Abstract
The Canary Islands is a Macaronesian volcanic archipelago with a depauperate community of three species of Kalotermitidae, including Kalotermes dispar. A total of 54 Kalotermes colonies were collected from Gran Canaria, Tenerife, La Gomera, La Palma, and El Hierro islands. Soldiers and imagos were morphologically examined and sequenced for four mitochondrial markers. Although morphological differences could not be detected, phylogenetic analysis of both cox1/tRNA/cox2 and rrnL markers revealed two distinct clades of K. dispar, suggesting cryptic diversity. The diversification within the Canary Kalotermes lineage most likely occurred around 7.5 Mya, while the divergence within the two clades was reconstructed at about 3.6 Mya and 1.9 Mya. Kalotermes approximatus from the southeastern Nearctic constitutes a sister to the Canary Kalotermes, while the Palearctic K. flavicollis, K. italicus, and K. phoenicae form a separate clade. It is hypothesized that a faunal exchange of Kalotermes from the Nearctic to the Canary Islands occurred via transoceanic rafting during the mid-Miocene.
Keywords: cryptic species, diversification, drywood termite, oceanic islands, transoceanic dispersal
Graphical Abstract
Graphical Abstract.
Introduction
The genus Kalotermes Hagen, 1853 belongs to the family Kalotermitidae Froggatt, 1897. Like many other kalotermitid genera, Kalotermes build small colonies and nest in live or dead branches and trunks, which provide both shelter and food (so-called “one-piece nesters,” Abe 1987). This lifestyle has two primary outcomes: (i) continuous increase of the nest size with consequent frequent colony fusions because of the likely encounter when nesting within the same wood log (Luchetti et al. 2013, Scicchitano et al. 2018), (ii) ease of passive dispersal by moving the infested wood itself. In fact, wood rafting overwater has been suggested as one of the main drivers of the worldwide distribution and island colonization of kalotermitids (Scheffrahn et al. 2006, Thiel and Haye 2006, Scheffrahn and Postle 2013, Buček et al. 2022). The low termite diversity in oceanic islands is largely explained by their low aerial dispersal ability, i.e., termites are weak fliers with dehiscent wings. Also, as mating occurs after wings are shed, aerial dispersal by inseminated females over more significant distances is precluded (Tonini et al. 2013). Therefore, long-distance dispersal in this group by overwater rafting will be more effective in wood-nesting species, making them more represented in oceanic islands than earth-dwelling species.
Currently, the genus Kalotermes includes 22 species distributed primarily in the subtropics of both hemispheres (Emerson 1969, Ghesini and Marini 2013, 2015, Krishna et al. 2013, Ghesini et al. 2014, Constantino 2022). About half of the species are distributed in the Australian region, and only two are known from the New World (Krishna et al. 2013). In the Palearctic region, five species are currently described. Across Europe, three species are found, including the type species Kalotermes flavicollis Fabricius, 1793, which was also found to include three distinct lineages (Velonà et al. 2011, Scicchitano et al. 2018), and two of them have been described very recently: Kalotermes italicus Ghesini and Marini, 2013 and Kalotermes phoenicae Ghesini and Marini, 2015 (Ghesini and Marini 2013, 2015). In addition, Kalotermes monticola monticola Sjöstedt, 1925 and Kalotermes monticola brachycephala Sjöstedt, 1926 are found in Algeria, and Kalotermes dispar Grassé, 1938 inhabits the Canary Islands (Krishna et al. 2013). However, the taxonomy of Kalotermes is still far from being complete due to the existence of cryptic diversity within the genus, as well as undiscovered species in unsampled areas. Apart from the recently described K. italicus and K. phoenicae, Scicchitano et al. (2018) showed a strong geographic structure within K. flavicollis of Western Europe, suggesting the existence of potential new species. In this study, we present new data on Kalotermes’s molecular systematics and phylogenetics, focusing on the intraspecific genetic variation of the Canarian K. dispar colonies. Obtained data show subtle population differences between the colonies from the type locality of La Palma Island and other Canarian islands. Transoceanic faunal exchange of Kalotermes between the Nearctic and Palearctic regions is also suggested.
Materials and Methods
Sampling Area
This study was carried out in the Canary Islands, a volcanic archipelago comprising eight major islands off the southwest Atlantic coast of NW Africa. Although all islands were surveyed, samples were only collected on the five main islands of Gran Canaria, Tenerife, La Gomera, La Palma, and El Hierro (Fig. 1; Supplementary Table S1) between 2016 and 2022. Specimens were collected from 55 to 1120 m asl in natural and urban areas, with a higher peak at middle elevations (400–600 m asl), from dead branches and trunks and stored in 100% ethanol for further genetic and morphological analyses.
Fig. 1.
Map of sampling sites. Clade A is represented in discs (subgroup A1 green discs and A2 empty discs), clade B in diamonds (subgroup B1 in green diamonds and B2 in empty diamonds). Acronyms are as in Supplementary Table S1, and shapes are according to the clustering pattern in Fig. 2.
Morphological Analysis
Specimens collected were compared with descriptions and measurements from the literature (Grassé 1938). Microphotographs were taken as multilayer montages using a Leica M205C stereomicroscope controlled by Leica Application Suite version 3 software. Preserved specimens were taken from ethanol and suspended in a pool of Purell Hand Sanitizer to position the specimens on a transparent Petri dish background. Helicon Focus software was used to stack pictures. Measurements were done following Roonwal (1970).
Molecular Phylogenetic Analysis
A single individual per colony (N = 54; Supplementary Table S1) was analyzed. The total DNA was isolated from the head using the NucleoSpin DNA Insect Mini Kit (Macherey-Nagel). Mitochondrial fragments PCR amplification was carried out with Promega GoTaq2, with thermal cycling as described in Scicchitano et al. (2018) and Suárez et al. (2022), using the following primers: cox2, C1-J-2797 (5ʹ-CCTCGACGTTATTCAGATTACC-3ʹ) and TK-N-3785 (5ʹ-GTTTAAGAGACCAGTACTTG-3ʹ) (Simon et al. 1994) or TL2-J-30307 (5ʹ-TAATATGGCAGATTAGTGCATTGGA-3ʹ) (Simon et al. 1994) and TK-N-3785 (5ʹ-GAGACCATTACTTGCTTTCAGTATCT-3ʹ) (Gómez-Zurita et al. 2000); rrnL, R-J-12887 (5ʹ-CCGGTCTGAACTCAGATCACGT-3ʹ) and LR-N-13398 (CGCCTGTTTAACAAAAACAT) (Simon et al. 1994; Palumbi 1996). After the amplified fragments’ purification with an ExoSap kit (Invitrogen), Sanger sequencing was performed at Macrogen Europe. Sequences were submitted to Genbank under the following accession numbers: PP112277–PP112320 (cox1/trnL/cox2) and PP118566–PP118598 (rrnL).
Available sequences from other Kalotermes taxa and Longicaputermes sinaicus, which was used as outgroup, were retrieved from Genbank (Supplementary Table S2).
Sequences were aligned through MAFFT v. 7.220 (Katoh and Standley 2013) using the --auto parameter set. Sequence divergences were computed using the uncorrected p-distance with Mega 11 (Tamura et al. 2021). Possible substitutions saturation has been analyzed through the transitions/transvertions vs evolutionary distance plots and Xia et al. (2003) and Xia and Lemey (2009) statistical test, implemented on Dambe v. 7 (Xia 2018).
Maximum Likelihood phylogenetic analysis was carried out with IQ-Tree (Trifinopoulos et al. 2016), with 1000 Ultrafast bootstrap replicates for nodal support. The best partition schemes and substitution models were determined with ModelFinder (Kalyaanamoorthy et al. 2017), according to BIC statistics: cox2 1st codon position, TrN + G model; 2nd codon position, HKY + G model; cox2 3rd codon position, HKY + G model; rrnL TIM2 + I + G model.
The Bayesian inference of divergences time was carried out using BEAST v. 1.8 (Drummond and Rambaut 2007). To minimize any possible bias in the parameters and age estimations, the analysis was performed only considering samples for which both cox2 and rrnL sequences were available. Two independent searches were run to check convergence, running 206 generations and sampling every 1,000 generations. A log-normal relaxed molecular clock was used with a birth-death tree model. According to BIC statistics, the best partition schemes and substitution models were determined with PartitionFinder v. 1.1 (Lanfear et al. 2012): cox2 1st + 2nd codon positions, TrN + I model; cox2 3rd codon position, HKY + G model; rrnL, TrN + I + G model. Runs logfiles were, then, combined and the convergence was considered reliable when ESS values >200. Two calibration points were considered, using age estimates obtained by Buček et al. (2022): (1) the divergence between Australian Kalotermes and the other Kalotermes spp., ~68 Mya; (2) the divergence between the North American species K. approximatus and the European Kalotermes clade, ~22 Mya. All calibrations were modeled with a normal distribution and a standard deviation of 3.0.
Median‐joining networks (Bandelt et al. 1999) using only cox2 (n = 42) were calculated with PopART 1.7, keeping parameter e = 0, starting with minimum spanning trees combined within a single network, and then adding median vectors (consensus sequences) to reduce tree length.
Ecological Analysis
A smoothed density estimate plot was conducted for altitudes where each subgroup colony was sampled using the function “geom_density” from the package ggplot2 (Wickham 2016). In addition, each plant species from where a colony was found was annotated and a bipartite network was constructed using the function “plotweb” from the package bipartite (Dormann et al. 2009).
Results
Fifty-four colonies were analyzed. For 36 samples both cox2 and rrnL markers were obtained, while for eight only cox2 was sequenced, and for ten only the rrnL was possible. All sequences were then combined in a single alignment, along with literature data, to give an alignment comprising 86 sequences with 1206 nucleotide positions (665 bp cox2; 541 bp rrnL). Tests conducted on sequence alignments did not give indication of substitutions saturation (Supplementary Fig. S1).
The maximum likelihood tree shows high nodal support at nodes of all main lineages (Fig. 2A). The Canarian samples are all in a monophyletic cluster, in sister relationship with the Nearctic K. approximatus. The Mediterranean Kalotermes species are all in a monophyletic cluster, in sister relationship with the Canarian samples + K. approximatus clade. The Canarian clade further splits into two distinct, well-supported clades. The first one (clade A in Fig. 2A) included samples from La Palma, La Gomera, northern Tenerife, and El Hierro. The second clade (clade B in Fig. 2A), included samples from southern Tenerife and Gran Canaria. Interestingly, in both clades, two main subgroups can be recognized. In clade A, subgroup A1 constituted La Palma samples and two samples from northern Tenerife (CAB and RAC), and a paraphyletic assemblage, indicated with A2, included samples from northern Tenerife and the only sample from El Hierro (ELG). Samples from La Gomera are included in subgroups A1 and A2. In clade B, subgroup B1 was composed of southern Tenerife samples, and subgroup B2 comprised samples from Gran Canaria (Fig. 2A).
Fig. 2.
Molecular phylogenetic analyses of Kalotermes taxa. A) Maximum likelihood tree based on all available cox2 and rrnL sequence. Numbers at nodes indicate Ultrafast Bootstrap nodal support. Clades A and B, along with subgroups, are shaded. The outgroup sequences have been omitted for graphical purposes. B) Bayesian time tree analysis based on samples for which both cox2 and rrnL were available. Arrowheads indicate calibration points. Numbers at nodes indicate posterior probability nodal support. Bars at nodes represent 95% high-posterior density associated with node age. The upper left map indicates the worldwide distribution of Kalotermes lineages, represented by different colors according to the tree tip names. Locality acronyms are explained in Supplementary Tables S1 and S2.
The Bayesian inference resulted in a tree completely agreeing with the maximum likelihood, also showing maximum or nearly maximum support at all main nodes (Fig. 2B). Timing of cladogenetic events indicated that the Canarian clade was separated by the North American K. approximatus 16.8 Mya (HPD = 12.4–21.7 Mya), while the canary clade differentiated about 7.5 Mya (HPD = 5.1–10.3 Mya). The divergence between subgroups A1 and A2 dates back to 1.9 Mya (HPD = 1.2–2.8 Mya), while the separation of subgroups B1 and B2 occurred at 3.6 Mya (HPD = 2.3–5.1 Mya).
The Haplotype network shows the same main clades and more subgroups. In clade A, subgroup A1 was divided into A1.1 with samples from the west of La Palma and one from La Gomera, and A1.2 from the east of La Palma; subgroup A2 was divided into A2.1 with samples from the northeastern Tenerife and A2.2 from northwestern Tenerife and one from La Gomera. In addition, samples from El Hierro are located between subgroups A1.1 (La Palma) and A2.2 (Tenerife). In clade B, subgroup B2 was divided into B2.1 with samples from north of Gran Canaria and B2.2 with samples from the island’s center (Fig. 3A and B).
Fig. 3.
Population structure and colonization events of Kalotermes dispar-complex. A) Median-joining networks of K. dispar-complex based on the mitochondrial data set (cox2) from a sample of 42 individuals and 497-bp DNA sequences. Haplotype circle size is proportional to the number of samples within a given haplotype, and lines between haplotypes represent mutational steps within alleles. Colors denote the geographical origin of the individuals used in the analysis (Tenerife: red; Gran Canaria: green; La Palma: blue; La Gomera: yellow; and El Hierro: brown). Each subgroup is encircled with the same color as the one used in A. B) Map of sampling sites with possible colonization events. Clade A is represented in discs, and clade B in diamonds. Subgroup A1.1 in light blue and A1.2 in dark blue. Sub-group A2.1 in pink and A2.2 in violet. Subgroup B1 in red, B2.1 in dark green, and B2.2 in light green. Dashed lines represent the geographic boundaries between clades or subgroups; and the dates of colonization events. Localities’ names are in Fig. 1.
The within-group divergence calculated for the two Canary Island clades, A and B, was 1.3% and 2.6%, respectively. As a comparison, the divergence calculated among the K. flavicollis lineages was 2.6%, and among K. phoenicae samples, it was 2.9%. The average inter-clade divergence was 5.9%, ranging from 4.8% to 6.4% when comparing clade A.1 vs. clade B.2 and clade A.2 vs. clade B.1, respectively. The Canarian clade divergence from other Kalotermes taxa ranges from 9.7%, compared with K. approximatus, to 10.8%, compared with K. flavicollis lineages.
The original description of K. dispar by Grassé (1938) includes measurements and line drawings of the imago and major and minor soldiers from La Palma. Supplementary Figures S2 and S3 are photographs of the imago and largest soldier, respectively, also from La Palma (Clade A). We have included more complete measurements of both castes in Supplementary Tables S3 and S4. The soldier measurements were not bimodal, indicating a continuous size polymorphism from the largest to the smallest soldiers in each colony. Neither castes from clade A nor clade B could be differentiated by morphology or morphometrics (Supplementary Tables S3 and S4).
Kalotermes has been found infesting several wood plant species, but this genus has been more commonly found in Rumex lunaria (Polygonaceae) and Erica arborea (Ericaceae). When subsetting by clade, clade A shows a higher peak at middle elevations (200–400 m asl), while clade B shows a peak at higher elevations (700–1000 m asl) (Fig. 4). More concretely, subgroup B2 was always found above 900 m asl except for one specimen collected a 345 m asl. Clade A was found on several plant species, while clade B was found almost exclusively in Rumex lunaria (Fig. 5).
Fig. 4.
Altitudinal distribution of the different subgroups of Kalotermes dispar-complex.
Fig. 5.
Bipartite network showing the plant preferences of each subgroup of Kalotermes dispar-complex.
Discussion
Cryptic Diversity Within Kalotermes dispar-Complex
The termite fauna of the Canary Islands comprises only one native species belonging to Kalotermes genus (Grassé 1938, Lamb 1980); this is K. dispar, originally described from La Palma (Grassé 1938). In the present work, with the help of molecular data, we provide new data highlighting the phylogenetic placement of this species and its cryptic diversity. In fact, our analyses clearly indicated that collected Kalotermes colonies in Canary Island evolved as a distinct clade concerning other known Kalotermes species. Moreover, the presence of an internal structure within the clade further suggests the possible presence of cryptic taxa.
The molecular phylogenetic analysis split the analyzed samples into two divergent clades: A and B. Samples in the clade A have been morphologically identified as K. dispar in line with the geographic distribution on La Palma Island (Grassé 1938). Attempts to morphologically discriminate available imago and soldier specimens of the clade B from K. dispar failed to retrieve any divergence. More clade B specimens of these castes need to be measured to ensure that there are no morphological differences separating them from clade A. However, the level of genetic divergence between clades A and B suggests that the two lineages could represent two distinct, sister taxa. In fact, our estimate of average divergence between the two clades was 5.9%, reflecting, for example, the same level of divergence found among two well-established species as K. flavicollis and K. italicus (Luchetti et al. 2013, Schicchitano et al. 2018). Apart from genetic divergences, also ecological differences were found. In the Canary Islands, significant climatic variations are associated with subtle changes in altitude and orientation, which are affected by the trade-winds and the cool Canary Current. The climate is more humid on its windward north and northeast slopes due to the formation of a cloud layer typically between 700 and 1500 m asl and drier to the south and west without a cloud layer (del Arco and Rodríguez 2018). These climatic variations determine the distribution of animal and plant species within a given island. Specimens from clade A were collected at lower elevations (mean = 355 m asl), while individuals from clade B were found at higher elevations (mean = 680 m asl). Also, differences within clades were observed. Subgroup A2 shows an elevation peak of ca. 200 m asl, while the peak of subgroup A1 is ca. 350 m asl. The same occurs within clade B, with subgroup B1 showing a peak at ca. 650 m asl and subgroup B2 displaying its peak at ca. 1,000 m asl (Fig. 4). Clade B is located in the center of Gran Canaria and in the south of Tenerife, where the climate is drier, so they tend to occupy higher altitudes probably to reach their climatic optima. On the southern slope, an altitude of ca. 300 m asl is placed under the arid ombrotype, whereas at the same altitude, the northern slope is placed under a semiarid ombrotype, which in the southern slope is reached between 500 and 1,200 m asl (del Arco and Rodríguez 2018). Clade A is present in the north of Tenerife and La Palma, both more humid areas. In addition, members of clade A can also inhabit the laurel forest, a humid forest ecosystem, and the localities at the highest elevation within this clade correspond with colonies in this humid habitat. Host–plant relationships also differ between clades, with clade B being found primarily on Rumex lunaria. In contrast, clade A was found on up to sixteen different plant species (Fig. 5), suggesting that colonies of clade B are more specialists or that there are fewer trophic resources in the habitats where clade B is present. A more detailed sampling will be needed to discern between the two hypotheses. Although there is a geographically structured mtDNA variation and some ecological differences, the lack of significant morphological features prevents us from describing different clades or subgroups as new species. The coexistence of specimens from the clades A1 and A2 at La Gomera suggests the possibility of testing through genomic sequencing, such as ddRADseq, whether those subgroups are different species or not under the biological species concept (see Pérez-Delgado et al. 2022). Further studies comprising new analytical approaches (e.g., genomic sequencing, morphometrics, or niche modeling) are needed to test whether different clades or subgroups can be considered biological species or just a high level of intraspecific mtDNA variation.
Biogeography and Patterns of Colonization
Transoceanic rafting in wood flotsam, the dispersal mechanism proposed herein, has already been suggested for kalotermitid taxa (Buček et al. 2022). It is consistent with their peculiar lifestyle: as one-piece nesters, Kalotermes colonies live within tree branches that, on extremely rare occasions, may survive transoceanic rafting with the condition that the infested branch(es) remain subaerial as in the case of tsunami flotsam (Scheffrahn et al. 2006). This may explain the unexpected observed sister relationship between the Canary K. dispar lineage(s) and the North American species K. approximatus, the two clades having diverged from European taxa about 26 Mya. This close relationship suggests that a faunal exchange between North America and the Canary Islands would have occurred, and rafting is a likely explanation. It is to be noted that this process would have been facilitated by the North Atlantic subtropical gyre, a system of oceanic currents which circulate from the Caribbean and Florida to the Azores, through the Gulf Stream, and then to northwestern African coasts, embracing the Canary Islands, and flowing back through the North Equatorial current (Schmitz and McCartney 1993). It is difficult to determine the exact colonization route or whether its direction was east-west or vice versa. Biotic exchanges between the Nearctic and the Macaronesia were also proposed for other clades, such as mosses of the genus Orthotrichum (Patiño et al. 2013, Vigalondo et al. 2019), trees of the genera Clethra (Fior et al. 2003), Ilex (Manen et al. 2010), and Persea (Li et al. 2011), lichens of the genus Roccella (Tehler et al. 2009), or the blind crustacean of the genus Morlockia (Hoenemann et al. 2013). Both the recent separation of Palearctic and Nearctic Kalotermes (26 Mya, Buček et al. 2022), as well as the Canarian-Nearctic Kalotermes (16.8 Mya, this study), argues for a model of long-distance dispersal of this clade. Due to the absence of available sequences of K. monticola, we could not test the genetic affinities of the Canarian clade with populations of North Africa. Further sampling of Kalotermes from the New World and Africa would help to have a better picture of the dispersal dynamics of these taxa.
The Canary Islands are volcanic, oceanic islands that were, therefore, never connected to the mainland. All islands rose from the seafloor at different times during the origin of the archipelago: the oldest one, the easternmost Fuerteventura, originated about 23 Mya, while Gran Canaria, Tenerife, and La Gomera emerged between 15 Mya and 11 Mya, respectively, and La Palma and El Hierro were the youngest islands which originated less than 2 Mya (van den Bogaard 2013). In addition, Tenerife emerged initially as possibly three separate islands [Adeje (11.5 Mya), Teno (8 Mya), and Anaga (6 Mya)], and these proto-islands fused into the single present-day island only within the last 3.5 Mya (Carracedo et al. 2002). Considering the Kalotermes dispar-complex, both clades A and B show an internal structure that overlaps the sample distribution across the islands. Colonies distributed into La Palma are genetically distinguishable from those collected in the northern part of Tenerife, with the two sampled in La Gomera and one from El Hierro, which appear from the larger islands. The same can be observed for those samples collected in southern Tenerife and Gran Canaria. The biogeographic pattern of genetic differentiation within Tenerife here obtained fits with other Canarian taxa and has been evoked as a consequence of independent colonization events of the three proto-islands, with subsequent recent expansion (Juan et al. 2000, see table 4 in Mairal et al. 2015). For example, the endemic lizard Gallotia galloti (Oudart 1839) is divided into two subspecies in Tenerife with a clear north-south phylogeographic structure (Thorpe et al. 1996, Maca-Meyer et al. 2003) and another subspecies in La Palma after colonization from Tenerife (Cox et al. 2010). Similarly, the Tenerife gecko Tarentola delalandii (Duméril and Bibron 1836) shows a paraphyletic structure within Tenerife, overlapping the geographic range of the three proto-islands, and with populations in La Palma being originated from those of north Tenerife (Gübitz et al. 2000). Also, the Canary Island bellflower Canarina canariensis (L.) Vatke shows a polyphyletic grouping within Tenerife, with eastern Tenerife being the sister clade to Gran Canaria and western Tenerife being the sister clade to La Gomera, the latter being the source population of the younger islands of La Palma and El Hierro (Mairal et al. 2015). The mtDNA geographic genetic variation found for the Kalotermes dispar-complex fits with the proto-island model, in which it has had dispersal and colonization events to and between proto-islands, posteriorly fused into the single present-day island (Juan et al. 2000, Fernández‐Palacios et al. 2011). A strong divergence between the south of Tenerife (subgroup B1; Adeje) and the north (subgroup A2) was found. Also, within subgroup A2, there is a phylogeographic break between Anaga (A2.1) and Teno (A2.2) populations.
In addition, the differences in subgroup B2 between the northern part and center/south of Gran Canaria and in subgroup A1 between the east and west of La Palma could be related to geologic/volcanological events (Figs. 2 and 3). Gran Canaria is divided into two equal parts: the southwest older part (Miocene) and the younger northeast (Plio-Quaternary). La Palma was caused by two large volcanoes, one older to the north and the other to the south (Troll and Carracedo 2016).
In the present analysis, the obtained time tree estimated the age of the diversification of analyzed Canary Kalotermes as approximately 10.3 Mya and 5.1 Mya, aligning with the sampled islands’ early emergence. The time of A1–A2 and B1–B2 divergences is reconstructed at about 1.9 Mya and 3.6 Mya, respectively, in line with the later colonization of islands by overwater dispersal. Ten million years ago, the islands of Gran Canaria, La Gomera, and Adeje emerged, and 5 Ma ago were also the other two proto-islands of Tenerife (Fernández‐Palacios et al. 2011). A possible explanation could be that the ancestor of Canarian Kalotermes arrived on the emerged islands (one to Gran Canaria and the other to Adeje or La Gomera), and posteriorly, specimens from Gran Canaria colonized the south of Tenerife and from the northwest of Tenerife or La Gomera to Anaga and La Palma in two colonization events and subsequent El Hierro since Tenerife-La Gomera or La Palma (Fig. 3).
Inter-island dispersion may have also been facilitated by overwater dispersal. Recently, García-Olivares et al. (2017) showed that multiple lineages of endemic weevils colonized the island of La Palma after a mega-landslide event in La Orotava valley (north Tenerife; Krastel et al. 2001, Acosta et al. 2005). This pattern fits with our results, with the La Palma subgroup (A1) being a sister clade from the north of Tenerife (A2), suggesting that mega-landslides may have played a role in the colonization of the species complex within the Canary Islands. A more detailed sampling within the north of Tenerife will be needed to test whether the origin of the split of clade A fits with any of the known mega-landslides in Tenerife (see García-Olivares et al. 2017 and references therein). Following the mega-landslide hypothesis, at least three landslides occurred in Gran Canaria during the Pliocene (4.0–3.5 Mya), one towards the island’s north (Acosta et al. 2005). As the oceanic currents were towards the southeast, material from the landslide may have reached the south of Tenerife. This potential explanation fits temporal and spatially with the biogeographic pattern observed within clade B. However, due to the old origin of these subgroups, it should be less likely to find signatures on mtDNA due to lineage sorting (García-Olivares et al. 2017).
Supplementary Material
Acknowledgments
We wish to thank David Lugo for his help with DNA extraction and amplification, as well as Rafael García, Carmelo Andújar, Paula Arribas, Heriberto López, Laura García, and Aitor Rizo for fieldwork assistance. We would like to thank the Canary Government Biodiversity Service and the Cabildos (Island Councils) for supporting and collecting permits (2017/226644 and YMG/cpa). We are grateful to Guido Jones for providing language revision.
Contributor Information
David Hernández-Teixidor, Island Ecology and Evolution Research Group, Instituto de Productos Naturales y Agrobiología (IPNA-CSIC), 38206 La Laguna, Spain; Grupo de Investigaciones Entomológicas de Tenerife (GIET), 38108 La Laguna, Spain.
Alex Cussigh, Department of Biological, Geological and Environmental Sciences, University of Bologna, via Selmi 3, 40126 Bologna, Italy.
Daniel Suárez, Island Ecology and Evolution Research Group, Instituto de Productos Naturales y Agrobiología (IPNA-CSIC), 38206 La Laguna, Spain; Grupo de Investigaciones Entomológicas de Tenerife (GIET), 38108 La Laguna, Spain.
Javier García, Grupo de Investigaciones Entomológicas de Tenerife (GIET), 38108 La Laguna, Spain.
Rudolf H Scheffrahn, Fort Lauderdale Research and Education Center, Institute for Food and Agricultural Sciences, 3205 College Avenue, Davie, FL 33314, USA.
Andrea Luchetti, Department of Biological, Geological and Environmental Sciences, University of Bologna, via Selmi 3, 40126 Bologna, Italy.
Author contributions
David Hernández-Teixidor (Conceptualization [lead], Funding acquisition [equal], Investigation [equal], Methodology [equal], Project administration [lead], Visualization [equal], Writing—original draft [equal], Writing—review & editing [equal]), Alex Cussigh (Formal analysis [equal], Investigation [equal], Writing—review & editing [supporting]), Daniel Suárez (Formal analysis [equal], Investigation [equal], Methodology [equal], Writing—original draft [equal], Writing—review & editing [equal]), Javier García (Investigation [equal], Writing—review & editing [supporting]), Rudolf Scheffrahn (Formal analysis [equal], Investigation [equal], Methodology [equal], Validation [equal], Writing—review & editing [equal]), and Andrea Luchetti (Conceptualization [equal], Formal analysis [equal], Funding acquisition [equal], Investigation [equal], Methodology [equal], Writing—original draft [equal], Writing—review & editing [equal])
Funding
D.H.T. is currently funded by the Cabildo de Tenerife. The work was also supported by Canziani Foundation grant to A.L. D.S. was funded by the Spanish “Ministerio de Ciencia e Innovación” through an FPI Ph.D. fellowship (PRE2018-083230).
References
- Abe T. 1987. Evolution of life types in termites. In: Kawano S, Connell JH, Hidaka T, editors. Evolution and coadaptation in biotic communities. Tokyo: University of Tokyo Press; p. 126–148. [Google Scholar]
- Acosta J, Uchupi E, Muñoz A, et al. ZEE Working Group. 2005. Geologic evolution of the Canarian Islands of Lanzarote, Fuerteventura, Gran Canaria and La Gomera and comparison of landslides at these islands with those at Tenerife, La Palma and El Hierro. In: Clift P, Acosta J, editors. Geophysics of the Canary Islands. Dordrecht (UK): Springer; p. 1–40. [Google Scholar]
- Bandelt HJ, Forster P, Röhl A.. 1999. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16(1):37–48. 10.1093/oxfordjournals.molbev.a026036 [DOI] [PubMed] [Google Scholar]
- Buček A, Wang M, Šobotník J, et al. 2022. Molecular phylogeny reveals the past transoceanic voyages of drywood termites (Isoptera, Kalotermitidae). Mol. Biol. Evol. 39(5):msac093. 10.1093/molbev/msac093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carracedo JC, Torrado FJP, Ancochea E, et al. 2002. Cenozoic volcanism II: the canary islands. In: Gibbons W, Moreno T, editors. The geology of Spain. London: Geological Society; p. 439–472. [Google Scholar]
- Constantino R. 2022. Termite database. Brasília: University of Brasília; http://termitologia.net [Google Scholar]
- Cox SC, Carranza S, Brown RP.. 2010. Divergence times and colonization of the Canary Islands by Gallotia lizards. Mol. Phylogen. Ev ol. 56(2):747–757. 10.1016/j.ympev.2010.03.020 [DOI] [PubMed] [Google Scholar]
- del Arco MJ, Rodríguez O.. 2018. Vegetation of the Canary Islands. Plant and vegetation, vol. 16. Cham: Springer; p. 429. [Google Scholar]
- Dormann C, Fruend J, Bluethgen N, et al. 2009. Indices, graphs and null models: analyzing bipartite ecological networks. Open Ecol. J. 2:7–24. 10.2174/1874213000902010007 [DOI] [Google Scholar]
- Drummond AJ, Rambaut A.. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7:214. 10.1186/1471-2148-7-214 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Emerson AE. 1969. A revision of the tertiary fossil species of the Kalotermitidae (Isoptera). Am. Mus. Novit. 2359:1–57. [Google Scholar]
- Fernández‐Palacios JM, De Nascimento L, Otto R, et al. 2011. A reconstruction of Palaeo‐Macaronesia, with particular reference to the long‐term biogeography of the Atlantic island laurel forests. J. Biogeogr. 38(2):226–246. 10.1111/j.1365-2699.2010.02427.x [DOI] [Google Scholar]
- Fior S, Karis PO, Anderberg AA.. 2003. Phylogeny, taxonomy, and systematic position of Clethra (Clethraceae, Ericales) with notes on biogeography: evidence from plastid and nuclear DNA sequences. Int. J. Plant Sci. 164(6):997–1006. 10.1086/378655 [DOI] [Google Scholar]
- García‐Olivares V, López H, Patino J, et al. 2017. Evidence for mega‐landslides as drivers of island colonization. J. Biogeogr.44(5):1053–1064. 10.1111/jbi.12961 [DOI] [Google Scholar]
- Ghesini S, Marini M.. 2013. A dark-necked drywood termite (Isoptera: Kalotermitidae) in Italy: description of Kalotermes italicus sp. nov. Fla. Entomol. 96(1):200–211. 10.1653/024.096.0127 [DOI] [Google Scholar]
- Ghesini S, Marini M.. 2015. Molecular characterization and phylogeny of Kalotermes populations from the Levant, and description of Kalotermes phoeniciae sp. Nov. Bull. Entomol. Res. 105(3):285–293. 10.1017/S0007485315000097 [DOI] [PubMed] [Google Scholar]
- Ghesini S, Simon D, Marini M.. 2014. Kalotermes sinaicus Kemner (Isoptera, Kalotermitidae): new morphological and genetic evidence, and assignment to the new genus Longicaputermes gen. nov. Insectes Soc. 61(2):123–131. 10.1007/s00040-013-0335-1 [DOI] [Google Scholar]
- Gómez–Zurita J, Juan C, Petitpierre E.. 2000. The evolutionary history of the genus Timarcha (Coleoptera, Chrysomelidae) inferred from mitochondrial COII gene and partial 16S rDNA sequences. Mol. Phylogenet. Evol. 14(2):304–317. 10.1006/mpev.1999.0712 [DOI] [PubMed] [Google Scholar]
- Grassé PP. 1938. Calotermes dispar n. sp. termite nouveau des Iles Canaries. Le polymoprhisme des soldats chez les Calotermitides. Bull. Soc. Entomol. Fr. 42(20):291–295. [Google Scholar]
- Gübitz T, Thorpe RS, Malhotra A.. 2000. Phylogeography and natural selection in the Tenerife gecko Tarentola delalandii: testing historical and adaptive hypotheses. Mol. Ecol. 9(9):1213–1221. 10.1046/j.1365-294x.2000.00997.x [DOI] [PubMed] [Google Scholar]
- Hoenemann M, Neiber MT, Humphreys WF, et al. 2013. Phylogenetic analysis and systematic revision of Remipedia (Nectiopoda) from Bayesian analysis of molecular data. J. Crustac. Biol. 33(5):603–619. 10.1163/1937240X-00002179 [DOI] [Google Scholar]
- Juan C, Emerson BC, Oromí P, et al. 2000. Colonization and diversification: towards a phylogeographic synthesis for the Canary Islands. Trends Ecol. Evol. 15(3):104–109. 10.1016/S0169-5347(99)01776-0 [DOI] [PubMed] [Google Scholar]
- Kalyaanamoorthy S, Minh BQ, Wong TKF, et al. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat. Methods 14(6):587–589. 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Katoh K, Standley DM.. 2013. MAFFT multiple sequence alignment software Version 7: improvements in performance and usability. Mol. Biol. Evol. 30(4):772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Krastel S, Schmincke HU, Jacobs CL, et al. 2001. Submarine landslides around the Canary Islands. J. Geophys. Res. Solid Earth 106(B3):3977–3997. 10.1029/2000jb900413 [DOI] [Google Scholar]
- Krishna K, Grimaldi DA, Krishna V, et al. 2013. Treatise on the Isoptera of the World. Bull. Am. Mus. Nat. Hist. 377(7):1–200. 10.1206/377.1 [DOI] [Google Scholar]
- Lamb RW. 1980. Termites (Isoptera) of Macaronesia. Bol. Mus. Munic. Funchal 33(142):44–66. [Google Scholar]
- Lanfear R, Calcott B, Ho SY, et al. 2012. Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol. 29(6):1695–1701. 10.1093/molbev/mss020 [DOI] [PubMed] [Google Scholar]
- Li L, Li J, Rohwer JG, et al. 2011. Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical Amphi‐Pacific disjunctions. Am. J. Bot. 98(9):1520–1536. 10.3732/ajb.1100006 [DOI] [PubMed] [Google Scholar]
- Luchetti A, Dedeine F, Velonà A, et al. 2013. Extreme genetic mixing within colonies of the wood-dwelling termite Kalotermes flavicollis (Isoptera, Kalotermitidae). Mol. Ecol. 22(12):3391–3402. 10.1111/mec.12302 [DOI] [PubMed] [Google Scholar]
- Maca-Meyer N, Carranza S, Rando JC, et al. 2003. Status and relationships of the extinct giant Canary Island lizard Gallotia goliath (Reptilia: Lacertidae), assessed using ancient mtDNA from its mummified remains. Biol. J. Linn. Soc. 80(4):659–670. 10.1111/j.1095-8312.2003.00265.x [DOI] [Google Scholar]
- Mairal M, Sanmartín I, Aldasoro JJ, et al. 2015. Palaeo‐islands as refugia and sources of genetic diversity within volcanic archipelagos: the case of the widespread endemic Canarina canariensis (Campanulaceae). Mol. Ecol. 24(15):3944–3963. 10.1111/mec.13282 [DOI] [PubMed] [Google Scholar]
- Manen JF, Barriera G, Loizeau PA, et al. 2010. The history of extant Ilex species (Aquifoliaceae): evidence of hybridization within a Miocene radiation. Mol. Phylogenet. Evol. 57(3):961–977. 10.1016/j.ympev.2010.09.006 [DOI] [PubMed] [Google Scholar]
- Palumbi SR. 1996. Nucleic acid II: the polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK, editors. Molecular systematics. Sunderland: Sinauer Associates; p. 205–247. [Google Scholar]
- Patiño J, Medina R, Vanderpoorten A, et al. 2013. Origin and fate of the single‐island endemic moss Orthotrichum handiense. J. Biogeogr. 40(5):857–868. 10.1111/jbi.12051 [DOI] [Google Scholar]
- Pérez‐Delgado AJ, Arribas P, Hernando C, et al. 2022. Hidden island endemic species and their implications for cryptic speciation within soil arthropods. J. Biogeogr. 49(7):1367–1380. 10.1111/jbi.14388 [DOI] [Google Scholar]
- Roonwal ML. 1970. Termites of the oriental region. In: Krishna K, Weesner FM, editors. Biology of termites, vol. 2. New York, London: Academic Press; p. 315–391. [Google Scholar]
- Scheffrahn RH, Postle A.. 2013. New termite species and newly recorded genus for Australia: Marginitermes absitus (Isoptera: Kalotermitidae). Aust. J. Entomol. 52(3):199–205. 10.1111/aen.12023 [DOI] [Google Scholar]
- Scheffrahn RH, Křeček J, Chase JA, et al. 2006. Taxonomy, biogeography, and notes on termites (Isoptera: Kalotermitidae, Rhinotermitidae, Termitidae) of the Bahamas and Turks and Caicos Islands. Ann. Entomol. Soc. Am. 99(3):463–486. 10.1603/0013-8746(2006)99[463:tbanot]2.0.co;2 [DOI] [Google Scholar]
- Schmitz W Jr, McCartney MS.. 1993. On the north Atlantic circulation. Rev. Geophys. 31(1):29–49. 10.1029/92rg02583 [DOI] [Google Scholar]
- Scicchitano V, Dedeine F, Mantovani B, et al. 2018. Molecular systematics, biogeography and colony fusion in the European dry-wood termites Kalotermes spp. (Blattodea, Termitoidae, Kalotermitidae). Bull. Entomol. Res. 108(4):523–531. 10.1017/S0007485317001080 [DOI] [PubMed] [Google Scholar]
- Simon C, Frati F, Beckenbach A, et al. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87(6):651–701. 10.1093/aesa/87.6.651 [DOI] [Google Scholar]
- Suárez D, Arribas P, Jiménez-García E, et al. 2022. Dispersal ability and its consequences for population genetic differentiation and diversification. Proc. R. Soc. B. 289(1975):20220489. 10.1098/rspb.2022.0489 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tamura K, Stecher G, Kumar S.. 2021. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 38(7):3022–3027. 10.1093/molbev/msab120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tehler A, Irestedt M, Bungartz F, et al. 2009. Evolution and reproduction modes in the Roccella galapagoensis aggregate (Roccellaceae, Arthoniales). Taxon. 58(2):438–456. 10.1002/tax.582010 [DOI] [Google Scholar]
- Thiel M, Haye PA.. 2006. The ecology of rafting in the marine environment. III. Biogeographical and evolutionary consequences. In: Gibson RN, Atkinson RJA, Gordon JDM, editors. Oceanography and marine biology: an annual review, vol. 44. Boca Raton (Oxon): Taylor & Francis; p. 323–429. [Google Scholar]
- Thorpe RS, Black H, Malhotra A.. 1996. Matrix correspondence tests on the DNA phylogeny of the Tenerife lacertid elucidate both historical causes and morphological adaptation. Syst. Biol. 45(3):335–343. 10.1093/sysbio/45.3.335 [DOI] [Google Scholar]
- Tonini F, Hochmair HH, Scheffrahn RH, et al. 2013. Simulating the spread of an invasive termite in an urban environment using a stochastic individual-based model. Environ. Entomol. 42(3):412–423. 10.1603/EN12325 [DOI] [PubMed] [Google Scholar]
- Trifinopoulos J, Nguyen LT, von Haeseler A, et al. 2016. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 44(W1):W232–W235. 10.1093/nar/gkw256 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Troll VR, Carracedo JC.. 2016. The geology of the Canary Islands. Amsterdam: Elsevier; p. 636. [Google Scholar]
- van den Bogaard P. 2013. The origin of the Canary Island Seamount Province-New ages of old seamounts. Sci. Rep. 3(1):2107. 10.1038/srep02107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Velonà A, Luchetti A, Ghesini S, et al. 2011. Mitochondrial and nuclear markers highlight the biodiversity of Kalotermes flavicollis (Fabricius, 1793) (Insecta, Isoptera, Kalotermitidae) in the Mediterranean area. Bull. Entom. Res. 101:353–364. 10.1017/S000748531000060X [DOI] [PubMed] [Google Scholar]
- Vigalondo B, Patiño J, Draper I, et al. 2019. The long journey of Orthotrichum shevockii (Orthotrichaceae, Bryopsida): from California to Macaronesia. PLoS One 14(2):e0211017. 10.1371/journal.pone.0211017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wickham H. 2016. ggplot2: elegant graphics for data analysis. New York: Springer-Verlag; https://ggplot2.tidyverse.org. [Google Scholar]
- Xia X. 2018. DAMBE7: New and improved tools for data analysis in molecular biology and evolution. Mol. Biol. Evol. 35(6):1550–1552. 10.1093/molbev/msy073 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xia X, Lemey P.. 2009. Assessing substitution saturation with DAMBE. In: Lemey P, Salemi M, Vandamme A-M, editors. The phylogenetic handbook: a practical approach to DNA and protein phylogeny. Cambridge: Cambridge University Press; p. 615–630. [Google Scholar]
- Xia X, Xie Z, Salemi M, et al. 2003. An index of substitution saturation and its application. Mol. Phylogenet. Evol. 26(1):1–7. 10.1016/s1055-7903(02)00326-3 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






