reference genome downloading and multilocus sequence typing
Thirty-three thousand three hundred nine Escherichia genomes were downloaded on 18 April 2023 with the ncbi-genome-download tool (https://github.com/kblin/ncbi-genome-download) from the RefSeq database (30). To identify any mis-annotated genomes, pairwise distances were calculated with MASH v2.3 (31) for each genome against E. coli K-12 strain MG1655 (MG1655) (NC_000913.2) (32). Genomes with a MASH distance >0.06 [~94% average nucleotide identity (ANI)] were considered Escherichia near neighbors. One thousand one hundred fifty-one assemblies with >500 contigs were filtered from all downstream analyses. The final reference set consisted of 31,630 E. coli genomes and 528 near neighbor Escherichia genomes.
A representative set of E. coli reference genomes was created from the 31,630 genomes with the Assembly Dereplicator tool v0.1.0 (https://github.com/rrwick/Assembly-Dereplicator) using default settings, resulting in a set of 461 reference genomes (Table S1). The sequence type (ST) of these genome assemblies was determined with FastMLST v0.0.15 (33) and the Clermont group (phylogroup) (34) was determined with the ClermonTyping tool (35). A previously dereplicated set of 516 E. coli genomes, using the Assembly Dereplicator method at a less stringent threshold, was also used for a subset of analyses (Table S1).
Reference UPEC genomes from Flagstaff, Arizona
A recent study analyzed >3,000 E. coli isolates from meat and clinical samples from Flagstaff, Arizona (23). The WGS data from these samples (PRJNA307689, PRJNA407956) were downloaded, assembled with SPAdes v3.15.5 (36), sequence typed with FastMLST, and analyzed in this study to determine if common sequence types were circulating in Flagstaff.
Single locus informative marker identification and analysis
To generate a WGS reference tree, the set of 516 E. coli genomes (Table S1) was aligned against MG1655 with NUCmer v3.1 (37) in NASP v1.2.1 (38) and a maximum likelihood phylogeny was inferred on the concatenated SNP alignment with RAxML v8.2.4 (39). To identify an appropriate molecular marker for genotyping, the MG1655 genome was sliced into 300 nt fragments, overlapping by 50 nt. Each candidate marker (n = 92,789) was extracted from the 516 E. coli genome set (Table S1) with BLASTN v2.11.0 (40), aligned with MUSCLE v3.8.31 (41), and a phylogeny was inferred on the alignment with FastTree2 v2.1.10 (41, 42). The Robinson-Foulds (RF) (43) distance was calculated between the candidate marker tree and the WGS tree with DendroPy v4.2.0 (44). All of these functions were wrapped with Phylomark v1.6 (45). A region with a low RF value and a larger number of distinguishing SNPs was chosen as the single locus informative marker (SLIM); this region corresponds to positions 1,834,751 through 1,835,050 in E. coli MG1655 and corresponds to locus B21_01711 in E. coli BL21 and b1754 in MG1655 (SLIMv2). An additional SLIM marker (SLIMv1), designed earlier from a smaller E. coli collection with the same methods, was also included in the ColiSeq assay described below to provide additional phylogenetic resolution; the SLIMv1 corresponds to locus_tag b2244 in MG1655.
To build a reference SLIM database, the SLIMv2 was extracted from the set of 31,630 E. coli genomes from BLASTn alignments. The complete SLIMv2 alignment was found in 31,560 genome assemblies (99.8% of all genomes). Unique SLIM alleles were identified with mothur v1.44.3 (unique.seqs command) (46) resulting in 333 unique SLIM variants. In some cases, SLIM variants represent multiple STs and genomes within some STs can belong to multiple SLIM variants (Table S2).
Minimum spanning set identification
Reference E. coli genomes (n = 31,630) were aligned against E. coli MG1655 with NASP. All SNPs were processed with VaST (47) in order to identify the minimum number of SNPs that provide maximum strain-level resolution. Ten SNPs were identified that provided >90% strain resolution; this set of targets represents the minimal spanning set (MSS) (Fig. S1). For primer design, 125 nt flanking regions in the MG1655 genome were extracted from both sides of each MSS SNP in the reference genome.
Unique E. coli species gene marker
The pan-genome of a reference set of E. coli genomes (n = 461, Table S1) was identified with LS-BSR v1.2.3 (48). The core genes, defined as having a blast score ratio (BSR) (49) ≥0.8 in all genomes, within these E. coli genomes were screened against near neighbor Escherichia genomes with LS-BSR. Genes with a BSR value <0.4 in the near neighbor genomes were identified, resulting in three potential candidates for an E. coli presence/absence marker. One of these regions was moved forward into the ColiSeq assay; this region corresponds to yfdX (B21_02246), a protein of unknown function.
Primer design and in silico optimization
Primer3 v2.3.6 (50) was used to identify candidate forward and reverse primers for the following targets: E. coli species marker, 2 SLIMs (v1 and v2), and 10 MSS targets. Primers were selected if they had a predicted amplicon size of between 150 and 300 nucleotides and the melting temperature was between 52°C and 62°C [calculated with IDT OligoAnlyzer Tool (51) using the qpcr specsheet settings]. Predicted amplicons were extracted from alignments with BLASTn, aligned with MUSCLE, and visualized with JalView (52). Based on the alignment, degeneracies were manually added to the primer sequences where needed for maximum genome inclusion.
The primers were then quality checked with Primacy (https://github.com/FofanovLab/Primacy) to limit potential negative primer interactions. The oligos were synthesized with forward (UT1: ACCCAACTGAATGGAGC) and reverse (UT2: ACGCACTTGACTTGTCTTC) universal tails (53) to facilitate index ligation prior to pooling for multiplexed sequencing.
In silico PCR screen
To test for sensitivity and specificity of ColiSeq in silico, PCR primers were screened against Escherichia genomes with the -search_pcr method in USEARCH v11.0.667 (54), using the following parameters: “-strand both -maxdiffs 2 -minamp 70 -maxamp 1500.” The number and composition of predicted amplicons were manually verified.
WG-FAST validation on SNPs in the ColiSeq data set
The whole genome focused array SNP typing (WG-FAST) method genotypes bacterial strains using a subset of all core genome SNPs (55). To demonstrate the ability to genotype E. coli strains using SNPs in ColiSeq amplicons, a reference data set was created from a set of 21 characterized Escherichia genomes (56). SNPs were identified for all genomes against MG1655 with NASP and a maximum likelihood phylogeny was created from the concatenated SNP alignment with RAxML v8.2.4 (39). Reads from E. coli C227-11 (SRR341580), an outbreak strain isolated in 2011 from Europe (57), were aligned with minimap2 v2.24 (58) against ColiSeq amplicons and aligned reads were extracted from the resulting BAM file (n = 2,437 paired end reads) with SAMtools v1.9 (59). Mapped reads from C227-11 were inserted into the phylogeny with WG-FAST v1.2 with SNPs called at a minimum coverage of 3× to determine if the phylogenetic placement of the genome was consistent with previous results (57).
Multi-locus sequence typing locus analysis
To compare the number of polymorphisms in ColiSeq regions with traditional markers, seven genes from the PubMLST typing system for E. coli (60) were extracted from a set of BLASTn alignments with a custom script (https://gist.github.com/jasonsahl/2a232947a3578283f54c). The number of SNPs contained in a concatenated alignment of MLST markers was calculated with snp-dists v0.8.2 (https://github.com/tseemann/snp-dists). A phylogeny was inferred on the concatenated MLST alignment with raxml-ng v1.1.0 (61) using the GTR + G substitution model; the unweighted Robinson-Foulds distance between this phylogeny and phylogenies inferred on the core genome alignment and the ColiSeq alignment were calculated with the treecompare method in DendroPy.
Sample collection
Clinical urine samples (n = 294) were collected from Flagstaff Medical Center (FMC) from October 2017 to September 2018 under IRB protocol No. 764034-NAH. These samples were collected from patients with urinary tract infections that were confirmed at FMC by culture-based approaches in the clinical laboratory; all samples were transferred to NAU with any identifying patient data removed. Samples were stored at −80°C until processed and precautions were taken to avoid freeze-thaw cycles to prevent any changes in the microbial composition of the samples.
Urine DNA extraction and validation
Whole DNA was extracted from each urine sample using the Norgen Urine DNA Isolation Kit (Slurry Format) (Norgen Botek Corp Cat# 48800) with two elutions of 100 µL. Of the 294 urine samples that were collected, only 230 of them were extracted (Table S3); the remaining samples did not have enough volume of urine to go through the extraction process. Following extraction, an E. coli species-specific PCR assay (described above, Table 1) was run on DNA to confirm the presence of E. coli. Five hundred microliters of urine was also plated using a sterile hockey stick on both Luria-Bertani and MacConkey agar and incubated for 72 h at 37°C. For a subset of samples that underwent WGS, single colonies were isolated, DNA was extracted with GenElute (MilliporeSigma, St. Louis, MO), and cultures were frozen at −80°C in 20% (vol/vol) glycerol (Table S3).
TABLE 1.
Assay information and sequence
| Type of target | Locus | Primer | Primer (5′−3′) | Melting temp | Amplicon length | Amplicon length + UT | Position in Amplicon | Reference | Variant | Sequence ID | Start | Stop |
E. coli hits (n = 31630) |
NN hits (n = 528) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| E. coli species | B21_02246 | Forward | GAGCGTATCTCTGAACAAGG | 59.7 | 110 | 146 | N/A | N/A | N/A | https://www.ncbi.nlm.nih.gov/nuccore/CP032667.1/ CP032667.1 | 1389110 | 1389219 | 31485 | 0 |
| Reverse | GAAGCTTCRYTGGTCAGTTC | 60.8 | ||||||||||||
| MSS - SNP | B21_00966 | Forward | CAGCATAAAAGAGGAGGATG | 57.9 | 150 | 186 | 49 | A | G | CP032667.1 | 2863461 | 2863312 | 31582 | 46 |
| Reverse | CTGGTTCCKGATACCGATAG | 59.9 | ||||||||||||
| MSS - SNP | B21_01903 | Forward | CATTCGACTCCGGTTKATTA | 58.5 | 147 | 183 | 37 | T | C | CP032667.1 | 1797701 | 1797555 | 24981 | 163 |
| Reverse | GAAGAAAGCTCAATGGTTCT | 58.2 | ||||||||||||
| MSS - SNP | B21_01907 | Forward | CGYGAATCAAAATACATCAT | 55.8 | 176 | 212 | 114 | G | A | CP032667.1 | 1792511 | 1792336 | 31593 | 528 |
| Reverse | TTCAGTTTTTCCATNGTTTC | 55.9 | ||||||||||||
| MSS - SNP | B21_01912 | Forward | TAGATTTAATYRACGGSACB | 57.3 | 181 | 217 | 120 | C | T | CP032667.1 | 1788231 | 1788051 | 31047 | 505 |
| Reverse | TTAATCARYRGGATTTGA | 52.4 | ||||||||||||
| MSS - SNP | B21_01973 | Forward | AGATCCAGACYAAYGAYGAR | 59.6 | 214 | 250 | 113 | A | G,T | CP032667.1 | 1724304 | 1724091 | 31584 | 525 |
| Reverse | CTGTCWACCGTCTGRATWAT | 58 | ||||||||||||
| MSS - SNP | B21_03426 | Forward | CATCACATCGCAGTATTCAT | 58.1 | 235 | 271 | 121 | G | A | CP032667.1 | 91517 | 91283 | 31602 | 527 |
| Reverse | CAACAACGATATGCAKGAG | 57.4 | ||||||||||||
| MSS - SNP | B21_03444 | Forward | AAGATGRGYCAGMACRTTRT | 60.7 | 193 | 229 | 88 | G | A | CP032667.1 | 72607 | 72415 | 31630 | 434 |
| Reverse | GGGCTGGATTATCATTCATT | 58 | ||||||||||||
| MSS - SNP | B21_03573 | Forward | GCTTTGYTGCAGACCATC | 60 | 182 | 218 | 124 | C | T | CP032667.1 | 4594237 | 4594056 | 31604 | 374 |
| Reverse | TGATTGTGAAATACDGTGAA | 56.3 | ||||||||||||
| MSS - SNP | B21_04060 | Forward | ATCTAYAAAGCGATGATKGA | 56.9 | 172 | 208 | 66 | T | G,C,A | CP032667.1 | 4072460 | 4072289 | 31605 | 527 |
| Reverse | AYTCTTCTTTTGCGGTATCA | 58.7 | ||||||||||||
| MSS - SNP | B21_04066 | Forward | AGTTTATGGAACARYACCAC | 58 | 144 | 180 | 75 | G | A | CP032667.1 | 4065665 | 4065522 | 31615 | 527 |
| Reverse | CCAGCGTATTAARATGGAAG | 57.4 | ||||||||||||
| SLIM v1 | B21_02129 | Forward | TGTCATTAGTGAAGCCTCTA | 58.1 | 262 | 298 | N/A | N/A | N/A | CP032667.1 | 1525852 | 1526113 | 31575 | 517 |
| Reverse | TTGCTGTTTTATCATGGC | 56 | ||||||||||||
| SLIM v2 | B21_01711 | Forward | MTTGTGGCAATWTCTTGAYG | 58.3 | 279 | 315 | N/A | N/A | N/A | CP032667.1 | 2045846 | 2045568 | 31562 | 165 |
| Reverse | AARTTGGCRACHACCTTCG | 61.4 |
ColiSeq amplification and sequencing of clinical samples
Two different PCR master mixes—Promega PCR Master Mix (Promega Corporation, Madison, Wisconsin, United States) and KAPA2G Fast Multiplex PCR Mastermix (Roche, Indianapolis, IN)—were evaluated for the amplicon sequencing multiplex PCR; the master mix with the strongest amplification band was selected on a per sample basis. Promega/Kapa2G 2× pre-mixed master mixes were used in a final 1× concentration in the final PCR and water was added to bring the volume of each reaction to 22.5 µL prior to adding 2.5 µL of template DNA. The PCR conditions consisted of an initial denaturation at 95°C for 3 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 65°C for 30 s, and extension at 72°C for 90 s.
The PCR product underwent two 1.5× AmpPure bead (Beckman Coulter Cat# A63880) purifications, consecutively. The bead-cleaned products were then indexed with 8 bp indices in a second PCR amplification. 2× Kapa HiFi HotStart ReadyMix (Roche, Indianapolis, IN) was diluted to 1× and mixed with 1 µM of forward and reverse indexing oligo. Two microliters of purified PCR product was added, and the reaction was brought to 25 µL with water. Thermocycler conditions included an initial denaturation step of 98°C for 2 min followed by 6 cycles of a 98°C denaturation step for 30 s, a 60°C annealing step for 20 s, and a 72°C extension step for 30 s. These six cycles were followed by a final extension step of 72°C for 5 min.
After indexing, another 1.5× bead purification was performed, and the products were normalized for multiplexed sequencing with the Invitrogen SequalPrep Normalization 96-well plate kit (ThermoFisher Cat# A1051001), following manufacturer’s directions. After the samples were eluted, they were pooled together and a 1× bead clean-up was performed on the pool. When eluting the DNA off the beads with Tris-tween, 1/10th of the initial pool volume was used to elute and concentrate the pool. The final pool was quantified on a Qubit 4 Fluorometer (ThermoFisher Cat# Q33226) and sequenced on the Illumina MiSeq platform.
Analysis of ColiSeq amplicon sequence variants for clinical samples
Following Illumina sequencing, amplicon sequence variants (ASVs) of the SLIMv2 were identified with QIIME2 v2022.2.0 (62). The exact commands used to process the amplicon data and identify ASVs with QIIME are available for full reproducibility (https://gist.github.com/jasonsahl/bca2067afd954853b25f51803f1aa18c#file-slim_qiime_commands-txt).
ColiSeq cost estimates
Costs associated with the ColiSeq assay were estimated on a per sample basis (Table S4). The cost estimations are based on a range of sequencing depths and are current to November 2023 prices.
WG-FAST database development and data analysis for reference genomes and clinical samples
Urine samples were genotyped based on a partial set of single-nucleotide polymorphisms in ColiSeq amplicons using WG-FAST. The reference set of 461 dereplicated genomes (Table S1), genomes from a recent study of E. coli in Flagstaff (n = 1,335) (23), and a set of genomes generated as part of this study (n = 37, see methods below) were aligned against MG1655 with NUCmer within NASP. A phylogeny was inferred from the concatenated SNP data with FastTree2 v2.1.11 (41, 42). To obtain the targeted set of SNPs from the ColiSeq assay, the NASP matrix was filtered to only include positions present in the ColiSeq amplicons. All clinical ColiSeq data were then placed into the WGS phylogeny with WG-FAST at a minimum depth of coverage of 3×, which allows for genotyping at low-coverage loci. Publicly available genome assemblies that were not closely related to urine sample genotypes were removed from the data set, and the WG-FAST process was repeated with the following exceptions: the core genome SNP tree was generated with IQ-TREE v2.2.2.3 (63, 64), and both clinical sample data and WGS data were inserted into the phylogeny with WG-FAST to determine if the placements of each data type within the tree were consistent.
Limit of detection for ColiSeq assay
To determine the limit of detection (LOD) of the multiplexed ColiSeq assay, three sample DNAs were quantified on a Qubit 4 Fluorometer (ThermoFisher Cat# Q33226), diluted, amplified with the ColiSeq assay, and sequenced on the Illumina MiSeq platform. Samples included in the LOD analysis include an ST131 isolate (FMC_UTI_02545:SAMN04414795), an ST10 isolate (HS-U-736-I-03:SAMN35335793), and a ST404 isolate (HS-U-877-I-03:SAMN35335903). The number of genomic equivalents was calculated by using the genome assembly size and assuming that the mass of a DNA base pair is 650 daltons. The breadth of coverage was calculated with SAMtools across each amplicon in the multiplex at a minimum depth of 3× and values >80% were considered to be present.
In silico limit of detection for ColiSeq assay
Reads were randomly subsampled from the isolate genome HS-U-000681 (SRR24939606) at a range of depths (100–1,000 paired reads, stepping by 100) with seqtk v1.3 (https://github.com/lh3/seqtk), and the breadth of coverage across amplicons was calculated with SAMtools at 3× depth; the number of subsampled data sets (100 reads) with a breadth >80% was identified and plotted.
ASAP analysis
The ColiSeq data for clinical samples were also analyzed with the ASAP pipeline (https://github.com/TGenNorth/ASAP) using the “ASAP_assaydetails_tsv.xsl” output transform format (https://github.com/TGenNorth/ASAP/tree/public/output_transforms). This allows for easy visualization of the number of reads and coverage breadth for presence/absence assays. For SNP assays, the number of reads, coverage breadth, SNP position, depth of coverage, reference call, and percentage of calls for each nucleotide at each SNP position were reported. Mixtures/co-infections were identified by >10% minor allele frequency.
Whole-genome sequencing
For whole-genome sequencing, sample selection was restricted to urine samples that grew red colonies on MacConkey agar. Using ColiSeq data analyzed by WG-FAST, a diversity of samples from across the global phylogeny in proximity to other Flagstaff UTI and E. coli positive food samples (23) were selected. For these samples, DNA was extracted from a single colony that grew on MacConkey agar at 37°C overnight with GenElute (NA2110-1KT). Approximately 250 ng of DNA was prepared for sequencing on the Illumina MiSeq platform.
Enterobacterial repetitive intergenic consensus PCR and targeted mixture sequencing
Using the ASAP analysis data, possible mixtures were interrogated further using the enterobacterial repetitive intergenic consensus (ERIC) PCR assay. The ERIC PCR assay amplifies regions between neighboring repetitive elements, which generates DNA fingerprints that enable the differentiation of Enterobacterial species and strains (65). Using the ASAP results, a total of 10 samples were chosen to examine possible mixtures within samples: HS-U-000720, HS-U-000728, HS-U-000855, HS-U-000910, HS-U-000940, HS-U-000942, HS-U-000946, HS-U-000973, HS-U-000765, and HS-U-000962. Five isolation streaks were made for each sample on MacConkey agar plates from MacConkey populations in LB + 20% glycerol stocks. The isolation streaks were incubated at 37°C overnight. After incubation, 20 single colonies were picked using an inoculation needle for each sample and swirled into 15 µL of molecular grade water. Quarter lawns were made for each single colony as well by streaking the single colony on a quarter of a MacConkey agar plate prior to swirling it in the water and incubating the plates at 37°C. The single colonies underwent a boil at 95°C for 10 min, followed by centrifugation at 2,200 rcf for 1 min. The boiled product was then used as input for the ERIC assay with the following protocol: 1× Q5 Hot PCR Master Mix, 1.5 µL gDNA template, and 10 µM ERIC2 and ERIC1R primers. Specific PCR parameters were as follows: initial denaturation at 98°C for 2 min, 35 cycles of denaturation at 98°C for 10 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, with a final extension at 72°C for 2 min. The PCR product was run on a 1% Lithium Borate agarose gel at 200 V for approximately 1 h using a 1 kb ladder and then viewed with a Bio-rad Gel Doc. Gel images were examined to determine if there were multiple unique banding patterns within a single sample across the 20 colonies. For two samples (HS-U-000946, HS-U-000720) that had multiple banding patterns, each colony that contained a unique pattern underwent a gDNA extraction using the quarter lawns generated in the single colony picking described above and was sequenced on the Illumina MiSeq platform.
RESULTS
The goal of this study was to develop a method to rapidly and inexpensively detect and genotype E. coli directly from clinical samples. We developed a multiplex, amplicon sequencing assay (ColiSeq), guided by comparative genomics, that can be used for high-throughput genotyping of E. coli in complex samples. The ColiSeq assay targets a region for determining E. coli presence/absence, 2 regions determined to be highly informative for differentiating E. coli strains [single locus informative marker (SLIM); SLIMv1 and SLIMv2], and 10 SNP loci that provide maximum resolution of E. coli strains [minimal spanning set (MSS)].
ColiSeq assay development and testing
An in silico PCR screen of ColiSeq primers designed in this study (Table 1) against a diverse set of reference genomes demonstrates that MSS and SLIM assays broadly amplify both E. coli and near-neighbor species, while the E. coli species marker was specific to E. coli (Table 1).
To demonstrate that SNPs targeted in the ColiSeq assay can provide accurate genotypic information, a reference set of E. coli genome assemblies (n = 516) (Table S1) was aligned against ColiSeq target amplicons used in this study and 435 SNPs were identified. The resulting phylogeny demonstrates that many of the primary phylogroups were recovered, and the amplicon tree was generally consistent with the core genome phylogeny (Fig. S2).
To demonstrate the ability of the ColiSeq amplicons to provide strain level resolution, the C227-11 STEC genome was downloaded, aligned to ColiSeq amplicons, and placed into an existing phylogeny of reference genomes (56) with WG-FAST. The results demonstrate that C227-11 grouped in phylogroup B1 with E. coli 55989 (Fig. 1), a result that is consistent with the whole-genome analysis (57) and demonstrates the power of SNPs in the ColiSeq amplicons to accurate type strains.
Fig 1.
The placement of sample C227-11 (57) (shown in red), only including ColiSeq positions, into a maximum-likelihood phylogeny of reference E. coli genomes (56). SNPs were identified by NASP (38) and the reference genome was MG1655 (accession: NC_000913.2). Phylogroups are labeled in blue.
Comparison of ColiSeq with MLST
For the pubMLST system, seven genes are typically amplified with PCR and Sanger sequenced; a concatenation of genes extracted from genomes analyzed in this study (n = 461) consists of 3,423 nucleotides and 602 SNPs. The ColiSeq system includes 2,445 nucleotides and 691 SNPs from the same set of genomes. A comparison of phylogenies with the unweighted Robinson-Foulds (RF) metric demonstrated that the ColiSeq phylogeny was more similar to the whole-genome phylogeny (RF = 878) compared to the concatenated MLST phylogeny (RF = 1838).
Amplicon sequence coverage of ColiSeq data across clinical urine samples
Of the 294 clinical urine samples that were collected, adequate DNA was extracted and analyzed from 230 samples (Table S3). After PCR amplification with the ColiSeq multiplex assay and sequencing on the Illumina MiSeq platform, the breadth of coverage (minimum 3×) of all clinical data sets across the predicted amplicons demonstrated that broad coverage was generally observed across amplicons (Table S5). One amplicon, B21_01903, showed low breadth of coverage in 29 urine samples; an in silico screen across >31,000 reference E. coli genomes (Table 1) also demonstrated that many isolate DNAs would not amplify with the B21_01903 primers designed in this study (Table 1). An investigation into genomes that would be missed with this assay revealed that 85% of genomes (n = 5,002) from phylogroup B2 would not amplify with this primer set; the majority of UPEC fall within this phylogroup (21). This target could be removed from the multiplex assay but could also be included to provide additional resolution in genomes that contain this target.
Amplified samples in this study were sequenced to a high depth (e.g., ~85,000 paired end reads per sample). However, a sub-sampling test demonstrated that as few as 100 randomly selected reads can provide coverage across many amplicon targets, including one that is unique to E. coli (Fig. 2). The cost of processing a single sample with the ColiSeq assay was estimated between $20 and $28 depending on sequencing depth (Table S4).
Fig 2.
The number of randomly sampled data sets (of 100), at 100 reads, that have a breadth of coverage greater than 80% (at 3× depth) across ColiSeq amplicons.
Single locus informative marker performance and mixture detection
The SLIMv2 variants were identified with QIIME2 across all clinical urine samples, resulting in 30 amplicon sequence variants (ASV) (Table S6) called across 219 samples (Table S7); 11 of the 230 samples did not have enough coverage across the SLIMv2 amplicon to facilitate genotyping based on the QIIME2 ASV approach. An analysis based on extracting the SLIMv2 from reference E. coli genomes demonstrated that many SLIM alleles were identical across multiple genotypes (Table S2), suggesting limited resolution within those alleles.
For 11 samples (HS-U-000946, HS-U-000727, HS-U-000770, HS-U-000810, HS-U-000855, HS-U-000868, HS-U-000878, HS-U-000682, HS-U-000699, HS-U-000720, HS-U-000940), multiple SLIM ASVs were identified (Table S7), suggesting a mixture of E. coli genotypes. An analysis with ASAP across multiple loci (MSS SNP sites) confirmed mixtures for six of these samples (Table S8); the discordance between methods is not surprising as the ASAP output only includes a single nucleotide locus per amplicon and the SLIM ASV includes the entire amplicon. ASAP also identified mixtures in two additional samples (HS-U-000942, HS-U-000973), demonstrating the power of incorporating additional loci when analyzing mixed samples. To confirm mixtures based on ASAP results, an analysis was performed using ERIC PCR and multiple genotypes were observed for all samples; for two of these samples (HS-U-000720, HS-U_000946), multiple whole genomes were generated and separate genotypes were identified (Table S3).
Among the 219 urine samples processed with QIIME2, the most common SLIM ASV (4bebf4b720a328bb27991c67bdd0c3a2) was associated with an allele representing >160 STs (SLIM variant 4 in Table S2), which obscures definitive genotyping. The second most common SLIM ASV in the clinical urine sample data set (5e070755c3418ef0eaf26ce443097dd0) was associated with a ST that includes ST131 (SLIMv2 variant 7; Table S2), a sequence type commonly observed in UTI samples (66).
Comparing genotype resolution between ColiSeq and WGS using WG-FAST
To demonstrate the potential of ColiSeq to provide strain-level resolution on clinical samples, 36 samples with paired WGS and AmpSeq data were processed with WG-FAST; only the core genome of K12 MG1655 was used for genotyping, which limits the amount of resolution available from the entire E. coli pan-genome. The results demonstrate that 32 ColiSeq data sets were consistent with the WGS data, 1 was a near miss, and 3 samples were total misses (Fig. 3; Fig. S3; Table S3). An example of a clinical sample with a genotype matching WGS data and an example of a sample with a genotype inconsistent with WGS data are provided in panel B of Fig. 3. Sample HS-U-000720 was a confirmed mixture for which two isolates were whole-genome sequenced. Although mixed genotypes have been shown to confound accurate phylogenetic placement with WG-FAST (55), especially when present in nearly equal proportions (e.g., 60/40), this sample is appropriately genotyped as one of the isolates sequenced from this sample (Figure S3). A lack of coverage across reference positions and mixtures of multiple strains are two demonstrated explanations for the relatively poor genotyping placement for a subset of samples.
Fig 3.
A maximum-likelihood phylogeny including reference genomes as well as samples amplified with ColiSeq (inserted into phylogeny with WG-FAST). Panel A demonstrates the placement of 230 clinical urine samples (red) within a core genome SNP phylogeny of E. coli isolates. The phylogeny includes whole-genome sequenced isolates from 36 of the clinical urine samples (teal; WGS, blue; WG-FAST using WGS data) to determine if ColiSeq genotyping is consistent with WGS data. Stars indicate ColiSeq genotypes matching WGS data. Phylogroups are labeled in black. Panel B corresponds to the black box in panel A. A clinical sample (HS-U-000736) with a ColiSeq genotype matching WGS data and a clinical sample (HS-U-000878) with a ColiSeq genotype inconsistent with WGS data are shown. Arrows indicate the ColiSeq data and WGS data for sample HS-U-000878.
All additional urine samples processed in this study were placed into the phylogeny with WG-FAST (WG-FAST failed to place sample HS-U-000866 into the phylogeny due to low coverage and a lack of distinguishing SNP calls). The ST for the closest match was recorded (Table S3) based on the phylogeny (Figure S3); in some cases, the matching ST could not be determined based on the phylogeny. For clinical samples where the putative ST was derived from the phylogenetic placement, the dominant STs were ST131 and ST69; other common STs were ST12, ST95, and ST73. Sixteen clinical samples were placed within a clade that includes ST14, ST404, and ST1193. Frequently identified sequence types in this study overlap with the most common STs in human cases (ST131, ST95, ST73, and ST69) identified in a recently published study (23) that sampled E. coli from meat and UTIs in Flagstaff several years prior to the sampling conducted as part of this study.
ColiSeq limit of detection
The E. coli species marker was consistently identified in each dilution down to ~2 genome equivalent (GE) per milliliter (Table S9); these metrics were based on breadth of coverage at a minimum depth of 3×. For the MSS targets, a 1:1,000 dilution (~170 GEs per µL) generally returned enough amplification to call positives and accurately genotype UPEC.
Whole-genome sequencing of select isolates
Based on the ColiSeq analysis of urine samples compared to previous UTI samples obtained from Flagstaff, 40 isolates representing the diversity of observed strains and potential mixtures were obtained from clinical urines and whole genome sequenced. For sequenced isolates, 20 unique STs were identified (Table S3), including two novel STs (ST11973, ST11974); the most common ST was ST131 (n = 8). For two samples (HS-U-000720 and HS-U-000946), multiple genomes were sequenced and confirmed the presence of multiple STs within the sample (Table S3).
DISCUSSION
In this study, we describe the development and validation of a multiplexed amplicon sequencing assay known as ColiSeq to amplify and genotype Escherichia coli directly from clinical samples. Although all validation in this study was performed on UTI samples, ColiSeq should work on other sample types, including clinical diarrheal samples, although additional validation would be needed, including with deconvolution of mixed strains in stool. The ColiSeq assay consists of 13 amplicons designed to provide genotyping in a rapid, inexpensive, and highly multiplexed assay. The system is dynamic, and new amplicon targets [e.g., AMR markers, informative mobile genetic elements (23), or pathovar-specific markers] can be easily added as needed.
In silico experimentation demonstrated the utility of ColiSeq for genotyping E. coli. We successfully placed C227-11, a strain associated with an E. coli outbreak in 2011 (67), into a phylogeny of reference genomes (56), and the results were highly consistent with genotyping using the complete genome (57) (Fig. 1). The ColiSeq assay targets contain enough polymorphic information to infer a phylogeny that is generally congruent with the core genome phylogeny (Figure S2). Although other sub-genomic methods, such as multi-locus sequence typing, have been used for genotyping from urine (68), the sequence type alone cannot confirm transmission, and a phylogeny inferred from the concatenated MLST alignment can be highly discordant with whole genome phylogenetics (45). This incongruence is demonstrated in the analysis of a representative set of E. coli genomes, where B2 generally groups together across methods, while phylogroup A is more dispersed throughout the phylogeny using MLST markers (Figure S2). Sub-genomic methods, including MLST and ColiSeq, can be used to exclude transmission events through the identification of divergent genotypes and reduce the need for WGS efforts to interrogate the whole genome in depth. Additionally, ColiSeq is easily sequenced on high-throughput sequencing platforms, like Illumina, whereas MLST provides fewer discriminatory SNPs and needs to be sequenced with longer reads (e.g., 300 nts), to recover the larger amplicons.
We validated the ColiSeq assay on 230 clinical urine samples to show that it can accurately genotype E. coli directly from clinical specimens. We built a phylogeny using amplicon sequences from the ColiSeq assay, a set of reference genomes, whole genomes generated as part of this study, and a set of genomes analyzed from urine and food samples from Flagstaff (23). The placement of ColiSeq amplified samples was consistent with corresponding WGS samples (Fig. 3), indicating the potential for using sub-genomic data in source attribution applications. Additionally, many samples were placed within clades with the major pandemic UPEC clones (Fig. S3); these include ST131, ST73, ST69, and ST95 (69). These same STs were found previously in urine and food samples from Flagstaff (23), indicating that these genotypes are circulating in the Flagstaff community and are temporally stable.
Knowledge of strain mixtures within a sample can be important when monitoring recurrent UTIs or considering treatment options as multidrug-resistant UPEC strains could defy some antibiotic regimens. Strain mixtures of multiple genotypes were identified directly from urine samples using the ColiSeq assay. To address the difficulties of identifying strain mixtures within samples, we identified single locus informative markers (SLIMv1 and SLIMv2) that can be evaluated in conjunction with MSS loci for mixture deconvolution. The SLIMv2 analysis identified mixtures in 11 samples, with 6 of these confirmed by orthogonal approaches including ASAP and ERIC. Additionally, the SLIMs and 9 of the 10 MSS loci are widely conserved across known E. coli genomes (Table 1), suggesting that they could be used to compare E. coli across a range of complex samples, which could include not only clinical samples but other sample types as well (e.g., wastewater, agricultural or environmental). For some E. coli genotypes, the SLIM offers only broad genotyping resolution, while for other genotypes, the SLIM designation is likely to be highly specific. When the SLIM is combined with additional loci, the genotyping resolution improves which could allow for surveying E. coli in complex backgrounds.
As part of this work, we identified an E. coli species marker that is highly conserved in the species and is absent from near neighbor Escherichia genomes, including known cryptic species (70); this marker is associated with the yfdX gene, which has no known function (71). In a limit of detection (LOD) analysis, the E. coli species marker assay could detect the pathogen directly from urine down to <2 genomic equivalents (GE) per milliliter (Table S9), which could be effective at detecting even very early infections. For other ColiSeq targets, ~1.7 × 105 GEs/mL would result in detection as well as genotyping, which is consistent with the concentration of E. coli in confirmed UTIs (72). The assay should also be applicable to other sample types with similar or higher E. coli loads (e.g., stool samples, wastewater). Sub-sampling reads from a known sample demonstrated that as few as 100 paired reads could provide accurate genotyping (Fig. 2), potentially allowing thousands of samples to be efficiently and inexpensively combined on a single sequencing run.
The direct detection of E. coli from clinical samples, including urine, can produce rapid, actionable results without the need to culture. Recently, work has demonstrated the power of linking UTI isolates with zoonotic UPEC found in food (23), suggesting that ColiSeq could serve as a powerful tool to genotype directly from specimens, guiding contact tracing and source attribution efforts by identifying potential E. coli transmission events without the need to culture and whole-genome sequence the pathogen. Once potential matches are identified with ColiSeq; WGS and pan-genome analyses could then identify transmission and outbreak tracing by taking maximum advantage of the known diversity of E. coli. The ability to deconvolute mixtures and perform high-resolution genotyping will also help monitor recurrent UTIs (73), which may help guide treatment decisions. As sequence-based clinical diagnostics become more mainstream, ColiSeq will represent a powerful tool to monitor clinical UTIs and focus intervention, surveillance, and decontamination efforts to reduce the frequency of transmission events.
ACKNOWLEDGMENTS
We acknowledge staff at the Flagstaff Medical Center for preparing samples for transfer to NAU.
This research was supported by the Arizona Biomedical Research Centre New Investigator Awards (CTR056052, ADHS16-162398).
Contributor Information
Jason W. Sahl, Email: jason.sahl@nau.edu.
Shannon D. Manning, Michigan State University, East Lansing, Michigan, USA
DATA AVAILABILITY
Sequence data generated as part of this study were deposited under BioProject PRJNA853792.
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/spectrum.04139-23.
Saturation curve for minimal spanning set analysis.
Comparison of phylogenies inferred from different data types.
A tree showing the results of a WG-FAST analysis.
Tables S1 to S9.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Martinson JNV, Walk ST. 2020. Escherichia coli residency in the gut of healthy human adults. EcoSal Plus 9. doi: 10.1128/ecosalplus.ESP-0003-2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Yu C, Cao Y, Zou H, Xian M. 2011. Metabolic engineering of Escherichia coli for biotechnological production of high-value organic acids and alcohols. Appl Microbiol Biotechnol 89:573–583. doi: 10.1007/s00253-010-2970-z [DOI] [PubMed] [Google Scholar]
- 3. Blount ZD. 2015. The unexhausted potential of E. coli. Elife 4:e05826. doi: 10.7554/eLife.05826 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Kim KS. 2016. Human meningitis-associated Escherichia coli. EcoSal Plus 7. doi: 10.1128/ecosalplus.ESP-0015-2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Griffin PM, Tauxe RV. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol Rev 13:60–98. doi: 10.1093/oxfordjournals.epirev.a036079 [DOI] [PubMed] [Google Scholar]
- 6. Bunduki GK, Heinz E, Phiri VS, Noah P, Feasey N, Musaya J. 2021. Virulence factors and antimicrobial resistance of uropathogenic Escherichia coli (UPEC) isolated from urinary tract infections: a systematic review and meta-analysis. BMC Infect Dis 21:753. doi: 10.1186/s12879-021-06435-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Clarke SC. 2001. Diarrhoeagenic Escherichia coli--an emerging problem? Diagn Microbiol Infect Dis 41:93–98. doi: 10.1016/s0732-8893(01)00303-0 [DOI] [PubMed] [Google Scholar]
- 8. Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. 2015. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nat Rev Microbiol 13:269–284. doi: 10.1038/nrmicro3432 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Mulvey MA, Schilling JD, Hultgren SJ. 2001. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect Immun 69:4572–4579. doi: 10.1128/IAI.69.7.4572-4579.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Foxman B, Barlow R, D’Arcy H, Gillespie B, Sobel JD. 2000. Urinary tract infection: self-reported incidence and associated costs. Ann Epidemiol 10:509–515. doi: 10.1016/s1047-2797(00)00072-7 [DOI] [PubMed] [Google Scholar]
- 11. Foxman B, Brown P. 2003. Epidemiology of urinary tract infections: transmission and risk factors, incidence, and costs. Infect Dis Clin North Am 17:227–241. doi: 10.1016/s0891-5520(03)00005-9 [DOI] [PubMed] [Google Scholar]
- 12. Neugent ML, Hulyalkar NV, Nguyen VH, Zimmern PE, De Nisco NJ. 2020. Advances in understanding the human urinary microbiome and its potential role in urinary tract infection. mBio 11:e00218-20. doi: 10.1128/mBio.00218-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Simões e Silva AC, Oliveira EA, Mak RH. 2020. Urinary tract infection in pediatrics: an overview. J Pediatr 96:65–79. doi: 10.1016/j.jped.2019.10.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Johnson JR. 2004. Laboratory diagnosis of urinary tract infections in adult patients. Clin Infect Dis 39:873. doi: 10.1086/423844 [DOI] [PubMed] [Google Scholar]
- 15. Rubin RH, Shapiro ED, Andriole VT, Davis RJ, Stamm WE. 1992. Evaluation of new anti-infective drugs for the treatment of urinary tract infection. Clin Infect Dis 15:S216–S227. doi: 10.1093/clind/15.Supplement_1.S216 [DOI] [PubMed] [Google Scholar]
- 16. Jadhav SR, Shah RM, Karpe AV, Morrison PD, Kouremenos K, Beale DJ, Palombo EA. 2018. Detection of foodborne pathogens using proteomics and metabolomics-based approaches. Front Microbiol 9:3132. doi: 10.3389/fmicb.2018.03132 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Ward DV, Scholz M, Zolfo M, Taft DH, Schibler KR, Tett A, Segata N, Morrow AL. 2016. Metagenomic sequencing with strain-level resolution implicates uropathogenic E. coli in necrotizing enterocolitis and mortality in preterm infants. Cell Rep 14:2912–2924. doi: 10.1016/j.celrep.2016.03.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gasiorek M, Hsieh MH, Forster CS. 2019. Utility of DNA next-generation sequencing and expanded quantitative urine culture in diagnosis and management of chronic or persistent lower urinary tract symptoms. J Clin Microbiol 58:e00204-19. doi: 10.1128/JCM.00204-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Herring CD, Raghunathan A, Honisch C, Patel T, Applebee MK, Joyce AR, Albert TJ, Blattner FR, van den Boom D, Cantor CR, Palsson BØ. 2006. Comparative genome sequencing of Escherichia coli allows observation of bacterial evolution on a laboratory timescale. Nat Genet 38:1406–1412. doi: 10.1038/ng1906 [DOI] [PubMed] [Google Scholar]
- 20. Pasquali F, Remondini D, Snary EL, Hald T, Guillier L. 2021. Editorial: integrating whole genome sequencing into source attribution and risk assessment of foodborne bacterial pathogens. Front Microbiol 12:795098. doi: 10.3389/fmicb.2021.795098 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Halaji M, Fayyazi A, Rajabnia M, Zare D, Pournajaf A, Ranjbar R. 2022. Phylogenetic group distribution of uropathogenic and related antimicrobial resistance pattern: a meta-analysis and systematic review. Front Cell Infect Microbiol 12:790184. doi: 10.3389/fcimb.2022.790184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Kudinha T, Johnson JR, Andrew SD, Kong F, Anderson P, Gilbert GL. 2013. Escherichia coli sequence type 131 as a prominent cause of antibiotic resistance among urinary Escherichia coli isolates from reproductive-age women. J Clin Microbiol 51:3270–3276. doi: 10.1128/JCM.01315-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Liu CM, Aziz M, Park DE, Wu Z, Stegger M, Li M, Wang Y, Schmidlin K, Johnson TJ, Koch BJ, Hungate BA, Nordstrom L, Gauld L, Weaver B, Rolland D, Statham S, Hall B, Sariya S, Davis GS, Keim PS, Johnson JR, Price LB. 2023. Using source-associated mobile genetic elements to identify zoonotic extraintestinal E. coli infections. One Health 16:100518. doi: 10.1016/j.onehlt.2023.100518 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Ahmed D, Wahid SUH, Sadique T, Sultana N, Islam M, Halim F, Islam N, Hossain A. 2014. Recurrent urinary tract infection due to co‐Infection with extended spectrum β‐lactamase‐producer uropathogenic Escherichia coli and enteroaggregative E. coli. JMM Case Rep 1. doi: 10.1099/jmmcr.0.001404 [DOI] [Google Scholar]
- 25. Sahl JW, Sistrunk JR, Fraser CM, Hine E, Baby N, Begum Y, Luo Q, Sheikh A, Qadri F, Fleckenstein JM, Rasko DA. 2015. Examination of the enterotoxigenic Escherichia coli population structure during human infection. mBio 6:e00501. doi: 10.1128/mBio.00501-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Karmali MA, Petric M, Lim C, Cheung R, Arbus GS. 1985. Sensitive method for detecting low numbers of verotoxin-producing Escherichia coli in mixed cultures by use of colony sweeps and polymyxin extraction of verotoxin. J Clin Microbiol 22:614–619. doi: 10.1128/jcm.22.4.614-619.1985 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Pearson T, Sahl JW, Hepp CM, Handady K, Hornstra H, Vazquez AJ, Settles E, Mayo M, Kaestli M, Williamson CHD, Price EP, Sarovich DS, Cook JM, Wolken SR, Bowen RA, Tuanyok A, Foster JT, Drees KP, Kidd TJ, Bell SC, Currie BJ, Keim P. 2020. Pathogen to commensal? Longitudinal within-host population dynamics, evolution, and adaptation during a chronic >16-year Burkholderia pseudomallei infection. PLoS Pathog 16:e1008298. doi: 10.1371/journal.ppat.1008298 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Pulido-Tamayo S, Sánchez-Rodríguez A, Swings T, Van den Bergh B, Dubey A, Steenackers H, Michiels J, Fostier J, Marchal K. 2015. Frequency-based haplotype reconstruction from deep sequencing data of bacterial populations. Nucleic Acids Res 43:e105. doi: 10.1093/nar/gkv478 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Watanabe N, Kryukov K, Nakagawa S, Takeuchi JS, Takeshita M, Kirimura Y, Mitsuhashi S, Ishihara T, Aoki H, Inokuchi S, Imanishi T, Inoue S. 2018. Detection of pathogenic bacteria in the blood from sepsis patients using 16S rRNA gene amplicon sequencing analysis. PLoS One 13:e0202049. doi: 10.1371/journal.pone.0202049 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, et al. 2016. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res 44:D733–D745. doi: 10.1093/nar/gkv1189 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Ondov BD, Treangen TJ, Melsted P, Mallonee AB, Bergman NH, Koren S, Phillippy AM. 2016. Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol 17:132. doi: 10.1186/s13059-016-0997-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Riley M, Abe T, Arnaud MB, Berlyn MKB, Blattner FR, Chaudhuri RR, Glasner JD, Horiuchi T, Keseler IM, Kosuge T, Mori H, Perna NT, Plunkett G, Rudd KE, Serres MH, Thomas GH, Thomson NR, Wishart D, Wanner BL. 2006. Escherichia coli K-12: a cooperatively developed annotation snapshot--2005. Nucleic Acids Res 34:1–9. doi: 10.1093/nar/gkj405 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Guerrero-Araya E, Muñoz M, Rodríguez C, Paredes-Sabja D. 2021. FastMLST: a multi-core tool for multilocus sequence typing of draft genome assemblies. Bioinform Biol Insights 15:11779322211059238. doi: 10.1177/11779322211059238 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Clermont O, Christenson JK, Denamur E, Gordon DM. 2013. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep 5:58–65. doi: 10.1111/1758-2229.12019 [DOI] [PubMed] [Google Scholar]
- 35. Beghain J, Bridier-Nahmias A, Le Nagard H, Denamur E, Clermont O. 2018. ClermonTyping: an easy-to-use and accurate in silico method for Escherichia genus strain phylotyping. Microb Genom 4:e000192. doi: 10.1099/mgen.0.000192 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477. doi: 10.1089/cmb.2012.0021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, Salzberg SL. 2004. Versatile and open software for comparing large genomes. Genome Biol 5:R12. doi: 10.1186/gb-2004-5-2-r12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Sahl JW, Lemmer D, Travis J, Schupp JM, Gillece JD, Aziz M, Driebe EM, Drees KP, Hicks ND, Williamson CHD, Hepp CM, Smith DE, Roe C, Engelthaler DM, Wagner DM, Keim P. 2016. NASP: an accurate, rapid method for the identification of SNPs in WGS datasets that supports flexible input and output formats. Microb Genom 2:e000074. doi: 10.1099/mgen.0.000074 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–1313. doi: 10.1093/bioinformatics/btu033 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. doi: 10.1093/nar/25.17.3389 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Edgar RC. 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113. doi: 10.1186/1471-2105-5-113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Price MN, Dehal PS, Arkin AP. 2010. FastTree 2--approximately maximum-likelihood trees for large alignments. PLoS One 5:e9490. doi: 10.1371/journal.pone.0009490 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Robinson DF, Foulds LR. 1981. Comparison of phylogenetic trees. Math Biosci 53:131–147. doi: 10.1016/0025-5564(81)90043-2 [DOI] [Google Scholar]
- 44. Sukumaran J, Holder MT. 2010. DendroPy: a Python library for phylogenetic computing. Bioinformatics 26:1569–1571. doi: 10.1093/bioinformatics/btq228 [DOI] [PubMed] [Google Scholar]
- 45. Sahl JW, Matalka MN, Rasko DA. 2012. Phylomark, a tool to identify conserved phylogenetic markers from whole-genome alignments. Appl Environ Microbiol 78:4884–4892. doi: 10.1128/AEM.00929-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF. 2009. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75:7537–7541. doi: 10.1128/AEM.01541-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Furstenau TN, Cocking JH, Sahl JW, Fofanov VY. 2018. Variant site strain typer (VaST): efficient strain typing using a minimal number of variant genomic sites. BMC Bioinformatics 19:222. doi: 10.1186/s12859-018-2225-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Sahl JW, Caporaso JG, Rasko DA, Keim P. 2014. The large-scale blast score ratio (LS-BSR) pipeline: a method to rapidly compare genetic content between bacterial genomes. PeerJ 2:e332. doi: 10.7717/peerj.332 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Rasko DA, Myers GSA, Ravel J. 2005. Visualization of comparative genomic analyses by BLAST score ratio. BMC Bioinformatics 6:2. doi: 10.1186/1471-2105-6-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012. Primer3--new capabilities and interfaces. Nucleic Acids Res 40:e115. doi: 10.1093/nar/gks596 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Owczarzy R, Tataurov AV, Wu Y, Manthey JA, McQuisten KA, Almabrazi HG, Pedersen KF, Lin Y, Garretson J, McEntaggart NO, Sailor CA, Dawson RB, Peek AS. 2008. IDT SciTools: a suite for analysis and design of nucleic acid oligomers. Nucleic Acids Res 36:W163–W169. doi: 10.1093/nar/gkn198 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Waterhouse AM, Procter JB, Martin DMA, Clamp M, Barton GJ. 2009. Jalview version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189–1191. doi: 10.1093/bioinformatics/btp033 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Colman RE, Schupp JM, Hicks ND, Smith DE, Buchhagen JL, Valafar F, Crudu V, Romancenco E, Noroc E, Jackson L, Catanzaro DG, Rodwell TC, Catanzaro A, Keim P, Engelthaler DM. 2015. Detection of low-level mixed-population drug resistance in Mycobacterium tuberculosis using high fidelity amplicon sequencing. PLoS One 10:e0126626. doi: 10.1371/journal.pone.0126626 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Edgar RC. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26:2460–2461. doi: 10.1093/bioinformatics/btq461 [DOI] [PubMed] [Google Scholar]
- 55. Sahl JW, Schupp JM, Rasko DA, Colman RE, Foster JT, Keim P. 2015. Phylogenetically typing bacterial strains from partial SNP genotypes observed from direct sequencing of clinical specimen metagenomic data. Genome Med 7:52. doi: 10.1186/s13073-015-0176-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl S, Bidet P, Bingen E, Bonacorsi S, Bouchier C, Bouvet O, et al. 2009. Organised genome dynamics in the Escherichia coli species results in highly diverse adaptive paths. PLoS Genet 5:e1000344. doi: 10.1371/journal.pgen.1000344 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Grad YH, Lipsitch M, Feldgarden M, Arachchi HM, Cerqueira GC, Fitzgerald M, Godfrey P, Haas BJ, Murphy CI, Russ C, et al. 2012. Genomic epidemiology of the Escherichia coli O104:H4 outbreaks in Europe, 2011. Proc Natl Acad Sci U S A 109:3065–3070. doi: 10.1073/pnas.1121491109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Li H. 2018. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34:3094–3100. doi: 10.1093/bioinformatics/bty191 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup . 2009. The sequence alignment/map format and SAMtools. Bioinformatics 25:2078–2079. doi: 10.1093/bioinformatics/btp352 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Jolley KA, Bray JE, Maiden MCJ. 2018. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res 3:124. doi: 10.12688/wellcomeopenres.14826.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. 2019. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35:4453–4455. doi: 10.1093/bioinformatics/btz305 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm EJ, Arumugam M, Asnicar F, et al. 2019. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol 37:852–857. doi: 10.1038/s41587-019-0209-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R. 2020. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol 37:1530–1534. doi: 10.1093/molbev/msaa015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 14:587–589. doi: 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Gillings M, Holley M. 1997. Repetitive element PCR fingerprinting (rep-PCR) using enterobacterial repetitive intergenic consensus (ERIC) primers is not necessarily directed at ERIC elements. Lett Appl Microbiol 25:17–21. doi: 10.1046/j.1472-765x.1997.00162.x [DOI] [PubMed] [Google Scholar]
- 66. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Pendyala S, Debroy C, Nowicki B, Rice J. 2010. Escherichia coli sequence type ST131 as an emerging fluoroquinolone-resistant uropathogen among renal transplant recipients. Antimicrob Agents Chemother 54:546–550. doi: 10.1128/AAC.01089-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Frank C, Faber MS, Askar M, Bernard H, Fruth A, Gilsdorf A, Hohle M, Karch H, Krause G, Prager R, Spode A, Stark K, Werber D, HUS investigation team . 2011. Large and ongoing outbreak of haemolytic uraemic syndrome, Germany, May 2011. Euro Surveill 16:19878. doi: 10.2807/ese.16.21.19878-en [DOI] [PubMed] [Google Scholar]
- 68. Matsui Y, Hu Y, Rubin J, de Assis RS, Suh J, Riley LW. 2020. Multilocus sequence typing of Escherichia coli isolates from urinary tract infection patients and from fecal samples of healthy subjects in a college community. Microbiologyopen 9:1225–1233. doi: 10.1002/mbo3.1032 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Riley LW. 2014. Pandemic lineages of extraintestinal pathogenic Escherichia coli. Clin Microbiol Infect 20:380–390. doi: 10.1111/1469-0691.12646 [DOI] [PubMed] [Google Scholar]
- 70. Walk ST, Alm EW, Gordon DM, Ram JL, Toranzos GA, Tiedje JM, Whittam TS. 2009. Cryptic lineages of the genus Escherichia. Appl Environ Microbiol 75:6534–6544. doi: 10.1128/AEM.01262-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Nishino K, Inazumi Y, Yamaguchi A. 2003. Global analysis of genes regulated by EvgA of the two-component regulatory system in Escherichia coli . J Bacteriol 185:2667–2672. doi: 10.1128/JB.185.8.2667-2672.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Reyes S, Le N, Fuentes MD, Upegui J, Dikici E, Broyles D, Quinto E, Daunert S, Deo SK. 2020. An intact cell bioluminescence-based assay for the simple and rapid diagnosis of urinary tract infection. Int J Mol Sci 21:5015. doi: 10.3390/ijms21145015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Worby CJ, Olson BS, Dodson KW, Earl AM, Hultgren SJ. 2022. Establishing the role of the gut microbiota in susceptibility to recurrent urinary tract infections. J Clin Invest 132:e158497. doi: 10.1172/JCI158497 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Saturation curve for minimal spanning set analysis.
Comparison of phylogenies inferred from different data types.
A tree showing the results of a WG-FAST analysis.
Tables S1 to S9.
Data Availability Statement
Sequence data generated as part of this study were deposited under BioProject PRJNA853792.



