Classical swine fever virus non-structural protein 4A recruits dihydroorotate dehydrogenase to facilitate viral replication

ABSTRACT

Mitochondria are energy producers in cells, which can affect viral replication by regulating the host innate immune signaling pathways, and the changes in their biological functions are inextricably linked the viral life cycle. In this study, we screened a library of 382 mitochondria-targeted compounds and identified the antiviral inhibitors of dihydroorotate dehydrogenase (DHODH), the rate-limiting enzyme in the de novo synthesis pathway of pyrimidine ribonucleotides, against classical swine fever virus (CSFV). Our data showed that the inhibitors interfered with viral RNA synthesis in a dose-dependent manner, with half-maximal effective concentrations (EC₅₀) ranging from 0.975 to 26.635 nM. Remarkably, DHODH inhibitors obstructed CSFV replication by enhancing the innate immune response including the TBK1-IRF3-STAT1 and NF-κB signaling pathways. Furthermore, the data from a series of compound addition and supplementation trials indicated that DHODH inhibitors also inhibited CSFV replication by blocking the de novo pyrimidine synthesis. Remarkably, DHODH knockdown demonstrated that it was essential for CSFV replication. Mechanistically, confocal microscopy and immunoprecipitation assays showed that the non-structural protein 4A (NS4A) recruited and interacted with DHODH in the perinuclear. Notably, NS4A enhanced the DHODH activity and promoted the generation of UMP for efficient viral replication. Structurally, the amino acids 65–229 of DHODH and the amino acids 25–40 of NS4A were pivotal for this interaction. Taken together, our findings highlight the critical role of DHODH in the CSFV life cycle and offer a potential antiviral target for the development of novel therapeutics against CSF.

IMPORTANCE

Classical swine fever remains one of the most economically important viral diseases of domestic pigs and wild boar worldwide. dihydroorotate dehydrogenase (DHODH) inhibitors have been shown to suppress the replication of several viruses in vitro and in vivo, but the effects on Pestivirus remain unknown. In this study, three specific DHODH inhibitors, including DHODH-IN-16, BAY-2402234, and Brequinar were found to strongly suppress classical swine fever virus (CSFV) replication. These inhibitors target the host DHODH, depleting the pyrimidine nucleotide pool to exert their antiviral effects. Intriguingly, we observed that the non-structural protein 4A of CSFV induced DHODH to accumulate around the nucleus in conjunction with mitochondria. Moreover, NS4A exhibited a strong interaction with DHODH, enhancing its activity to promote efficient CSFV replication. In conclusion, our findings enhance the understanding of the pyrimidine synthesis in CSFV infection and expand the novel functions of CSFV NS4A in viral replication, providing a reference for further exploration of antiviral targets against CSFV.

INTRODUCTION

Classical swine fever (CSF) is a highly contagious and fatal disease of pigs and remains a major economic problem for the pig industry worldwide (1, 2). Domestic and wild boar are the only known natural hosts of classical swine fever virus (CSFV) (3). In the absence of a specific drug to effectively treat CSF, CSF elimination remains difficult in areas where CSF is endemic and re-emerging although a number of biosecurity and vaccination strategies have been developed to contain outbreaks (4, 5). Consequently, in addition to the implementation of improved biosecurity measures and research into more effective CSF vaccines, there is a need to develop effective anti-CSFV drugs (5). In addition, studies on anti-CSFV drugs can serve as a reference for other viruses in the Flaviviridae family, such as Hepatitis C virus (HCV), Dengue virus (DENV), and Zika virus (ZIKA).

The CSFV life cycle encompasses several key phases: attachment, receptor binding and entry, uncoating, protein translation and processing, RNA replication, virion morphogenesis, and virus release (6). Based on the above process of CSFV infection, the virus itself, RNA polymerase, host cells, and related signaling pathways can be used as targets for antiviral drug design (7). Among the available antiviral drugs against CSFV, those targeting viral proteins and corresponding structural domains are currently predominant and can provide protection against different genotypes of the virus (8). However, prolonged treatment may lead to the emergence of resistant and mutant strains. In contrast, antiviral strategies that target host receptors offer a broader comprehensive spectrum of antiviral activity without the emergence of drug resistance (9, 10). As the hub for pyruvate and fatty acid oxidation, the tricarboxylic acid (TCA) cycle, and the electron transport chain, mitochondria have become the main powerhouse of cellular energy, not only facilitating the synthesis of large molecular precursors essential for viral replication but also play a crucial role in the transmission of mitochondrial innate immune signals (11). As a result, drugs that target mitochondrial proteins are currently the focus of antiviral drug development (12, 13). DHODH is a rate-limiting enzyme in the de novo pyrimidine nucleotide synthesis pathway, and it is the only enzyme located on the outer surface of the inner mitochondrial inner membrane (MIM) during this process (14). Based on the permeability of the outer mitochondrial membrane to small molecules, DHODH can contact the substrate dihydroorotate (DHO) and MIM-bound coenzyme Q (CoQ), oxidizing DHO to orotate (ORO) while transferring electrons to ubiquinone to complete the catalytic cycle of the electron transport chain (15–17). This critical role makes DHODH more essential for viral replication and an attractive host target for antiviral agents.

Various DHODH inhibitors have been proven to inhibit viral infection both in vitro and in vivo, mainly by inhibiting viral proliferation through three mechanisms. DHODH inhibitors inhibit viral replication by impeding the synthesis of pyrimidine bases, especially from the early stage of virus replication. It was demonstrated that administration 300 µM Teriflunomide in a foot-and-mouth disease virus (FMDV)-infected IBRS-2 cell model markedly reduced 2B mRNA levels and VP1 viral protein expression in the early infection phase (0–4 h post-infection) (15). Additionally, DHODH inhibitors have been reported to increase the expression of interferon-stimulated genes (ISGs) to inhibit viral replication. Studies revealed that the addition of Brequinar to HEK293T cells infected with Peste Des Petits Ruminants Virus (PPRV) triggered the transcription of ISGs, a process independent of the classical JAK-STAT pathway and linked to the pyrimidine nucleotide depletion, as the addition of uridine entirely negates ISGs transcription (18). Another notable feature of DHODH inhibitors is that they can dampen cytokine storms and play a dual role of antiviral and anti-inflammatory effects during the mid to late stages of infection (19, 20). Leflunomide and Teriflunomide have been clinically used to treat autoimmune diseases and curb cytokine production and are also effective in moderating virus-induced hyperinflammation (21, 22). In a small trial on the treatment of COVID-19 patients, those treated with Leflunomide exhibited a significant reduction in C-reactive protein levels, signifying effectively managed immunopathological inflammation, without noticeable adverse effects (23).

In this study, we evaluated the antiviral activity of three DHODH inhibitors against CSFV. DHODH-IN-16, BAY-2402234, and Brequinar all showed potent antiviral activity against CSFV with EC₅₀ values in the low nanomolar range and a selectivity index (SI) greater than 100. Exactly, DHODH inhibitors did not affect the virus binding or entry but target the host pyrimidine biosynthesis process. Therefore, we explored the function of DHODH during CSFV replication. First, DHODH knockdown significantly inhibited CSFV replication, and DHODH overexpression promoted CSFV replication. Second, confocal microscopy revealed that CSFV infection caused mitochondria to perinuclear aggregation, while DHODH aggregation to the perinuclear area co-localized with mitochondria, which may be closely related to the involvement of NS4A. Moreover, there was a strong interaction between NS4A and DHODH for enhancing DHODH activity, suggesting the potential role of flavivirus NS4A in regulating host gene expression during infection. In conclusion, our findings elucidate the role of DHODH in CSFV infection and provide insights for determining molecular targets to develop antiviral drugs that inhibit CSFV infection.

RESULTS

DHODH is an effective target against CSFV infection

Mitochondria are vital dynamic organelles for energy production and play an important role in immune defense against viral infection. Many virus-encoded proteins interact with mitochondrial proteins and play a pivotal role in the intricate process of immune defense (24, 25). Therefore, we screened 382 compounds in the mitochondria-targeted compound library to find effective compounds against CSFV infection. Preliminary screening identified 13 compounds that effectively inhibit CSFV replication by up to 80.0%. Interestingly, 6 of these 13 compounds were the known inhibitors of DHODH, indicating DHODH as an anti-CSFV target. Among them, DHODH-IN-16, BAY-2402234, and Brequinar demonstrated significantly enhanced antiviral activity, making them prime candidates for further investigation (Fig. 1A through C). Our results showed that DHODH-IN-16 and BAY-2402234 were more effective than Brequinar in impairing CSFV replication, exhibiting 50% cytotoxic concentrations (CC₅₀) of 1,500 nM, while their 50% effective inhibitory concentrations (EC₅₀) against CSFV were around 1 nM. Brequinar, on the other hand, showed a CC₅₀ of around 1,500 nM, with an EC₅₀ against CSFV of around 26 nM. The selectivity index (SI = CC₅₀/EC₅₀) for all three drugs was greater than 100 (Fig. 1D). Overall, our data suggest that DHODH-IN-16, BAY-2402234, and Brequinar are potent and low-toxicity inhibitors against CSFV.

Fig 1.

The inhibitors are screened from the mitochondrial-targeted compound library. (A) Screening process for the compounds that inhibit CSFV replication. (B) Each dot represents the inhibition rate of the compound (1 µM) against CSFV (MOI of 1). (C) The fluorescence intensity of CSFV E2 for the 13 compounds screened against CSFV was expressed as relative fluorescence intensity. The red columns indicated the DHODH inhibitor. (D) CC₅₀, EC₅₀, and selectivity index (SI = CC₅₀/EC₅₀) values of six DHODH inhibitors against CSFV. Data are presented as the mean ± SD from three independent experiments. **P < 0.01.

DHODH is a broad-spectrum target of Flaviviridae

DHODH inhibitors have been shown to strongly inhibit the replication of various RNA viruses including SARS-CoV-2 (20), influenza virus (26), Ebola virus (EV) (27), and DENV (28). To further assess the efficiency of DHODH-IN-16, BAY-2402234, and Brequinar against CSFV replication in vitro, cells were infected with CSFV and subsequently treated with different concentrations of these compounds for 24 h. Results of reverse transcription real-time PCR (RT-qPCR) and Western blotting revealed that DHODH-IN-16, BAY-2402234, and Brequinar effectively impaired CSFV replication in a dose-dependent manner, without adversely affecting cell viability. Compared to the untreated group, DHODH-IN-16, BAY-2402234, and Brequinar reduced CSFV Npro expression by 95.0%, 93.0%, and 87.0%, and RNA copies by 93.9%, 90.5%, and 96.7% (Fig. 2A). Meanwhile, cells were fixed and subjected to fluorescence microscopy at 24 h and showed that DHODH-IN-16, BAY-2402234, and Brequinar treatment led to a dose-dependent reduction in the levels of CSFV E2 protein expression (green) (Fig. 2B). To further investigate the sensitivity of DHODH inhibitors to CSFV on other cells, porcine testis (ST) cells and porcine intestinal epithelial (IPEC-J2) cells were infected with CSFV and treated with a range of concentrations of these compounds. Cells were harvested and lysed at 24 hpi for Western blotting. The results showed that these compounds also inhibited CSFV proliferation in ST and IPEC-J2 cells in a dose-dependent manner and were particularly sensitive to IPEC-J2 cells. For IPEC-J2 cells, 10 nM DHODH-IN-16 inhibited CSFV 3.75- and 5.75-fold, 10 nM BAY-2402234 3.71- and 4.00-fold, and 500 nM Brequinar 2.68- and 3.48-fold, compared to PK-15 and BHK cells, respectively (Fig. 2C and D). Japanese encephalitis virus (JEV), bovine viral diarrhoea virus (BVDV), and pseudorabies virus (PRV) were used to further investigate the antiviral activity of DHODH inhibitors. As shown in Fig. 3A, DHODH-IN-16, BAY-2402234, and Brequinar markedly inhibited the replication of JEV, a zoonotic member of the Flaviviridae family. The results showed that DHODH-IN-16, BAY-2402234, and Brequinar reduced JEV NS1 protein levels by 86.0%, 91.0%, and 76.0%, NS5 protein by 96.0%, 97.0%, and 82.0%, and viral RNA levels by 80.5%, 68.2%, and 71.9%, respectively. However, only DHODH-IN-16 exhibited a dose-dependent inhibitory effect on BVDV, the viral RNA and E2 protein levels were decreased by 36.0% and 85.3%, respectively, whereas BAY-2402234 and Brequinar showed no significant effect on BVDV (Fig. 3B). In contrast, none of these compounds affected the PRV replication (Fig. 3C), as evidenced by stable viral DNA copy numbers and protein levels (Fig. 3C). Consequently, these findings suggest that DHODH-IN-16 acts as a broad-spectrum antiviral agent against Flaviviridae, whereas BAY-2402234 and Brequinar exhibit specific, dose-dependent inhibitory effects on CSFV replication.

Fig 2.

DHODH-IN-16, BAY-2402234 and Brequinar inhibit CSFV replication. (A) Cells were treated with either DMSO or different concentrations of DHODH-IN-16, BAY-2402234, and Brequinar for 24 h after infection with CSFV (MOI of 1). Viral replication was determined by RT-qPCR and Western blotting. The effect of DHODH-IN-16, BAY-2402234, and Brequinar on cell cytotoxicity was quantified using the CCK-8 assay. (B) Different concentrations of DHODH-IN-16, BAY-2402234, and Brequinar were added to cells after infected with CSFV (MOI of 1). At 24 hpi, cells were fixed and stained with mouse anti-CSFV E2 antibody (green) and observed by fluorescence microscopy. Bars = 50 µm. (C and D) IPEC or ST cells were treated with either DMSO or different concentrations of DHODH-IN-16, BAY-2402234, and Brequinar for 24 h after infection with CSFV (MOI of 1). Viral replication was determined by Western blotting. Data are presented as the mean ± SD from three independent experiments. **P < 0.01.

Fig 3.

Broad-spectrum antiviral activity of DHODH inhibitors against RNA viruses. Cells were treated with either DMSO or different concentrations of DHODH-IN-16, BAY-2402234, and Brequinar for 24 h after infection with (A) JEV (MOI of 0.1), (B) BVDV (MOI of 0.5), (C) PRV (MOI of 0.1) and harvested for RT-qPCR and Western blotting. The effect of DHODH-IN-16, BAY-2402234, and Brequinar on cell cytotoxicity was quantified using CCK-8 assay. Data are presented as the mean ± SD from three independent experiments. **P < 0.01.

DHODH inhibitors affect the initial stage of CSFV replication

To further explore whether DHODH inhibitors impact the early stage of the CSFV life cycle, specifically virus binding and entry. Cells were inoculated with different concentrations of DHODH-IN-16, BAY-2402234, and Brequinar for 2 h, infected with CSFV (MOI of 10) for 1 h at 4°C and then at 37°C at 0 hpi (binding) or 1 hpi (entry). The treated cells were lysed and subjected to RT-qPCR. The results showed that pre-treatment of the inhibitors had no effects on CSFV binding and entry (Fig. 4A). To confirm the key role of the inhibitors during viral infection, we performed a time-of-addition experiment by adding 10 nM DHODH-IN-16, 10 nM BAY-2402234, or 500 nM Brequinar to cells before or during CSFV infection. A slight decrease in viral RNA levels was observed in cells pretreated with both BAY-2402234 and Brequinar although no significant changes in Npro protein levels were observed. In contrast, neither mRNA nor protein levels were significantly different in cells treated with DHODH-IN-16. However, there was no significant difference in viral RNA copies and Npro protein expression when DHODH-IN-16, BAY-2402234, or Brequinar were administered 1 h during the virus entry (Fig. 4B), suggesting that the treatment duration has been insufficient to effectively inhibit DHODH activity. Interestingly, when any inhibitor was added 1 h after virus infection and remained present for the rest of the infection period of 24 h (after entry), we observed that the level of viral RNA copies was reduced by more than 60.0%, and Npro protein expression was significantly reduced by more than half. Notably, when cells were treated with any inhibitor 12 h prior to infection and throughout infection (throughout), there was an even more significant reduction in viral load, viral RNA copies and Npro protein expression were reduced by more than 79.0% and 86.0%, respectively (Fig. 4B). To further explore whether the DHODH inhibitors affect the ability to generate negative-strand RNA [(−) strand RNA] early in the replcation process, cells were infected with CSFV and treated with 10 nM DHODH-IN-16, 10 nM BAY-2402234, or 500 nM Brequinar for 4 h. Cells were harvested and subjected to RT-qPCR. The results showed that the inhibitors caused a significant reduction in the copy number of CSFV (−)strand RNA (Fig. 4C), suggesting that the inhibitors may impair (−)strand RNA generation during the early stage of viral replication, thereby further limiting total viral mRNA and Npro protein production in the late stage of viral replication. To further investigate whether DHODH inhibitors affect the release of CSFV, cells infected with CSFV were treated with these three inhibitors for 24 and 48 h, respectively, and cell supernatants were collected to infect fresh naive cells for 24 h. RT-qPCR assay revealed a substantial decrease in viral RNA copies (Fig. 4D). These findings suggest that these three inhibitors play a decisive role in the initial stage of CSFV replication.

Fig 4.

DHODH inhibitors affect the initial stage of CSFV replication. (A) Cells were treated with different concentrations of DHODH-IN-16, BAY-2402234, and Brequinar for 2 h and infected with CSFV (MOI of 10) for 1 h at 4°C and then at 37°C at 0 hpi (binding) or 1 hpi (entry). Cells were harvested for RT-qPCR for detecting viral RNA levels. (B) Time points of addition of DHODH inhibitors in CSFV infection. Cells were treated with 10 nM DHODH-IN-16, 10 nM BAY-2402234, or 500 nM Brequinar at various time points during the infection by CSFV (MOI of 1). Viral replication was determined by RT-qPCR and Western blotting. 12 h pretreatment, cells were pretreated with DHODH inhibitors for 12 h; 1 h entry, cells were treated with DHODH inhibitors and CSFV for 1 h before the mixture was washed and treated with 2% DMEM; after entry, cells were treated with DHODH inhibitors 1 h after CSFV entry; throughout, cells were treated with DHODH inhibitors for the whole time period, including the 12 h pretreatment. (C) The infected cells treated with 10 nM DHODH-IN-16, 10 nM BAY-2402234, or 500 nM Brequinar for 4 h were harvested and subjected to RT-qPCR for detecting the production of CSFV (−)strand RNA. (D) Cells were treated with different concentrations of DHODH inhibitors for 24 and 48 h after infection by CSFV (MOI of 1), and the supernatant was collected and used to infect fresh cells for 24 h. The viral genome was determined by RT-qPCR. Data are presented as the mean ± SD from three independent experiments. **P < 0.01.

DHODH inhibitors inhibit CSFV replication through enchancing innate immune signaling

In virus-infected cells, the interferon and NF-κB signaling pathways are often activated simultaneously, working in tandem to bolster immune responses (29, 30). The synergy and coordinated regulation between these pathways are essential for maintaining immune equilibrium and combating infections. To verify whether DHODH inhibitors inhibit virus replication by modulating innate immune pathways, infected cells treated with 500 nM Brequinar were harvested at indicated time points and subjected to Western blotting and RT-qPCR. The results indicated that Brequinar treatment significantly augmented phosphorylation levels within the TBK1-IRF3- STAT1 signaling pathway compared to the control group. Specifically, TBK1 phosphorylation reached its maximum at 9 hpi, marking a 1.57-fold increase over the control, pIRF3 levels peaked at 12 hpi with a 1.67-fold rise, and pSTAT1 levels maximized at 9 hpi, achieving a 1.39-fold increase (Fig. 5A). Additionally, Brequinar administration enhanced phosphorylation of the key marker p65 in the NF-κB signaling pathway, with p-p65 peaking at 6 hpi and showing a 1.56-fold increase over controls (Fig. 5A). Consistent with the data from Western blotting, Brequinar significantly increased the mRNA levels of ISG15, IFIT1, and MX1 (Fig. 5B), alongside increased those of IL-6, IL-8, and TNF-α in infected cells (Fig. 5C). These findings demonstrate that DHODH inhibitors effectively suppress CSFV replication by stimulating the TBK1-IRF3-STAT1 and NF-κB signalings, offering valuable insights into immune regulation mechanisms and bolstering the development of antiviral therapeutic approaches.

Fig 5.

DHODH inhibitors repress CSFV replication through enchancing the innate immune response. (A) Cells were infected with CSFV (MOI of 1) and treated with DMSO or 500 nm Brequinar. The treated cells were harvested at indicated time points and subjected to Western blotting using indicated antibodies against TBK1, pTBK1, IRF3, pIRF3, STAT1, pSTAT1, p65, p-p65, Npro, and β-actin. (B and C) The treated cells described above were lysed and subjected to RT-qPCR for detecting the mRNA levels of ISG15, IFIT1, MX1, IL-6, IL-8, and TNF-α. Data are presented as the mean ± SD from three independent experiments. *P < 0.05; **P < 0.01.

DHODH inhibitors inhibit CSFV replication through interrupting the pyrimidine synthesis

Viral replication in host cells depends on pyrimidine synthesis (31). Pyrimidine is the essential component of RNA, DNA, glycoprotein, and phospholipid biosynthesis, and similarly significant for cell survival and proliferation (32). As shown in Fig. 6A, DHODH, the rate-limiting enzyme in the de novo pyrimidine biosynthesis pathway, catalyzes the oxidation of DHO to ORO, followed by the synthesis of uridine monophosphate (UMP) by UMP synthetase. Thus, we hypothesized that the pyrimidine nucleotide pathway is essential for CSFV replication and that DHODH inhibitors may suppress CSFV replication by obstructing the Pyrimidine synthesis. To validate our hypothesis, cells were infected with CSFV and treated with pyrazofurin, a UMP synthase inhibitor, for 24 h and harvested for RT-qPCR and Western blotting. The results showed that Pyrazofurin effectively inhibited CSFV replication in a dose-dependent manner. At a concentration of 500 nM, viral RNA copies and Npro protein expression were reduced by 97.0% and 55.0%, respectively, while cell viability was not affected (Fig. 6B). DHO and ORO are the substrates and products of DHODH. Therefore, we supplemented different concentrations of DHO or ORO to CSFV-infected cells and harvested at 24 h. The results showed that DHO increased viral RNA levels of 1.5-fold, and Npro protein levels of 3.0-fold, and ORO increased both viral RNA and protein levels of more than 2-fold under the maximum concentration (Fig. 6C and D). This outcome suggests a direct link between pyrimidine synthesis and CSFV replication. To further assess whether DHODH inhibitors affect CSFV replication through their activity on UMP synthesis, we examined the replenishment effect of DHO or ORO on CSFV replication. The infected cells treated with Brequinar in medium with either DHO or ORO were harvested at 24 h and subjected to high-performance liquid chromatography (HPLC), RT-qPCR, and Western blotting. As shown in Fig. 6E, ORO but not DHO effectively attenuated the inhibitory effect of Brequinar on UMP synthesis. The data from RT-qPCR and Western blotting indicated that DHO addition failed to reverse the inhibitory effect of Brequinar on CSFV replication (Fig. 6F). Conversely, ORO supplements interfered with the antiviral activity of Brequinar in a dose-dependent manner (Fig. 6G). Given that uridine can transform into UMP via the salvage pathway, cells were infected with CSFV and added with 100 µM uridine for 24 h. The results showed that exogenous addition of uridine also prevented the inhibitory effect of Brequinar on CSFV replication (Fig. 6H). Similarly, the addition of uridine also mitigated the inhibitory effect of DHODH-IN-16 on BVDV replication (Fig. 6I). Altogether, these results further illustrate that the critical significance of the pyrimidine nucleotide in CSFV replication and that DHODH inhibitors obstruct CSFV replication by specifically targeting DHODH, thereby disrupting the fourth step of de novo pyrimidine synthesis.

Fig 6.

DHODH inhibitors block viral replication by interfering with host pyrimidine biosynthesis. (A) Schematic overview of de novo biosynthesis of pyrimidine nucleotide. (B) Cells infected with CSFV (MOI of 1) were treated with DMSO or different concentrations of pyrazofuran for 24 h, viral replication was determined by RT-qPCR and Western blotting. (C and D) Cells were treated with DMSO, different concentrations of DHO (C) or ORO (D) for 24 h after infection with CSFV (MOI of 0.1), viral replication was detected by RT-qPCR and Western blotting. (E–G) Cells infected with CSFV (MOI of 1) were treated with 500 nM Brequinar in medium with or without DHO or ORO and harvested at 24 h for (E) HPLC, (F and G) RT-qPCR, and Western blotting. (H) The infected cells pre-treated with Brequinar were treated with or without 100 µM uridine. After 24 h, cells were harvested and subjected to RT-qPCR and Western blotting for detecting viral replication. (I) Cells infected with BVDV were pre-treated with Brequinar and treated with or without 100 µM uridine. After 24 h, cells were harvested and subjected to Western blotting for detecting viral replication. Data are presented as the mean ± SD from three independent experiments. *P < 0.05; **P < 0.01.

CSFV replication requires DHODH

As mentioned above, DHODH inhibitors effectively inhibited CSFV replication. To further investigate the effects of DHODH on CSFV replication, cells infected with CSFV (MOI of 1) were harvested and lysed at indicated time points for Western blotting and HPLC assay. The results showed that DHODH expression levels remained stable during CSFV infection while the level of UMP upregulated (Fig. 7A). Next, cells infected with CSFV with different MOI (MOI of 1, 2, 10) for 24 h were harvested and subjected to Western blotting and HPLC assay. The results showed that DHODH expression also remained stable but UMP levels upregulated (Fig. 7B), suggesting that CSFV infection did not alter protein expression but enchanced enzymatic activity of DHODH. Furthermore, cells were transfected with siRNA targeting DHODH for 24 h and infected with CSFV (MOI of 1). At 24 hpi, cells were harvested and subjected to Western blotting and HPLC assay. The results indicated that DHODH knockdown reduced the Npro protein levels by half, accompanied by a notable decrease in intracellular UMP levels (Fig. 7C). To evaluate the effect of DHODH overexpression on CSFV proliferation, cells were transfected with pHA-DHODH for 24 h and infected with CSFV (MOI of 1). At 24 hpi, cells were harvested and subjected to Western blotting and HPLC assay. Compared to the control group, DHODH overexpression resulted in a more than 3-fold in Npro protein levels and a 1.7-fold increase in UMP levels (Fig. 7D). We also analyzed the effect of adding additional uridine to DHODH knowdown cells on CSFV replication. The results indicated that the supplementation of 100 µM uridine significantly restored CSFV replication in DHODH knockdown cells (Fig. 7E). These results suggest that DHODH promotes CSFV replication by catalysing de novo pyrimidine synthesis, highlighting the significant role of DHODH in the CSFV life cycle.

Fig 7.

DHODH is essential for CSFV infection. (A) Cells were infected with CSFV (MOI of 1), harvested at indicated time points, and then subjected to Western blotting and HPLC assay. (B) Cells were infected with CSFV (MOI of 1, 2, 10) for 24 h and then harvested for Western blotting and HPLC assay. (C) Cells transfected with siDHODH or siCtrl were inoculated with CSFV (MOI of 1) and harvested for Western blotting and HPLC. (D) Cells transfected with the plasmid pHA-DHODH or vector (pcDNA3.1-HA) were infected with CSFV (MOI of 1) for 24 h, harvested, and then subjected to Western blotting and HPLC. (E) The infected DHODH-knockdown cells were treated with or without 100 µM uridine and harvested at 24 h for Western blotting. Data are presented as the mean ± SD from three independent experiments. *P < 0.05; **P < 0.01.

CSFV NS4A recruits and interacts with DHODH

DHODH catalyzes DHO to ORO while transferring electrons to ubiquinone in the inner mitochondrial membrane, linking mitochondrial metabolism to the electron transport chain (33). The process of mitochondrial biogenesis is contingent on the importation of over 1,000 proteins. These proteins are initially synthesized on cytoplasmic ribosomes and subsequently transported to various compartments of the mitochondria (34). Nuclear-encoded mitochondrial proteins have specific targeting signals, and DHODH is a mitochondrial enzyme with a mitochondrial targeting sequence (35). To investigate the intricate relationships between DHODH, mitochondria, and CSFV replication, infected cells were fixed with 4% paraformaldehyde, stained mitochondria with mito-tracker, and subjected to confocal microscopy by using labeled antibodies. The results indicated that CSFV infection led to the perinuclear aggregation of mitochondria, while DHODH aggregated to the perinuclear region and colocalized with mitochondria (Fig. 8A). To investigate this phenotype, we expressed a series of CSFV non-structural proteins (NS4A, NS4B, NS5A, NS5B) and a structural protein (E2) in host cells to query which specific CSFV protein was involved in this process. At 24 hpt, cells were fixed and stained with indicated antibodies. Notably, the images revealed that only NS4A and NS5A colocalized with mitochondria (Fig. 8B), suggesting that NS4A and NS5A might play a role in modulating the functions of certain mitochondrial proteins, potentially influencing cellular responses during CSFV infection. To further define whether NS5A and NS4A were essential for the role of DHODH in mitochondria, NS5A or NS4A overexpression cells were fixed and subjected to confocal microscopy. Intriguingly, we observed that NS4A, but not NS5A, colocalized with DHODH (Fig. 8C). To further demonstrate the colocalization of NS4A in mitochondria, cells transfected with pEGFP-C1-NS4A were fixed and stained with antibody against Tom20, another marker of mitochondrial membrane proteins. Confocal microscopy revealed a colocalization between NS4A and Tom20 (Fig. 8C). Given that CSFV infection enhanced DHODH activity, we investigated the potential impact of NS4A on DHODH function. Cells transfected with pEGFP-C1-NS4A for 24 h were harvested and subjected to HPLC assay. Compared to the control group, NS4A overexpression resulted in the increasing UMP levels in dose-dependent manner (Fig. 8D). To further explore the interaction between NS4A and DHODH, cells co-transfected with plasmids pGFP-C1-NS4A and pHA-DHODH were harvested and subjected to co-immunoprecipitation (Co-IP). The results corroborated the interaction between DHODH and NS4A (Fig. 8E and F). Overall, our data indicate that CSFV NS4A recruits DHODH and enhances its activity to facilitate viral replication.

Fig 8.

CSFV NS4A interacts with DHODH. (A) Cells were infected with CSFV (MOI of 1) and fixed at 24 hpi. Then cells were stained with rabbit anti-DHODH antibody (green), mouse anti-E2 antibody (purple), and Mito-Tracker (red) and observed by confocal microscopy. The nuclei were stained with DAPI. Bars = 10 µm. (B) Cells transfected with indicated plasmids (pEGFP-C1-NS4A, pFlag-NS4B, -NS5A, -NS5B, or -E2) for 24 h were fixed and subjected to confocal microscopy by using mouse anti-Flag antibody (green) and mito-Tracker (red). The nuclei were stained with DAPI. Bars = 10 µm. (C) Cells transfected with indicated plasmids (pFlag-NS5A, or pEGFP-C1-NS4A) for 24 h were fixed and subjected to confocal microscopy using rabbit anti-DHODH antibody (red) and mouse anti-Flag antibody (green). The nuclei were stained with DAPI. Bars = 10 µm. (D) Cells transfected with pEGFP-C1-NS4A or vector (pEGFP-C1) for 24 h were harvested and subjected to Western blotting and HPLC assay. (E and F) Cells cotransfected with pEGFP-C1-NS4A and pHA-DHODH or control vector for 24 h were harvested and subjected to Co-IP assay by using anti-GFP or anti-HA nanobody magarose beads. Then, the whole cell lysates were subjected to Western blotting using rabbit anti-DHODH or anti-GFP antibody, along with GAPDH as a loading control.

Identification of the interaction key domains between NS4A and DHODH

Flaviviridae NS4A is a major nonstructural protein that plays a vital role in the regulation of virus replication. The NS4A of BVDV contains distinct features: a transmembrane region, a central peptide, and an acidic domain (36). However, the structural details of the CSFV NS4A domain remain uncharted, and identifying the specific interaction regions of NS4A could greatly enhance our understanding of its functional role in CSFV replication. To further investigate the specific interaction regions between NS4A and DHODH, various NS4A gene fragments were cloned to construct plasmids combining the GFP gene according to the protein structure of BVDV NS4A (Fig. 9A) and stably expressed in PK-15 cells (Fig. 9B). Among these, NS4A-F1 and -F2 were found to upregulate intracellular UMP levels, whereas NS4A-F3 did not exhibit such an effect (Fig. 9B). To assess the interactions between DHODH and the different truncated forms of NS4A (NS4A-F1, -F2, and -F3), both confocal microscopy and Co-IP assays were performed. Confocal microscopy results indicated that while NS4A-F1 and -F2 exhibited interaction with DHODH, NS4A-F3 did not demonstrate such an interaction (Fig. 9C). This finding was further supported by Co-IP data, which confirmed that NS4A-F1 and NS4A-F2 indeed interacted with DHODH (Fig. 9D). These results indicated that the overlapping region of NS4A-F1 and -F2, specifically the amino acids 25–40, was critical for the interaction with DHODH. This identification of a key interaction domain within NS4A provides valuable insight into its functional mechanism in relation to DHODH and contributes to our broader understanding of the molecular dynamics of CSFV replication.

Fig 9.

The key domains of NS4A and DHODH interaction. (A) Schematic of full-length NS4A and its three truncated mutants. (B) Cells transfected with pEGFP-C1-NS4A or its truncated mutant plasmids (pEGFP-C1-NS4A-F1, -F2, or -F3) or control vector for 24 h were harvested and subjected to Western blotting and HPLC assay. (C) Cells cotransfected with pHA-DHODH and indicated plasmids (pEGFP-C1-NS4A-FL, -F1, -F2, or -F3) for 24 h were fixed and subjected to confocal microscopy using rabbit anti-HA antibody (red). The nuclei were stained with DAPI. Bars = 10 µm. (D) Cells cotransfected with pHA-DHODH and indicated plasmids (pEGFP-C1-NS4A-FL, -F1, -F2, or -F3) for 24 h were harvested for Co-IP assay by using anti-GFP antibody margarose beads, and whole-cell lysates were subjected to Western blotting using rabbit anti-HA antibody, along with GAPDH as a loading control. (E) Schematic of full-length DHODH and its three truncated mutants. (F) Cells transfected with pHA-DHODH or its truncated mutant plasmids (pHA-DHODH-F1, -F2, or -F3) or control vector for 24 h were harvested and subjected to Western blotting. (G) Cells cotransfected with pEGFP-C1-NS4A and indicated plasmids (pHA-DHODH-FL, -F1, -F2, or -F3) for 24 h were fixed and subjected to confocal microscopy using rabbit anti-HA antibody (red). The nuclei were stained with DAPI. Bars = 10 µm. (H) Cells were cotransfected with p-EGFP-C1-NS4A and indicated plasmids (pHA-DHODH-FL, -F1, -F2, or -F3) for 24 h and harvested for Co-IP using anti-GFP nanobody-margarose beads, and whole cell lysates were subjected to Western blotting using rabbit anti-HA antibody, along with GAPDH as a loading control.

The N-terminus of DHODH features a mitochondrial signal (MS) and a transmembrane segment (TM), which are linked to the catalytic domain by two α-helices (a1, a2) and the electron acceptor co-substrate ubiquinone Q10 (35). To pinpoint the specific region of DHODH that interacted with NS4A, different segments of DHODH were cloned to generate the plasmids consisting of fragments of the gene of interest in tandem with the HA tag and stably expressed in PK-15 cells (Fig. 9E and F). Cells cotransfected with pEGFP-NS4A and the plasmids (pHA-DHODH-F1, -F2, -F3, -FL) were fixed and subjected to confocal microscopy. As shown in Fig. 9G, DHODH-F1 did not colocalize with NS4A, whereas DHODH-F2, -F3, and -FL exhibited colocalization with NS4A. These results were in accordance with Co-IP assay, which confirmed the interactions between DHODH-F2, -F3, and -FL with NS4A (Fig. 9H). Given that both DHODH-F2 and -F3 contain amino acids 65–229, these results imply that the segment spanning amino acids 65–229 was crucial for the interaction between DHODH and NS4A. The identification of the key structural domain for the interaction between DHODH and NS4A provides valuable insight into its functional mechanism in relation to DHODH and contributes to our broader understanding of the molecular dynamics of CSFV replication.

DISCUSSION

CSF remains a significant economic concern in the global pig industry (37). In regions where CSF is prevalent and re-emergent, completely eradicating it through biosecurity and vaccination strategies is proving challenging. Therefore, the development of effective anti-CSFV drugs or supplementary strategies is of great importance (8). Mitochondria, serving as the cellular energy powerhouses, are critical for numerous essential cellular processes (38). Consequently, we screened 382 compounds from the mitochondria-targeted compound library to pinpoint effective targets against CSFV replication. In our study, we pinpointed 13 potent inhibitors, which we classified into four distinct groups: mitochondrial oxidative phosphorylation (OXPHOS) inhibitors, mitochondrial F0F1-ATPase inhibitors, multi-target tyrosine kinase inhibitors, and DHODH inhibitors. Particularly, the DHODH inhibitors captured our interest. As a rate-limiting enzyme, DHODH stands out as the sole enzyme responsible for catalyzing the conversion of DHO to ORO, which is then utilized in UMP synthesis to meet cellular nucleotide demands (39). In virus-infected cells, the demand for a substantial intracellular nucleotide pool is driven by the need for rapid viral replication (18). Given that viral replication is highly dependent on the host nucleotide biosynthesis, enzymes involved in this pathway emerge as potential targets for anti-CSFV drug development. Our data, indeed, show that DHODH inhibitors effectively inhibit CSFV replication. Notably, candidate compounds DHODH-IN-16, BAY-2402234, and Brequinar demonstrate potent anti-CSFV activity, with EC₅₀ values of 1.038 nM (SI > 1,450), 0.975 nM (SI > 1,740), and 26.635 nM (SI >103.5), respectively, making them strong candidates for CSFV inhibition.

Current anti-CSFV drug candidates mainly include inhibitors targeting virus polymerase, reorganized proteins with ribonucleotidase (RNase) activity, and glycosylation inhibitors (8). These antiviral agents specifically target different stages of CSFV life cycle, classifying them as direct-acting antiviral drugs (DAAs), which have limited broad-spectrum activity, and are developed under the “one virus, one drug” strategy, which is not only inefficient and costly but also prone to inducing mutations during viral replication due to their direct action on viral proteins (31). In contrast, host-targeted antivirals (HTAs) which focus on host factors essential for viral replication offer the benefits of a broad spectrum and reduced resistance (40). Viruses depend on host cell components and machinery for the synthesis and processing of nucleic acids and proteins, essential for their life cycle (41). These resources are commonly employed by multiple viruses, HTAs demonstrate efficacy against a broad spectrum of viral infections (31). Pyrimidine plays a vital role in viral replication, and in recent years, inhibitors of host pyrimidine synthesis have gained prominence in the field of broad-spectrum antiviral drug research (26). DHODH is the sole enzyme that links pyrimidine synthesis to the electron transport chain of aerobic respiration, a unique position that makes it a particularly attractive target for drug development within the pyrimidine synthesis (42). Leflunomide and its active metabolite Teriflunomide are the first DHODH inhibitors to receive medical approval. Leflunomide is successfully employed in treating rheumatoid arthritis, while Teriflunomide is authorized for the clinical treatment of multiple sclerosis (43). Both Leflunomide and Teriflunomide are effective in vitro in inhibiting the proliferation of a number of viruses, such as SARS-CoV-2, herpes simplex virus (HSV), cytomegalovirus (CMV), respiratory syncytial virus (RSV), and influenza virus (31, 44–46). Brequinar, a more potent DHODH inhibitor than Leflunomide and Teriflunomide, is currently undergoing phase II clinical trials. Initial studies with Brequinar have demonstrated promising anti-cancer properties (47). In a mouse xenograft model, it effectively inhibited the growth of breast, lung, gastric, and colon tumours by 90% at dose ranging from 20 to 40 mg/kg (48). Meanwhile, Brequinar has exhibited broad-spectrum antiviral activity against various viruses including yellow fever, ZIKA, West Nile (WNV), EV, influenza virus, and vesicular stomatitis viruses (VSV) in vitro (49, 50). In our research, the DHODH inhibitor DHODH-IN-16 demonstrated its efficacy by not only significantly inhibiting the replication of CSFV but also by dose-dependently suppressing the replication of JEV and BVDV. Furthermore, two other DHODH inhibitors, BAY-2402234 and Brequinar, were found to be equally effective in inhibiting the replication of both CSFV and JEV. Notably, compared to RNA viruses, DNA viruses are less reliant on UMP, a specific nucleotide produced by DHODH, making them less susceptible to DHODH inhibitors (20). This difference explains the observed insensitivity of PRV to the DHODH inhibitors we examined. Herein, the antiviral activities of DHODH inhibitors were supported by four critical observations below: (i) DHODH inhibitors impeded CSFV replication not only in PK-15 cells but also in ST and IPEC-J2 cells, with significantly increased sensitivity in IPEC-J2 cells. (ii) DHODH inhibitors did not interfere the binding and entry of CSFV and may play a critical role in the later phases of the CSFV life cycle. (iii) DHODH inhibitors inhibited viral replication by enhancing the innate immune response. (iv) DHODH inhibitors directly limited the synthesis of UMP to inhibit viral replication, and this inhibition can be reversed through a remedial pathway by adding uridine. (v) The suppression of CSFV replication facilitated by DHODH inhibitors was counteracted by pre-addition their substrates and products.

CSFV NS4A is an essential cofactor for the NS3 protease and required for virus particle formation along with the NS2-NS3 precursor protein (51). Previous studies have established that Flavivirus NS4A is primarily located in the endoplasmic reticulum (ER), where it plays a crucial role in the reconfiguration of the ER membrane, aiding in the formation of the viral replication complex (VRC) (52, 53). However, recent discoveries have revealed that the presence of Flavivirus NS4A extends beyond the ER, with a notable association with mitochondria. JEV NS4A has been identified as localized to both the ER and mitochondria. Protein-protein interaction screenings employing JEV-NS4A against a mouse brain cDNA library revealed significant involvement of mitochondrial protein (54). Similarly, HCV NS4A has been proven to localize to mitochondria and the surrounding ER pools, with perinuclear-like accumulation of mitochondria observed in HCV-NS4A overexpressing cells (55). Our studies also indicated that CSFV NS4A localized to mitochondria. After CSFV infection, a pronounced aggregation of mitochondria was observed around the nucleus. Concurrently, DHODH exhibitd perinuclear accumulation and colocalized with mitochondria, a phenomenon potentially influenced by NS4A. Our further research revealed that NS4A strongly interacted with DHODH and enhanced its enzymatic activity, highlighting the potential role of Flavivirus NS4A in modulating host gene expression during infection. Moreover, we identified the key interacting domain of DHODH with CSFV NS4A as the amino acid residues 65–229. This critical segment resided within the catalytic domain of DHODH, representing a key functional area that encompasses the interaction site with ubiquinone (17). Ubiquinone, an essential component of the cellular respiratory chain, plays a crucial role in the transfer of hydrogen and electrons (56). Current research has demonstrated that HCV NS4A can trigger a decrease in mitochondrial transmembrane potential and prompt the release of cytochrome c into the cytoplasm (55), suggesting a possible connection between the interaction of NS4A and DHODH and the mitochondrial electron transport chain. We also discovered that the amino acid residues 25–40 of NS4A were crucial for its interaction with DHODH. These insights enhanced our understanding the role of NS4A in CSFV replication and established a groundwork for the continued development of potent anti-CSFV drugs.

Mitochondria are the energy factories of the cell and also serve as the control centers for intracellular substance metabolism. Viral infections initiate metabolic reprogramming, leading to the emergence of unique bioenergetic profiles essential for effective virus replication (57). Mitochondria, as the primary locus for metabolic reprogramming, underscore the significance of developing medications that target mitochondrial metabolism (58). This is essential not just for the effective treatment of viral infection but also for advancing our comprehension of viral influence on host metabolic regulation. Advancing mitochondria-targeted drugs involves more than identifying new agents that target mitochondria; it also requires delving into the specific mechanisms of action. Understanding these mechanisms sheds light on the regulatory processes that govern mitochondrial function during viral infection and will help uncover innovative therapeutic approaches for a range of viral diseases.

MATERIALS AND METHODS

Virus, cells, and plasmids

CSFV Shimen strain (GenBank accession number: AF092448), JEV NJ2008 strain (GenBank accession number: GQ918133), PRV SD2019 strain (GenBank accession number: MW805231), and BVDV2 strain (GenBank accession number: MG420995) were kept in the lab. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO, Invitrogen, CA, USA) supplemented with 10% fetal bovine serum (FBS, GIBCO, Invitrogen, CA,USA), 0.2% NaHCO₃, 100 µg/mL streptomycin, and 100 IU/mL penicillin (GIBCO, Invitrogen, CA, USA). The pFLAG-NS4B, -NS5A, -NS5B, and -E2 plasmids were generated by cloning corresponding CSFV genes into the p3×FLAG-CMV-7.1 vector. The plasmids pEGFP-C1-NS4A-FL, -F1, -F2, and -F3 were generated by cloning corresponding CSFV NS4A truncated mutant genes into the pEGFP-C1 vector. The plasmids pHA-DHODH-FL, -F1, -F2, and -F3 were generated by cloning corresponding DHODH and its truncated mutant genes into the pcDNA3.1-HA vector. The authenticity of each construct was confirmed by DNA sequencing. The primers are listed in Table 1.

TABLE 1.

Primers used in this study

Primer	Sequence (5'−3'）	Accession number	Use
CSFV-F	CCTGAGGACCAAACACATGTTG	AF092448	RT-qPCR for detection of CSFV
CSFV-R	TGGTGGAAGTTGGTTGTGTCTG
JEV-F	AGAGCGGGGAAAAAGGTCAT	GQ918133	RT-qPCR for detection of JEV
JEV-R	TTTCACGCTCTTTCTACAGT
BVDV-F	GAGTACAGGGTAGTCGTCAGT	MG420995	RT-qPCR for detection of BVDV
BVDV-R	CTCTGCAGCACCCTATCAGG
PRV-F	GATGACCTCAACGGCGACCTC	MW805231	RT-qPCR for detection of PRV
PRV-R	GCGAGAAGAGCTGCGAGTGG
ACTIN-F	GTGATCTCCTTCTGCATCCTGTC	AJ312193	RT-qPCR for detection of ACTIN
ACTIN-R	CTCCATCATGAAGTGCGACGT
DHODH-FL/F1/F3-F	ATGCAAGCTTGCCACCATGGCTGGCGACAGCTCAA	1191884597	Plasmid construct for pHA- DHODH-FL, -F1, -F2, and -F3
DHODH-FL/F2-R	ATGCCTCGAGTTACCTCCGATGATCTGCTCC
DHODH-F1-R	AGTCGGTACCCAGGGATGTGAAGCGAATGG
DHODH-F2-F	ATGCAAGCTTGCCACCGGGCTCCTTCCTCGGGCCAC
DHODH-F3-R	AGTCGGTACCCAGCTCAGCCTTCCCCTGAA
NS4A-FL/F1/F3-F	CAGCTCGAGCTATGTCAACAGCTGAGAAT	AF092448	Plasmid construct for pEGFP-C1-NS4A-FL, -F1, -F2, and -F3
NS4A-FL/F2-R	CGGGATCCTCATAGCTCCTTCAATTC
NS4A-F1-R	CGGGATCCTCATTCCAACCTGTGATC
NS4A-F2-F	CAGCTCGAGCTATGCCAGTAGTCACAGATATAT
NS4A-F3-R	CGGGATCCTCATATATGCCTCTTTGAA
ISG15-F	CAGAGACCCACTGAGCATCC	EU647216	RT-qPCR for detection of ISG15
ISG15-R	GCGTCAGCCAGACCTCATAG
IFIT1-F	TCCGACACGCAGTCAAGTTT	NM_001244363	RT-qPCR for detection of ISG56
IFIT1-R	TGTAGCAAAGCCCTGTCTGG
MX1-F	TTCCAGAGGATGAAAGCGGG	NM_214061	RT-qPCR for detection of MX1
MX1-R	CGACACTCGTACTCCACCAC
IL-6-F	AGGGAAATGTCGAGGCTGTG	NM_214399	RT-qPCR for detection of IL-6
IL-6-R	TCCACTCGTTCTGTGACTGC
IL-8-F	AGCCCGTGTCAACATGACTTCC	NM_213867	RT-qPCR for detection of IL-8
IL-8-R	GAAGTTGTGTTGGCATCTTTACTGA
TNFα-F	GGCAGAGTGGGTATGCCAAT	NM_214022	RT-qPCR for detection of TNFα
TNFα-R	GAGGTACAGCCCATCTGTCG
CSFV-FZL	TGGCTGGCTTACACATTTGTAAATGAAGAT	AF092448	Reverse transcription for generate CSFV (-)RNA strand

Cell viability assay

Cells were seeded in a 96-well plate (10⁴ cells/well) and treated with different concentrations of the compounds for 24 h. The cytotoxic effect of the compounds on cells was evaluated by Cell Counting Kit 8 (Absin Bioscience Inc., Shanghai, China). The reagent’s absorbance was measured with a fluorescence microplate reader after 1–4 h of incubation in 37°C.

Screening of mitochondrial targeting compounds

Mitochondrial targeted compound library was purchased from MedChem Express (MCE, NJ, USA) and stored as 10 mM stock solutions in DMSO at −80°C until use. The compound screening workflow is shown in Fig. 1A. Cells were treated separately with the compounds (1 µM compound or DMSO) for 24 h and then tested for cytotoxicity using a CCK-8 assay kit. During this screening, the compounds were removed if they showed observable cytotoxicity. For the next screening, cells were treated with the compounds (1 µM compound or DMSO) after infection with CSFV (MOI of 1). After 24 h, cells were harvested for indirect immunofluorescence assay (IFA). Fluorescence intensity was measured using ImageJ 7.0 software (ImageJ, MD, USA). The inhibition rate of each compound was normalised to the same volume of the DMSO-treated control group. Each assay was performed in duplicate. In this screening, compounds with an 80% inhibition rate of CSFV replication were selected. The EC₅₀ values of the compounds were determined from RT-qPCR experimental data, and the CC₅₀ values were ascertained using outcomes from the CCK-8 assay. The values were then computed utilizing GraphPad Prism 7.0 software (GraphPad Software, CA, USA). DHODH inhibitors that exhibited dose-dependent inhibitory activity against CSFV infection had a SI greater than 100 were considered for further study.

Time-of-addition assay

In brief, cells were pretreated for 12 h with the compound before the virus was added to the cells (12 h pretreatment), or cells were pretreated for 12 h and the compound remained throughout the 24 h of infection (throughout). Alternatively, the compound was added only during 1 h of infection, when most of the virus entry and fusion occurred (1 h entry), or after the 1 h of infection (after entry) for the remaining of the infection. After incubation for 24 h, cells were harvested for RT-qPCR and Western blotting .

Binding and entry assay

Cells were pretreated with nontoxic concentrations of compounds at 37°C for 1 h and inoculated with CSFV (MOI of 10) at 4°C for 1 h to allow virus attachment without internalization. Subsequently, cells were washed three times with cold phosphate-buffered saline (PBS) before viral RNA was extracted and quantified by RT-qPCR (Binding). The culture medium was replaced with fresh serum-free DMEM, and cells were subsequently shifted to 37°C with 5% CO₂ to allow virus internalization. After 1 h, cells were washed with citrate buffer solution (pH 3) to remove the noninternalized virions on the surfaces of cells and then washed three times with cold PBS before viral RNA were extracted and quantified by RT-qPCR (Entry).

Plasmids and siRNA transfection

Cells grown to 70% confluence cell culture plates were transfected with specified plasmids using jetPRIME transfection reagent (Polyplus, France) as per the manufacturer’s protocol. For RNA interference, cells were transfected with siRNA using Lipofectamine RNAiMAX (Invitrogen, CA, USA) according to the manufacturer’s instructions. The siRNA duplexes used in the study were as follows: siDHODH-1 (5-GCGCAAGACAAGGAAGAUATT-3) and siDHODH-2 (5-CGGGACUUAUCAACGCAAATT-3), which were designed and synthesized by GenePharma Co, Ltd (Shanghai, China). Cells were infected with CSFV (MOI of 1) and harvested for Western blotting at 24 h.

Western blotting

Cells were harvested and lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (R0020; Solarbio, Beijing, China) for 30 min at 4°C. Lysates were clarified by centrifugation at 12,000 g for 10 min at 4°C, and the supernatant is then mixed with 5 × SDS loading buffer. Proteins in the lysates were separated by SDS-PAGE, transferred to nitrocellulose membranes, and probed with the indicated antibodies. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin was used as a loading control. All the antibodies are listed in Table 2. To determine indicated protein levels, the grayscale analysis was performed with the corresponding amount of protein/GAPDH or β-actin by ImageJ 7.0 software.

TABLE 2.

Antibodies used in this study

Antibody	Name	Supplier	Catalog no.
Flag	Anti-Flag M2 antibody	Sigma-Aldrich	F1804
HA	Anti-HA antibody mouse MAb	Sigma-Aldrich	H3663
β-Actin	β-Actin (C4) antibody	Santa Cruz	sc-47778
STAT1	STAT1 MAb	Proteintech	66545-1-Ig
pSTAT1	Phospho-STAT1 (Ser727) polyclonal antibody	Proteintech	28977-1-AP
DHODH	DHODH polyclonal antibody	Proteintech	14877-1-AP
GAPDH	GAPDH MAb	Proteintech	60004-1-Ig
GFP	GFP tag polyclonal Ab	Proteintech	50430-2-AP
p65	RELA rabbit pAb	Abclonal	A22676
p-p65	Phospho-NF-κB p65/RelA-S276 rabbit pAb	Abclonal	AP0123
Tom20	Tom20 rabbit MAb	Abclonal	A19403
TBK1	TBK1/NAK antibody	Cell Signaling Technology	3013
pTBK1	Phospho-TBK1/NAK (Ser172) rabbit MAb	Cell Signaling Technology	5483
IRF3	IRF3 (D83B9) rabbit MAb	Cell Signaling Technology	4302
pIRF3	Phospho-IRF3 (Ser379) rabbit MAb	Cell Signaling Technology	79945

Reverse transcription real-time PCR

Total RNA was extracted from infected cells using TRIzol reagent (Invitrogen, CA, USA), and reverse-transcribed to cDNA using reverse transcription reagent (R222; Vazyme, Nanjing, China). Relative expression levels of target mRNA were determined by RT-qPCR using SYBR qPCR Master Mix (Q511; Vazyme, Nanjing, China). The expression levels for these genes were normalized to that of β-actin, and relative gene expression levels were calculated using the relative standard curve 2^−ΔΔCt method. The primers are listed in Table 1.

Co-immunoprecipitation

Cells were transfected with indicated plasmids for 24 h and lysed in lysis buffer (50 mM Tris-HCl pH7.5; 150 mM NaCl; 1% Triton-100; 1 mM EDTA; 1 mM PMSF) for 30 min at 4°C. The lysate is collected and centrifugation at 12,000 g for 5 min at 4°C to obtain the supernatant (whole-cell lysate). A 100 µL aliquot of the supernatant was removed from all samples for later use. The remaining lysate was incubated with anti-GFP/HA magarose beads (Alpalifebio, Shenzhen, China) and continuously rotated for 4–6 h at 4°C. The agarose beads were collected by centrifugation at 3,000 g for 5 min at 4°C and then resuspended in 2 × SDS loading buffer for Western blotting.

Confocal microscopy and IFA

Cells grown on coverslip dishes or 12-well plates were fixed with 4% paraformaldehyde (PFA) for 30 min at 37°C and permeabilized with 0.1% Triton X-100 (Sigma, USA) for 15 min at 37°C. Cells were incubated with first primary antibodies overnight at 4°C and then incubated with fluorescent-labeled secondary antibodies for 1 h at 37°C. The cell nuclei were stained with DAPI (C1005, Beyotime, Shanghai, China) for 10 min. For confocal microscopy, cells were scanned using Nikon A1 confocal microscope (Nikon, Japan), and co-localization coefficients were calculated using Image J 7.0 software. For IFA, cells on 12-well plates were examined under a Zeiss LSM700 confocal microscope (Zeiss, Germany).

HPLC detection

Cells in the six-well plate were washed three times with PBS, scraped with a cell scraper, and placed in a centrifuge tube. Cells were collected by centrifugation at 12,000 g for 5 min. Then 0.5 mL of 5% aqueous perchloric acid solution was added, thoroughly mixed, ultrasonicated at low temperature for 1 h, centrifuged at 4,000 rpm for 10 min, filtered through a 0.45 µm membrane. Twenty microliters of the sample was precisely aspirated and analyzed using an Agilent 1200 HPLC liquid chromatographer (Agilent, CA, USA). Test conditions: the detector was VWD C18. The column temperature was 30°C. The chromatographic column was 250 × 4.6 mm, 5 µm. The wavelength was 260 nm and the flow rate was 0.8 mL/min. The mobile phase was 0.05 mol/L potassium dihydrogen phosphate. In addition, the UMP control substance was determined by the same method. The content of UMP in cells was calculated as peak area according to the external standard method.

Statistical analysis

All data were presented as means and standard deviations (SD) as indicated. Student’s t test was used to compare the data from pairs of treated and untreated groups. Asterisks in the figures indicate statistical significance (*P＜0.05; **P＜0.01). All statistical analyses and calculations were performed using GraphPad Prism 7.0 software.

DATA AVAILABILITY

All relevant data are within the article.