Are Altered Expression of Vascular Endothelial Growth Factor and Placental Growth Factor Associated with Placental Angiogenesis in Recurrent Pregnancy Loss?

Abstract

Angiogenesis is one of the most important steps during pregnancy for placental and fetal development. Based on the hypothesis that vascular insufficiency and altered angiogenesis may lead to early pregnancy loss, the present study was aimed to understand the role of Vascular endothelial growth factor (VEGFA) and Placental growth factor (PLGF) gene expression in placental angiogenesis in the pathogenesis of Recurrent pregnancy loss (RPL). Gene expression analysis of VEGFA and PLGF was carried out in the placental tissue collected from 30 women with recurrent pregnancy loss and compared with the placenta obtained from 16 women with medically terminated pregnancy. The mRNA expression of both VEGFA and PLGF genes were significantly downregulated in the placenta of recurrent pregnancy loss in comparison to the placenta of medically terminated pregnancies. In conclusion the results of the present study suggest that altered expression of VEGFA and PLGF genes in placenta disturb the angiogenesis and contribute to the pathogenesis of recurrent pregnancy loss.

Introduction

Recurrent pregnancy loss (RPL), is the most common pregnancy obstacle, diagnosed as the loss of two or more consecutive pregnancies. About 1–2% of the women experience recurrent pregnancy loss according to the epidemiological studies [1]. Development of a human foetus needs a connection to be formed between the maternal and embryonic tissues through placenta. Placental trophoblast cells enter the uterine spiral arteries of the decidua and endorse their remodelling into a low-resistance, high-capacitance vascular network during implantation [2]. Vasculogenesis and angiogenesis are the processes that promotes the development of new blood vessels and the branching of already existing ones, which further expand and enrich the vascularity of the placenta. The placental microenvironment is dynamic and the vascular endothelial growth factor (VEGFA) is considered as one of the most potent stimulators of angiogenesis, inducing the differentiation of hemangioblasts into endothelial cells, promoting endothelial cell proliferation and migration, and inhibiting the process of apoptosis [3]. Placental growth factor (PLGF) is a pro-angiogenic molecule, member of the VEGF family and expresses mainly in the placenta. PLGF promotes placental vascularization and maturation of the utero-placental vascular network. The interruption of regular vascular development in the placenta is implicated in several gestational complications, which includes preeclampsia, intrauterine growth restriction, stillbirth and miscarriage [4]. Taking the process of angiogenesis in due consideration in the pregnancy and foetal development, the present study was taken up to investigate whether an altered expression of VEGFA and PLGF plays a role in placental angiogenesis in recurrent pregnancy loss.

Materials and Methods

The present case–control study consists of gestational age matched 30 women with unexplained recurrent pregnancy loss and 16 women with medically terminated pregnancy, who were enrolled from Government Modern Maternity Hospital, Petlaburj, Hyderabad. The clinical history of the study group was collected using a standard questionnaire. Prior informed consent was obtained from all the study subjects. The study was approved by the Institutional Ethics Committee. Placental tissue was obtained from both the case and control group to study the mRNA expression of VEGFA and PLGF genes using Real-Time qPCR.

Inclusion and Exclusion Criteria

Placental tissue from women with unexplained recurrent pregnancy loss were considered as cases. While, the pregnancy losses due to known causes such as chromosomal abnormalities, uterine anomalies, endocrine disturbances, antiphospholipid syndrome, inherited thrombophilia and infections were excluded from the study. Placental tissue from women with medically terminated pregnancies who has successfully given birth to at least two children and does not have any medical history of pregnancy loss were regarded as control subjects.

Tissue Collection

Placental tissue was collected in RNA later solution (Invitrogen, Thermo scientific solutions) from both recurrent pregnancy loss and medically terminated pregnancies and stored at −80 °C till further use.

Total RNA Isolation and Purification

Total RNA from placental tissue was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions. Purity and concentration of RNA was estimated by Nanodrop (Eppendorf).

Primer Designing

The forward and reverse primers for the target genes VEGFA and PLGF and endogenous control Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were designed by obtaining all mRNA transcripts sequences from NCBI. All the transcripts were compared using Clustal omega multi sequence alignment. Primer quest tool from Integrated DNA Technologies (IDT) was used to design the appropriate primers and probes. The obtained primers were checked by Basic local alignment search tool (BLAST). The primers and probe sequences were synthesised from Eurofins India Pvt Limited.

cDNA Synthesis and Real-Time RT-PCR

cDNA was synthesised by using QuantiTect Reverse Transcription Kit (Qiagen). The reaction was incubated for 30 min at 42 °C and 3 min at 95 °C according to the manufacturer’s instructions. Amplification of the target genes VEGFA, PLGF and housekeeping gene GAPDH were done by quantitative real-time (qRT)-PCR using gene specific oligonucleotides and TaqMan probes (Table 1). In each reaction, 20 ng cDNA, 10 µl premix 2× master mix (Takara) and 100 nM of each forward and reverse primers were added. Amplification was performed in Applied Biosystems, Step One Real Time PCR System using a two-step cycling protocol. The cycling conditions for the reaction were 95 °C–30 s, 95 °C–5 s and acquiring at 60 °C for VEGFA and 58 °C for PLGF for 45 s, and 40 cycles were performed.

Table 1.

Primers and probes sequences used for qPCR

S. no	Gene	Forward primer	Reverse primer	Probe	Fluorophore
1.	VEGFA	CTTGCCTTGCTGCTCTACC	ATGATTCTGCCCTCCTCCTT	CACCATGCCAAGTGGTCC	FAM
2.	PLGF	TGATCTCCCCTCACACTTTGC	CACCTTGGCCGGAAAGAA	TTTGCTTGTACTGGGACATTG	FAM
3.	GAPDH	CTCTCTGCTCCTCCTGTTCG	CCATGGTGTCTGAGCGATGT	ATCTTCTTTTGCGTCGCCAG	VIC

Statistical Analysis

The difference between the level of expression in VEGFA and PLGF genes in recurrent pregnancy loss and medically terminated pregnancies were determined by Livak method [5]. Comparison of values between the two groups were performed by paired, two tailed, non-parametric t-test using Graph pad Prism version 9.3.1(471). Statistical significance was established at p < 0.05.

Results

The clinical characteristics of the study group are represented in the Table 2. The mean age of the cases was 25.23 ± 2.51, while the mean age of controls was 29.21 ± 3.54. The body mass index of the cases was 24.48 ± 3.54, whereas in controls the body mass index was 23.55 ± 3.02. The gestational age of the cases was 11.02 ± 3.12 (weeks), while 12.14 ± 3.72 (weeks) in controls.

Table 2.

Clinical characteristics of the study subjects

Category	Sample size	Age (years)	BMI (kg/m2)	Gestational age (weeks)
Cases	30	25.23 ± 2.51	24.48 ± 3.54	11.02 ± 3.12
Controls	16	29.21 ± 3.54	23.55 ± 3.02	12.14 ± 3.72

Relative quantification of mRNA expression of growth factors VEGFA and PLGF from placenta of recurrent pregnancy loss and medically terminated pregnancies was done in order to know whether the altered expression of these angiogenesis related growth factors plays a role in the pathogenesis of recurrent pregnancy loss. Real time qpcr results for the relative mRNA expression of VEGFA and PLGF growth factors in both the case and control groups are represented in Fig. 1a and b. Our results showed a significantly downregulated mRNA expression of VEGFA (1.27-fold, p < 0.0001) and PLGF (1.26-fold, p< 0.0001) genes in the placenta of recurrent pregnancy loss compared to medically terminated pregnancies (VEGFA-2.77 fold and PLGF-2.67 fold) (Table 3).

Fig. 1.

a mRNA expression of placental VEGFA in cases and controls. b Placental mRNA expression of PLGF in cases and controls

Table 3.

Fold change expression and P value of the study group

Gene		ΔCt	ΔΔCt	2^−ΔΔCt	SD	SE	P value
VEGFA	Cases (30)	4.30	−0.32	1.27	0.24	0.04	< 0.0001
	Controls (16)	3.16	−1.46	2.77	0.35	0.09
PLGF	Cases (30)	5.88	0.30	1.26	0.34	0.06	< 0.0001
	Controls (16)	4.78	−1.41	2.67	0.39	0.10

SD Standard deviation, SE standard error

Discussion

Implantation and development of a human embryo needs an increased level of angiogenesis. Various growth factors have been related with placental angiogenesis and embryonic development. Flaws in vascular formation and angiogenesis are among the causes leading to an increased risk of pregnancy loss. Angiogenesis is one of the most important steps in embryogenesis, characterized by the formation of new blood vessels from previous blood vessels. Imbalance in the angiogenesis process from starting and sprouting vessels to maturation, can decrease the chances of the foetal survival due to lack of exchange of nutrients, oxygen, and waste products. VEGF and PLGF are the two synergistic molecules acting on angiogenesis. The increased expression of these two growth factors in the endometrium during the implantation of embryo indicates the crucial role of angiogenesis for successful embryo implantation. VEGF and PLGF strive for the binding site of Fms-like tyrosine kinase 1 (Flt-1) receptor, a member of the tyrosine kinase receptor family. Activation of Flt-1 leads to the differentiation and migration of endothelial cells, therefore promoting angiogenesis [3].

Placental VEGF expression is crucial for normal vasculogenesis and maintenance of the embryo [6]. Aberrant placental VEGFA expression may lead to adverse pregnancy outcomes such as pregnancy loss, intrauterine fetal death, intrauterine fetal growth restriction and pre-eclampsia [7, 8]. VEGF and its receptors (VEGFR1/Flt-1, VEGFR2/KDR/Flk-1) play an important role in oocyte maturation, embryo implantation, fetal development and placentation [9, 10]. Women with recurrent miscarriage had shown lower circulating serum levels of VEGF compared with non-pregnant and pregnant women with live births [11]. Studies on mRNA expression and immunohistochemistry for VEGF in the placenta, showed higher levels of VEGF expression amongst the women with recurrent spontaneous miscarriage [12, 13]. VEGF expression at mRNA and protein level were significantly decreased in the villi and decidua from women with RPL compared with women with normal early pregnancy [14]. According to Amirchaghmaghi et al. (2015) although, VEGF, VEGFR1 and VEGFR2 gene expression was detected in endometrial samples of both women with unexplained recurrent spontaneous abortion and fertile women, the mean relative expression of VEGF was lower in the case group compared with control group. Nevertheless, both VEGF receptors were highly expressed in the endo¬metrium of the case group. Further, the serum level of VEGF was significantly higher in the case group compared with the controls [15]. The results in the present study are in concordance with the earlier studies, wherein the mRNA expression of VEGFA was significantly downregulated in the recurrent pregnancy loss group compared to the medically terminated pregnancies.

During pregnancy, the placental trophoblast is the key source of PLGF and its expression is suggestively upregulated at an early gestational age after implantation [16]. Although PLGF plays an inert role in physiological functions, it is involved in embryo implantation and early pregnancy. PLGF functions are characterized in both angiogenic and inflammatory mechanisms. Association of PIGF with VEGF emphasizes angiogenesis, while impairment of VEGF/VEGFR-2 signaling pathways promotes inflammatory pathways, which might lead to implantation site arrest, thus resulting in pregnancy loss [17]. During normal pregnancy serum levels of secreted PLGF increases to a peak around 30th week of gestation, while lower levels of PIGF are reported in women with preeclampsia [18]. Serum and trophoblast PLGF levels were decreased in the early stage of complicated pregnancies such as ectopic pregnancy, missed abortion, miscarriage and preeclampsia [19–22]. According to Galaziou et al. (2021) placental mRNA expression of VEGF and PLGF did not differ between induced and spontaneous abortions, except for an insignificant increase of PLGF in spontaneous abortions [23]. However, in the present study the PLGF mRNA expression was significantly downregulated in the placenta of women with recurrent pregnancy loss compared to the placenta from medically terminated pregnancies.

At present the clinical treatments for angiogenesis related disorders emphasize on VEGF and its downstream goals. Anti VEGF therapies like antibodies against VEGF are used in various cancers [24]. However, anti-VEGF therapies have antiangiogenic effects which may prevent fetal development and cause fetal abnormalities in the early stage of pregnancy [25]. PLGF treatment prevents the progression of hypertension and can lower sFlt-1 levels, and have less damaging side effects compared to VEGF therapy, as VEGF bounds to VEGFR-2 and Flt-1, which may lead to higher vascular permeability and edema [26]. PLGF treatment seems to be a new prospect to reduce early pregnancy failure caused due to ischemia and clinical use. Taking the observations of the VEGFA and PLGF treatments into due considerations new treatment regimens can be developed which promotes angiogenesis instead of antiangiogenic effects, which promotes normal placental angiogenesis, implantation and foetal development and prevents pregnancy loss.

In conclusion, the present study highlights the downregulated placental expression of VEGFA and PLGF genes in the recurrent pregnancy loss women compared to the medically terminated pregnancies, which indicates that altered placental expression of the growth factors VEGFA and PLGF plays an important role in placental angiogenesis and in the aetiology of RPL.

Author contribution

Study conception and design, material preparation, data collection, data analysis and manuscript preparation were done by SS. MRRD helped in the execution of work. MKR provided the placental tissue samples for the study. PPR has given valuable inputs for the completion of the study. VA approved the final version of the manuscript.

Funding

The present study was financially supported by Department of Science and Technology (DST), New Delhi under DST Women Scientist (WOS-A) scheme.

Declarations

Conflict of interest

None to declare.

Ethical Approval

The present study was approved by Institutional Ethics Committee.

Informed Consent

Prior informed consent was obtained by all the study subjects.