Abstract
Simple Summary
Prolactin (PRL) plays an important role in animal molecule development and ovulation. However, the regulatory effects on the different stages of the estrus cycle in ewes are unclear. We studied the effect of PRL on the secretion of reproductive hormones, follicle counts, and gene expressions via the PRL inhibitor bromocriptine. Our findings show that PRL had no significant effect on the of the estrus cycle. PRL inhibition affected the serum concentrations of E2, FSH, and GnRH, as well as the expression of PR, FSHR, LHR, 3β-HSD, StAR, CYP11A1, CYP19A1, Bax, Bcl-2, and Caspase-3 in different stages of the estrus cycle. These results provide a basis for understanding the mechanisms underlying the regulation of the ewe estrus cycle by PRL.
Abstract
Prolactin (PRL) plays an important role in animal follicle development and ovulation. However, its regulatory effects on the different stages of the estrus cycle in ewes are unclear. In this study, bromocriptine (BCR, PRL inhibitor) was used to study the effect of PRL on the secretion of reproductive hormones and gene expressions in order to explore its regulatory effects on the sexual cycle of ewes. Eighty healthy ewes with the same parity and similar weights were randomly assigned to the control group (C, n = 40) and the treatment group (T, n = 40, fed bromocriptine). After estrus synchronization, thirty-one ewes with overt signs of estrus were selected from each group. Six blood samples were randomly obtained by jugular venipuncture to measure the concentration of PRL, estrogen (E2), progesterone (P4), luteinizing hormone (LH), follicle-stimulating hormone (FSH), and gonadotropin-releasing hormone (GnRH) in the proestrus, estrus, metestrus, and diestrus. At the same time, we collected the ovaries of the six ewes in vivo after anesthesia in order to detect follicle and corpus luteum (CL) counts and measure the expression of hormone-receptor and apoptosis-related genes. The results show that PRL inhibition had no significant effects on the length of the estrus cycle (p > 0.05). In proestrus, the number of large and small follicles, the levels of E2, FSH, and GnRH, and the expressions of ER, FSHR, and the apoptotic gene Caspase-3 were increased (p < 0.05); and the number of middle follicles and the expression of anti-apoptotic gene Bcl-2 were decreased (p < 0.05) in the T group. In estrus, the number of large follicles, the levels of E2 and GnRH, and the expressions of the StAR, CYP19A1, and Bcl-2 genes were increased (p < 0.05), and the number of middle follicles was decreased (p < 0.05) in the T group. In metestrus, the number of small follicles and the expression of LHR (p < 0.05) and the pro-apoptotic gene Bax were increased (p < 0.05); the number of middle follicles was decreased (p < 0.05) in the T group. In diestrus, the number of large follicles, middle follicles, and CL, the level of P4, and the expressions of PR, 3β-HSD, StAR, Caspase-3, and Bax were increased (p < 0.05); the number of small follicles and the expression of Bcl-2 were decreased (p < 0.05) in the T group. In summary, PRL inhibition can affect the secretion of reproductive hormones, the follicle count, and the gene expression during the estrus cycle. These results provide a basis for understanding the mechanisms underlying the regulation of the ewe estrus cycle by PRL.
Keywords: prolactin, ovary, serum hormone, reproduction, sheep
1. Introduction
An ewe’s estrus cycle is 16–17 days [1]. It consists of four stages, including the proestrus, estrus, metestrus, and diestrus [2], which involve the activation and growth of primordial follicles, the selection and maturation of the dominant follicle, and ovulation [3]. Hormones regulate follicular development and atresia [4]. Follicle development is divided into the follicle-stimulating hormone (FSH) and luteinizing hormone (LH)-dependent stages; a decrease in hormone secretion leads directly to follicular atresia [5]. LH and FSH act directly on the theca externa and the GCs of follicles, inducing the final and nuclear maturation stages of oocytes, as well as the subsequent rupture of follicles and the formation of corpus luteum [6]. In GCs, estradiol 17 beta (E2) assumes a central role in follicular development and selection by activating estrogen receptors beta (ER) [7]. The intrafollicular P4 concentration is influenced by the presence of the corpus luteum (CL) and modulates the biological processes related to follicular cell development and oocyte competence [8]. In sheep follicle development and ovulation, endocrine regulation can greatly improve the reproductive rate and economic benefits of sheep.
Prolactin (PRL) is primarily secreted by the lactotrophs of the pituitary, acting via the prolactin receptor (PRLR) on the target cell [9]. In addition to regulating lactation [10], growth performance [11], animal behavior [12], and metabolism [13], PRL also plays a crucial role in reproductive processes such as follicle development and ovulation, with changes in its concentration particularly closely related to estrus and ovulation [14,15]. Studies have shown that PRL has important modulatory effects on the reproductive system in sheep via inhibitory actions on pituitary gonadotrophs and hypothalamic gonadotrophin hormone release [16], regulating the production of reproductive hormones including E2 [17], P4 [18], LH [19], FSH [20], and GnRH [21]. A reduction in PRL indirectly leads to an increase in the LH pulse frequency, which regulates follicular development [22]. Blaszczyk et al. showed that the PRL concentrations of Anglo-Nubian dairy goats in Poland were significantly higher during the non-breeding season than during the breeding season [23]. Reducing PRL during non-breeding seasons induces off-season estrus in sheep [24]. Bromocriptine (BCR), a commonly used dopamine agonist [25,26,27], can reduce PRL levels in the body [28], thus alleviating hypogonadism, infertility, galactorrhea, oligomenorrhea, and amenorrhea due to serum PRL elevation [29,30]. However, the regulation of the estrus cycle in sheep via PRL inhibition remains unclear.
The aim of this study was to determine whether PRL plays a regulatory role in the sexual cycle of ewes. In this study, bromocriptine (BCR, PRL inhibitor) was used to investigate the effects of PRL inhibition on serum reproductive hormones and reproduction-related genes in ewes during the proestrus, estrus, metestrus, and diestrus stages.
2. Materials and Methods
2.1. Animals and Feeding Management
This study was conducted during the breeding season (November) at the Zhihao Livestock Science and Technology Corporation in Wuyi, Hengshui, China. All procedures utilized in this study were approved by the Laboratory Animal Ethics Committee at Hebei Agricultural University (Hebei, China; permit number 2023156). All ewes had free access to fresh water and were fed twice daily (07:00 and 15:00 h) throughout the experiment. All ewes were housed in individual pens. Ewes were fed a basal diet, as shown in Supplementary Table S1.
2.2. Experimental Design
2.2.1. Sheep Estrus Synchronization Treatment of Ewes
Eighty healthy non-pregnant ewes (Hu sheep, 2–3 years, body weight = 52.98 ± 0.96 kg) were selected and randomly divided into a control group (C) and a treatment group (T). The estrus synchronization protocol consisted of the insertion of an implanted progesterone sponge plug on Day 0 (MAP, 45 mg/piece, SYNCRITE-45 Vaginal Sponge, Australia), the removal of the device at 16:00 on Day 11, and an injection of 330 IU equine chorionic gonadotrophin (eCG; Sansheng Pharmaceutical Ltd., Ningbo, China) on Day 11. Ewes were checked for estrus (acceptance of male) with a vasectomized buck every four hours during presumed estrous periods and twice daily during other periods. After estrus synchronization, thirty-one ewes with overt signs of estrus were selected randomly from each group. The experiment lasted 38 days.
2.2.2. Experimental Design
A schematic representation of the main activities performed during the whole experimental period is depicted in Figure 1. We began feeding the ewes in the T group with PRL inhibitor (bromocriptine (BCR), 2.5 mg/d, dissolved in water and evenly sprayed in the feed) at 0 d. The estrus was checked again 14 days after being induced, and ewes were on spontaneous estrus. Ewes in proestrus were determined according to records of estrus cycles: the proestrus stage is 1 day before the estrus, the estrus stage is 1 day after the proestrus, the metestrus stage is 2 days after estrus, and the diestrus stage is 7 days before the estrus. The first and second estrus times were accurately recorded, and the number of estrus cycle days was counted by subtracting the first estrus date. In the proestrus (I), estrus (II), metestrus (III), and diestrus (IV) stages, six ewes per stage were randomly selected for blood and ovarian tissue collection form both the C (n = 6) and T (n = 6) groups. The number of follicles with a diameter of ≥ 1 mm was observed and recorded. Those sheep whose ovaries were collected were no longer involved in the experiment, while we continued to feed the rest BCR.
Figure 1.
Schematic of the experimental design and collection protocol: a total of eighty sheep were randomly assigned to either the control (C) or treatment group (T). Blood and ovarian tissues were collected during the proestrus (I), estrus (II), metestrus (III), and diestrus (IV) stages of spontaneous estrus for both groups.
2.3. Blood and Ovary Collection and of Follicle Count Statistics
Before the morning feeding, blood samples from six randomly selected sheep in the C and T groups were collected via jugular venipuncture into 5 mL coagulation-promoting tubes during the proestrus (I), estrus (II), metestrus (III), and diestrus (IV) stages. The samples were immediately centrifuged at 3000× g for 15 min to harvest serum and stored at −20 °C until analysis. Ovarian tissue was surgically collected, and the numbers of follicles and corpus luteum were recorded, for which 1–2 mm was considered small follicles, 2–4 mm medium follicles, and >4 mm large follicles [31,32,33]. All surgeries were performed under sodium pentobarbital anesthesia with efforts made to minimize animal suffering.
After rinsing the ovarian tissue with RNase-free phosphate-buffered saline (PBS), it was cut into 1 cm3 pieces in a sterile environment before immediately being frozen in liquid nitrogen and stored in a refrigerator at −80 °C for subsequent RNA extraction.
2.4. Reproductive Hormone Assays
Following the manufacturer’s instructions, commercial sheep enzyme-linked immunosorbent assay (ELISA) kits from Nanjing Jiancheng Bio, Nanjing, China, were used to determine the serum concentrations of PRL (H095-1-2, sensitivity > 0.1 ng/mL), FSH (H101-1-2, sensitivity > 0.1 mIU/mL), E2 (H102-1-2, sensitivity > 0.1 ng/L), LH (H206-1-2, sensitivity > 0.1 mIU/mL), progesterone (P4, H089-1-1, sensitivity > 0.1 ng/mL), and gonadotropin-releasing hormone (GnRH, H297, sensitivity > 0.1 ng/L). The absorbance (OD) of each well was measured at 450 nm and a standard curve was generated. According to the standard curve, the serum hormone concentration of the test sheep was calculated. The intraassay CV was 10%.
2.5. Determination of Relative Gene Expression
Total RNA was extracted using the RNAprep Pure Tissue Kit (TIANGEN, DP431, Beijing, China) and stored at −80 °C. cDNA was synthesized using the HiFiScript gDNA Removal RT MasterMix from Cowin Biotech Co., Ltd. (CWBIO, Jiangsu, China). The protocol was followed according to the manufacturer’s instructions.
The primers (Table 1) were created using Primer Premier 5.0 software and synthesized using BGI·Write (Beijing, China). The TransStart® Tip Green qPCR SuperMix (+Dye I) from TransGen Biotech, Beijing, China was used for qRT-PCR on an ABI QuantStudio 7 Flex System (Foster City, CA, USA). Each sample was tested in triplicate using quantitative real-time PCR with GAPDH as an endogenous reference gene. Relative expression levels were calculated using the 2−ΔΔCt method.
Table 1.
List of primers used in qRT-PCR.
| Gene | Sequence (5′-3′) | Size (bp) | Tm (°C) | Accession Number |
|---|---|---|---|---|
| L-PRLR | F: CCCCTTGTTCTCTGCTAAACCC R: CTATCCGTCACCCGAGACACC |
129 | 60 | O46561-1 |
| S-PRLR | F:ACAGTAAGCGCCATCAACCA R: CTGGCTTGCATCGAATCTGC |
328 | 60 | O46561-2 |
| FSHR | F: GTGACACCAAGATAGCCAAGCG R: GGGTAGAACAGGACCAGGAGGA |
151 | 60 | NM_001009289.1 |
| LHR | F: ATCCAGAGCTGATGGCTACC | 115 | 60 | NM_001278566.2 |
| R: GCAGCTGAGATGGCAAAGAA | ||||
| PR | F: CAACAGCAAACCTGATACCT R: CCATCCTAGTCCAAATACCATT |
183 | 60 | XM_015100878.2 |
| ER | F: CGGCTACGCAAGTGCTATGAA | 385 | 60 | XM_027972563.1 |
| R: CCACAAATCCTGGCACCCT | ||||
| StAR | F: ATTCAGGAGGCAAAGAGCAGC | 270 | 60 | XM_015094520.2 |
| R: TCGGGTAAGGAAAATGGGTCA | ||||
| 3β-HSD | F: CAGTCTATGTTGGCAATGTGGC | 283 | 60 | NM_001135932.1 |
| R: CGGTTGAAGCAGGGGTGGTAT | ||||
| CYP11A1 | F: GTTTCGCTTTGCCTTTGAGTC | 120 | 60 | NM_001093789.1 |
| R: ACAGTTCTGGAGGGAGGTTGA | ||||
| CYP19A1 | F: GCTTTTGGAAGTGCTGAACCC | 379 | 60 | NM_001123000.1 |
| R: CATGCCGATGAACTGCAACC | ||||
| Caspase-3 | F: AATGCAAGAAGCAGGGCACCCA | 275 | 60 | XM_015104559.3 |
| R:GGGTTACAGCGATGCAGAAGGTTCA | ||||
| Bcl-2 | F:CGCTGAAGCGAAGCTGTAGA | 176 | 60 | XM_027960877.2 |
| R: CGTTGAGCCTGAAAGCTGTTT | ||||
| Bax | F: TGCCAGCAAACTGGTGCTCAA | 183 | 60 | XM_027978592.1 |
| R: GCACTCCAGCCACAAAGATGGT | ||||
| GAPDH | F: CTGACCTGCCGCCTGGAGAAA | 149 | 60 | NM001190390.1 |
| R: GTAGAAGAGTGAGTGTCGCTGTT |
2.6. Statistical Analysis
The length of the estrus cycle, hormone levels, and relative expressions were compared among multiple groups using the one-way ANOVA procedure in SPSS software (ver. 22.0, IBM Corp., Armonk, NY, USA), followed by Duncan’s post hoc test. The results were expressed as mean ± standard error of the mean (SEM), and statistical significance was defined as p < 0.05. Visualization mapping was performed using GraphPad Prism 9.0 software.
3. Results
3.1. Effects of BCR on Serum Reproductive Hormone in Ewes at Different Stages of the Estrus Cycle
The effects of BCR on the length of the estrus cycle in ewes are shown in Figure 2A; there was no significant difference between the C and T groups (p > 0.05). The effects of BCR on reproductive hormones at each stage of the ewes’ estrus cycle are shown in Figure 2B–G. In the proestrus, estrus, metestrus, and diestrus stages of the estrus cycle, BCR significantly decreased the serum concentrations of PRL (p < 0.05). In the proestrus stage, the serum concentrations of E2, FSH, and GnRH in the T group were significantly increased (p < 0.05) and no significant differences occurred in P4 and LH (p > 0.05). In the estrus stage, the serum concentrations of E2 and GnRH in T the group were significantly increased (p < 0.05), and no significant differences occurred in the contents of P4, LH, and FSH (p > 0.05). In the metestrus stage, there was no significant difference in other reproductive hormones, except PRL, between the two groups (p > 0.05). In the diestrus stage, the serum concentration of P4 in the T group was significantly increased (p < 0.05), while no significant difference occurred in E2, LH, FSH, and GnRH (p > 0.05).
Figure 2.
Effects of BCR on estrus cycle days and serum concentrations in ewes: (A) estrus cycle, (B) PRL, (C) E2, (D) P4, (E) LH, (F) FSH, (G) GnRH. ns: p > 0.05. * p < 0.05.
3.2. Effects of BCR on the Number of Follicles and Corpus Luteum in Ewes at Each Stage of the Estrus Cycle
The changes in the number of large, medium, and small follicles and the number of CLs in the ewes’ estrus cycle are shown in Figure 3. In the proestrus stage, the number of large and small follicles in the T group was increased (p < 0.05), while the number of middle follicles was decreased (p < 0.05). In the estrus stage, the number of large follicles was increased (p < 0.05), the number of middle follicles was decreased (p < 0.05), and the number of small follicles in the T group was not significantly different (p > 0.05). In the metestrus stage, the number of small follicles was increased (p < 0.05), the number of middle follicles was decreased (p < 0.05), and the number of large follicles in the T group was not significantly different (p > 0.05). In the diestrus stage, the number of large follicles, middle follicles, and CLs was increased (p < 0.05), while the number of small follicles was decreased (p < 0.05).
Figure 3.
Effects of BCR on follicle numbers at different stages of the estrus cycle in ewes. (A) Number of follicles in proestrus, (B) number of follicles in estrus, (C) number of follicles in metestrus, (D) number of follicles in diestrus. Large: large follicle count; medium: middle follicle count; small: small follicle count; CL: corpus luteum. * p < 0.05. Six replicates per group.
3.3. Effects of BCR on mRNA Expression of Genes at Each Stage of the Estrus Cycle in Ewes
The mRNA expression of the hormone-receptor genes during the ewes’ estrus cycle is shown in Figure 4. The expressions of L-PRLR and S-PRLR were significantly different during the estrus cycle (p < 0.05). After PRL inhibition, the expression level of L-PRLR increased in the proestrus and decreased in the estrus, metestrus, and diestrus stages (p < 0.05). The expression of S-PRLR decreased in the metestrus and increased in the proestrus, estrus, and diestrus stages (p < 0.05). In the proestrus stage, the expressions of FSHR and ER in T group were increased (p < 0.05) and PR was decreased (p < 0.05). In the estrus stage, the expression of ER was increased (p < 0.05) and the expressions of FSHR, LHR, and PR were decreased (p < 0.05). In the metestrus stage, the expressions of FSHR, ER, and LHR in the T group were increased (p < 0.05), and there was no significant difference in the expression of PR (p > 0.05). In the diestrus, the expressions of LHR and PR in the T group were increased (p < 0.05), while the expression of FSHR was decreased (p < 0.05) and no significant difference occurred in the expression of ER (p > 0.05).
Figure 4.
Effect of BCR on the mRNA expression of reproductive hormone-receptor (A–F) genes at different stages of the estrus cycle in ewes. (A) L-PRLR; (B) S-PRLR; (C) FSHR; (D) ER; (E) LHR; (F) PR. * p < 0.05.
The expressions of steroidogenic enzymes are shown in Figure 5. In the proestrus stage, the expression of CYP19A1 in the T group was increased (p < 0.05), while the expression of CYP11A1 was decreased (p < 0.05). In the estrus stage, the expressions of StAR and CYP19A1 were increased. In the metestrus stage, the expressions of StAR and CYP11A1 in the T group were increased (p < 0.05), and the expressions of 3β-HSD and CYP19A1 were decreased. In the diestrus stage, the expressions of 3β-HSD and StAR were increased (p < 0.05), while the expressions of CYP19A1 and CYP11A1 were not significantly different (p > 0.05).
Figure 5.
Effect of BCR on the mRNA expression of steroid-receptor (A–D) genes at different stages of the estrus cycle in ewes. (A) 3β-HSD; (B) StAR; (C) CYP19A1; (D) CYP11A1. * p < 0.05.
The expressions of apoptosis-related genes are shown in Figure 6. In the proestrus stage, the expression of Caspase-3 was increased (p < 0.05) while that of Bcl-2 was decreased (p < 0.05) in the T group. In the estrus stage, the expression of Bcl-2 was increased (p < 0.05), while there was no significant difference in the expressions of Caspase-3 and Bax (p > 0.05). In the metestrus stage, the expression of Bax was increased in the T group (p < 0.05), but there was no significant difference in Bcl-2 and Caspase-3 (p > 0.05). In the diestrus stage, the expressions of Caspase-3 and Bax in the T group were increased (p < 0.05), while the expression of Bcl-2 was decreased (p < 0.05).
Figure 6.
Effect of BCR on the mRNA expression of apoptosis-related (A–C) genes at different stages of the estrus cycle in ewes. (A) Bcl-2; (B) Bax; (C) Caspase-3. * p < 0.05.
4. Discussion
4.1. Effect of PRL on Follicle Count and CL Number
In dairy cows, suckling elevated levels of PRL lead to anestrus in dairy cows [34]. PRL levels are correlated with the duration of postpartum amenorrhea [35]; in rats, these levels have been shown to decline postpartum after separation from the pup [36]. During the estrus cycle, the number of follicles varied dynamically with the follicle wave [37]. The number and size of follicles were somewhat indicative of ovarian activity [38]. High levels of PRL significantly inhibited the diameter and number of follicles in rats [39]; these results align with those in our study, that the inhibition of PRL significantly increased the number of large follicles in the proestrus, estrus, and metestrus stages. In addition, this study showed that PRL inhibition increased the proportion of follicles developing into large follicles. This is consistent with the results of Picazo’s study examining the 2–3 mm medium follicle count (p < 0.01) in the ovaries of Spanish merino ewes, as detected in the follicular phase after BCR injection [26]. We also found that the number of follicles increased in the diestrus stage after BCR feeding; this was associated with high levels of FSH in the proestrus, producing more follicles [40]. The CL is a temporary endocrine gland formed during ovulation [41]. The addition of PRL inhibited hCG-induced ovulation in a dose-related fashion [42]. We found that PRL inhibition significantly increased the number of CLs in the diestrus stage, which is consistent with similar histopathological results from rat ovaries [43]. Thus, this suggests that PRL inhibition can promote follicle development and ovulation during the estrus cycle.
4.2. Effect of PRL on the Secretion of Related Reproductive Hormones
Endocrine pathways play an essential role in the menstrual cycle [44], throughout which hormone levels fluctuate [45], regulating estrus production [46] and ovulation [47]. Our study showed that PRL inhibition significantly increased the concentrations of GnRH, FSH, and E2 as well as the number of small follicles in the proestrus stage and increased the concentrations of GnRH and E2 in the estrus stage. A high PRL concentration suppresses the hypothalamic gonadotropin-releasing hormone, which plays a pivotal role in reproduction by stimulating the synthesis and secretion of LH and FSH [47]. Upon FSH stimulation, a cohort of small antral follicles begins the gonadotropin-dependent development phase of recruited follicles [48]. With the growth of recruited follicles, more and more E2 is produced and FSH release is suppressed [1]. A higher level of PRL was also shown to significantly reduce E2 production in granule cells (GCs) [49]. Our study found that the P4 concentration was significantly increased after PRL inhibition in the diestrus stage, mediating the further regulation of estrus follicle development. P4 is mainly produced by the CL [50] and its concentration 44 could be due to an increased number of CLs [51]. The inhibition of PRL increased the P4 concentration in heifer [52], which is consistent with our research; PRL has also been significantly negatively correlated with P4 levels during the luteal phase [53]. Therefore, PRL inhibition can regulate the production of recruiting follicles and ovulation by increasing GnRH and E2 in the proestrus and estrus stages and increasing P4 in the diestrus stage.
4.3. Effect of PRL on the Expression of Genes at Different Stages of the Estrus Cycle
PRL plays a crucial role in reproduction by binding with different PRLRs [54]. Ruminants have two types of PRLR, long PRLR (L-PRLR) and short PRLR (S-PRLR) [55], which serve different roles in the ovaries. Previous studies found that, while there is a marked increase in L-PRLR expression, the expression of S-PRLR remains constant during the estrus cycle in sheep [56]; this is in accordance with the fact that we examined sheep without BCR. During the cycle, we found that after PRL inhibition, the fluctuating expression of S-PRLR increased significantly in the proestrus, estrus, and diestrus stages. Thompson’s study suggests that S-PRLR is involved in the formation and maintenance of the CL [57], suggesting that the inhibition of PRL concentration may promote the formation and maintenance of the CL in the estrus cycle by regulating S-PRLR.
Our study showed that PRL inhibition could increase FSH sensitivity and further affect follicular development by increasing the levels of E2, FSH, ER, and FSHR in the proestrus stage. ER and PR are members of the nuclear receptor family [58], with transcription after combining with E2 [50], thus further regulating antral follicle development and oocyte maturation [59]. Physiologic levels of PRL amplify the stimulatory effects of FSH on the acquisition of FSHR production in cultured GCs, while higher concentrations of PRL cause a decrease in FSHR binding [60]. Only the follicles with the highest sensitivity to FSH, which are those follicles with the highest FSHR expression in GCs, can secure the dominance of the selected follicle [61]; conversely, follicles lead to GC apoptosis, and ultimately follicular atresia [62]. In the estrus stage, we found that PRL inhibition resulted in a significant increase in StAR and CYP19A1. StAR is an enzyme that controls the rate of cholesterol transport to the inner mitochondrial membrane [63], and the expression of the StAR, CYP11A1, and CYP19A1 genes increases with follicle development [64], suggesting that the inhibition of PRL in the estrus stage can significantly promote cholesterol transport and follicle development. In the metestrus stage, we found a significant increase in LHR levels, but no significant difference occurred in LH levels. BCR or PRL treatments alone did not affect the LH response [65]. LH acted on mural GCs, yielding high levels of LHR and initiating a series of events leading to cumulus cell expansion and follicle rupture [66]. With the increase in LHR gene expression, the sensitivity of follicles to LH increased, which drove follicular development in the second half of the follicular phase [48,67]. In the present study, the suppression of PRL promoted the expression of the pro-apoptotic gene Bax. Bax is more predominantly found in atresia follicles [68]. In the metestrus stage, ovulation leads to an increase in the expression of pro-apoptotic genes [69]. This further confirms our results, in that PRL inhibition in the metestrus stage may be due to increased LH sensitivity, which then promotes follicle rupture and ovulation.
CL regression is mediated by apoptosis [70], which initiates luteolysis by promoting extrinsic apoptosis and destructive autophagy [71], thereby decreasing P4 secretion [72]. The early increase in plasma P4 concentration during the luteal phase promotes the premature activation of the luteolytic process, thus affecting CL function in llamas [73]. We found that both P4 and PR in the diestrus stage increased significantly after PRL inhibition; the expression of 3β-HSD, StAR, Bax, and Caspase-3 was increased, and the expression of Bcl-2 was decreased, thus demonstrating that PRL inhibition could improve the diestrus steroidogenic ability and induce luteinization and apoptosis.
5. Conclusions
Form our findings, we can conclude that PRL had no significant effect on the length of the estrus cycle. PRL inhibition affected the serum concentrations of E2, FSH, and GnRH, as well as the expressions of PR, FSHR, LHR, 3β-HSD, StAR, CYP11A1, CYP19A1, Bax, Bcl-2, and Caspase-3 in different stages of the estrus cycle. These results provide a basis for understanding the mechanisms underlying estrus cycle regulation in ewes via PRL.
Acknowledgments
The authors thank Zhihao Livestock Science and Technology Corporation for providing us with the material we needed for this study.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14131873/s1, Table S1: Ingredients and nutrient composition of the basal diet (dry matter basis).
Author Contributions
Conceptualization, Y.L. (Yueqin Liu); investigation, R.Y. and M.C.; writing—original draft preparation, S.Y.; writing—review and editing, J.C. and X.L.; validation: C.D.; visualization: Y.L. (Yu Li) and Z.S.; funding acquisition: Y.L. (Yueqin Liu) and Y.Z.; project administration, Y.Z. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
The animal study was conducted under the guidance of the Animal Care and Use Committee of the Hebei Agricultural University (approval number:2023156).
Informed Consent Statement
Not applicable.
Data Availability Statement
Data are contained within the article.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This research was supported by the National Modern Agricultural Industry Technology System Construction Project of China [CARS-38].
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Talebi R., Ahmadi A., Afraz F., Sarry J., Plisson-Petit F., Genêt C., Fabre S. Transcriptome analysis of ovine granulosa cells reveals differences between small antral follicles collected during the follicular and luteal phases. Theriogenology. 2018;108:103–117. doi: 10.1016/j.theriogenology.2017.11.027. [DOI] [PubMed] [Google Scholar]
- 2.Chen X., Chen H.Y., Jiang S., Shen H., Zeng X.C. Identification of LncRNA Expression in the Estrous Cycle of Qira Black Sheep and Its Combination with miRNA Analysis. Kafkas Univ. Vet. Fak. Derg. 2021;27:733–740. doi: 10.9775/kvfd.2021.26203. [DOI] [Google Scholar]
- 3.Orisaka M., Miyazaki Y., Shirafuji A., Tamamura C., Tsuyoshi H., Tsang B.K., Yoshida Y. The role of pituitary gonadotropins and intraovarian regulators in follicle development: A mini-review. Reprod. Med. Biol. 2021;20:169–175. doi: 10.1002/rmb2.12371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Cao X.H., Wang X.Y., Lu L.L., Li X.Y., Di R., He X.Y., Hu W.P., Zeng X.Y., Liu Q.Y., Chu M.X. Expression and Functional Analysis of the BCL2-Associated Agonist of Cell Death (BAD) Gene in the Sheep Ovary During the Reproductive Cycle. Front. Endocrinol. 2018;9:512. doi: 10.3389/fendo.2018.00512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Richard S., Zhou Y.R., Jasoni C.L., Pankhurst M.W. Ovarian follicle size or growth rate can both be determinants of ovulatory follicle selection in mice. Biol. Reprod. 2023;110:130–139. doi: 10.1093/biolre/ioad134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Luo Y.R., Zhang R.Q., Gao J., Wang Y.L., Zhang W.M., Qing S.Z. The localization and expression of epidermal growth factor and epidermal growth factor receptor in bovine ovary during oestrous cycle. Reprod. Domest. Anim. 2020;55:822–832. doi: 10.1111/rda.13690. [DOI] [PubMed] [Google Scholar]
- 7.Rawan A.F., Langar H., Munetomo M., Yamamoto Y., Kawano K., Kimura K. Effects of insulin-like growth factor-1 on the mRNA expression of estradiol receptors, steroidogenic enzymes, and steroid production in bovine follicles. J. Reprod. Dev. 2023;69:337–346. doi: 10.1262/jrd.2023-047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Rosa P.M.D., Bridi A., Ferronato G.D., Prado C.M., Bastos N.M., Sangalli J.R., Meirelles F.V., Perecin F., da Silveira J.C. Corpus luteum presence in the bovine ovary increase intrafollicular progesterone concentration: Consequences in follicular cells gene expression and follicular fluid small extracellular vesicles miRNA contents. J. Ovarian Res. 2024;17:65. doi: 10.1186/s13048-024-01387-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Raut S., Khambata K., Goffin V., Balasinor N. Prolactin Regulates Testicular Gene Expression and Cell Cycle Processes Predominantly via JAK2/STAT5 Pathway in the Male Rat. Endocrinology. 2023;164:bqad072. doi: 10.1210/endocr/bqad072. [DOI] [PubMed] [Google Scholar]
- 10.Samuel B., Dadi H., Dejene G., Kang M.G., Park C., Dinka H. Single nucleotide polymorphisms within exon four of the prolactin gene and their effect on milk traits in cattle populations of Ethiopia. Anim. Biotechnol. 2023;34:4634–4644. doi: 10.1080/10495398.2023.2176867. [DOI] [PubMed] [Google Scholar]
- 11.Maleki O.L., Hashemi A., Zarringhabaie G.E., Farhadian M. Associations of polymorphisms in the prolactin receptor gene with growth trait in japanese quail (Coturnix coturnix japonica) Genetika. 2017;49:1105–1114. doi: 10.2298/GENSR1703105M. [DOI] [Google Scholar]
- 12.Toyoda F., Hasunuma I., Yamamoto K., Yamashita M., Kikuyama S. Prolactin acts centrally to enhance newt courtship behavior. Gen. Comp. Endocrinol. 2005;141:172–177. doi: 10.1016/j.ygcen.2004.12.015. [DOI] [PubMed] [Google Scholar]
- 13.Pirchio R., Graziadio C., Colao A., Pivonello R., Auriemma R.S. Metabolic effects of prolactin. Front. Endocrinol. 2022;13:1015520. doi: 10.3389/fendo.2022.1015520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Misztal T., Rornanowicz K., Tomaszewska-Zaremba D., Wójcik-Gladysz A., Barcikowski B. The effects of prolonged, intracerebroventricular prolactin treatment on luteinizing hormone secretion, catecholaminergic activity and estrous behavior in ewes. Exp. Clin. Endocrinol. Diabetes. 2004;112:215–221. doi: 10.1055/s-2004-817942. [DOI] [PubMed] [Google Scholar]
- 15.Schanbacher B. Relationship of daylength and prolactin to resumption of reproductive activity in anestrous ewes. J. Anim. Sci. 1980;50:293–297. doi: 10.2527/jas1980.502293x. [DOI] [PubMed] [Google Scholar]
- 16.Christian H.C., Imirtziadis L., Tortonese D. Ultrastructural changes in lactotrophs and folliculo-stellate cells in the ovine pituitary during the annual reproductive cycle. J. Neuroendocrinol. 2015;27:277–284. doi: 10.1111/jne.12261. [DOI] [PubMed] [Google Scholar]
- 17.Polatti F., Nava C., Brambilla A., Zara C. PRL action on E2 ovarian secretion. Clin. Exp. Obstet. Gynecol. 1982;9:160–164. [PubMed] [Google Scholar]
- 18.Taketa Y., Inoue K., Takahashi M., Sakamoto Y., Watanabe G., Taya K., Yoshida M. Effects of sulpiride and ethylene glycol monomethyl ether on endometrial carcinogenicity in Donryu rats. J. Appl. Toxicol. 2016;36:769–776. doi: 10.1002/jat.3206. [DOI] [PubMed] [Google Scholar]
- 19.Liu T., Jia C., Li Y. Treatment of sexual dysfunction induced by hyperprolactinemia accompanied by reduced luteinizing hormone levels: A case report. Clin. Case Rep. 2024;12:e8432. doi: 10.1002/ccr3.8432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nakamura E., Otsuka F., Inagaki K., Miyoshi T., Yamanaka R., Tsukamoto N., Suzuki J., Ogura T., Makino H. A Novel Antagonistic Effect of the Bone Morphogenetic Protein System on Prolactin Actions in Regulating Steroidogenesis by Granulosa Cells. Endocrinology. 2010;151:5506–5518. doi: 10.1210/en.2010-0265. [DOI] [PubMed] [Google Scholar]
- 21.Milenkovic L., D’Angelo G., Kelly P.A., Weiner R.I. Inhibition of gonadotropin hormone-releasing hormone release by prolactin from GT1 neuronal cell lines through prolactin receptors. Proc. Natl. Acad. Sci. USA. 1994;91:1244–1247. doi: 10.1073/pnas.91.4.1244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ohtaki T., Fujiwara H., Watanabe G., Ono M., Taya K., Tsumagari S. Changes in luteinizing hormone pulse frequency and prolactin levels in bitches in response to estrus induction by cabergoline-its cases where it is delayed to induce estrus. J. Vet. Med. Sci. 2020;82:1773–1780. doi: 10.1292/jvms.19-0397. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Blaszczyk B., Udala J., Gaczarzewicz D. Changes in estradiol, progesterone, melatonin, prolactin and thyroxine concentrations in blood plasma of goats following induced estrus in and outside the natural breeding season. Small Rumin. Res. 2004;51:209–219. doi: 10.1016/S0921-4488(03)00190-1. [DOI] [Google Scholar]
- 24.Deveson S.L. The Effects of Photoperiod and Melatonin on Seasonal Breeding in Goats. University of Surrey; Guildford, UK: 1990. [Google Scholar]
- 25.Chen M., Duan C., Yin X., Li X., Liu X., Zhang L., Yue S., Zhang Y., Liu Y. Prolactin inhibitor changes testosterone production, testicular morphology, and related genes expression in cashmere goats. Front. Vet. Sci. 2023;10:1249189. doi: 10.3389/fvets.2023.1249189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Picazo R.A., de Bulnes A.G., Brunet A.G., del Campo A., Granados B., Tresguerres J., Sebastián A.L. Effects of bromocriptine administration during the follicular phase of the oestrous cycle on prolactin and gonadotrophin secretion and follicular dynamics in Merino monovular ewes. J. Reprod. Fertil. 2000;120:177–186. doi: 10.1530/reprod/120.1.177. [DOI] [PubMed] [Google Scholar]
- 27.Zhang L., Duan C., Guo Y., Zhang Y., Liu Y. Inhibition of prolactin promotes secondary skin follicle activation in cashmere goats. J. Anim. Sci. 2021;99:skab079. doi: 10.1093/jas/skab079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Molik E., Blasiak M. The role of melatonin and bromocriptine in the regulation of prolactin secretion in animals—A review. Ann. Anim. Sci. 2015;15:849–860. doi: 10.1515/aoas-2015-0042. [DOI] [Google Scholar]
- 29.Fukuhara N., Nishiyama M., Iwasaki Y. Update in Pathogenesis, Diagnosis, and Therapy of Prolactinoma. Cancers. 2022;14:3604. doi: 10.3390/cancers14153604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Koniares K., Benadiva C., Engmann L., Nulsen J., Grow D. Macroprolactinemia: A mini-review and update on clinical practice. F&S Rep. 2023;4:245–250. doi: 10.1016/j.xfre.2023.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Año-Perello A., Santos-Jimenez Z., Encinas T., Martinez-Ros P., Gonzalez-Bulnes A. Use of GnRH for Synchronization of the Follicular Wave in Assisted Reproductive Technologies in Sheep: A Preliminary Study. Animals. 2020;10:1208. doi: 10.3390/ani10071208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Duan H., Ge W., Yang S., Lv J., Ding Z., Hu J., Zhang Y., Zhao X., Hua Y., Xiao L. Dihydrotestosterone regulates oestrogen secretion, oestrogen receptor expression, and apoptosis in granulosa cells during antral follicle development. J. Steroid Biochem. Mol. Biol. 2021;207:105819. doi: 10.1016/j.jsbmb.2021.105819. [DOI] [PubMed] [Google Scholar]
- 33.Palermo R. Differential actions of FSH and LH during folliculogenesis. Reprod. Biomed. Online. 2007;15:326–337. doi: 10.1016/S1472-6483(10)60347-1. [DOI] [PubMed] [Google Scholar]
- 34.Short R.E., Bellows R.A., Staigmiller R.B., Berardinelli J.G., Custer E.E. Physiological mechanisms controlling anestrus and infertility in postpartum beef cattle. J. Anim. Sci. 1990;68:799–816. doi: 10.2527/1990.683799x. [DOI] [PubMed] [Google Scholar]
- 35.Valdes P., Sierralta P., Barria A., Figueroa G., Berg V., Aravena M., Ossa X., Cardenas H. Influence of basal and post-feeding prolactin levels on amenorrhea during breast feeding. Rev. Chil. Obstet. Ginecol. 1991;56:88–93. [PubMed] [Google Scholar]
- 36.Kalyani M., Callahan P., Janik J.M., Shi H.F. Effects of Pup Separation on Stress Response in Postpartum Female Rats. Int. J. Mol. Sci. 2017;18:1370. doi: 10.3390/ijms18071370. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Mohammadi G., Kohram H., Gooraninejad S., Yousefi A., Motaghedi A. Ovarian follicular dynamics during the interovulatory interval in Najdi goats. Afr. J. Biotechnol. 2010;9:5236–5239. [Google Scholar]
- 38.Kebede H., Lemma A., Negussie H. Ultrasonographic studies on ovarian dynamics and associated estrus manifestations of jennies under controlled management, Ethiopia. Trop. Anim. Health Prod. 2012;44:1965–1970. doi: 10.1007/s11250-012-0165-6. [DOI] [PubMed] [Google Scholar]
- 39.Larsen J.L., Bhanu A., Odell W.D. Prolactin inhibition of pregnant mare’s serum stimulated follicle development in the rat ovary. Endocr. Res. 1990;16:449–459. doi: 10.1080/07435809009107117. [DOI] [PubMed] [Google Scholar]
- 40.Bosch E., Alamá P., Romero J.L., Marí M., Labarta E., Pellicer A. Serum progesterone is lower in ovarian stimulation with highly purified HMG compared to recombinant FSH owing to a different regulation of follicular steroidogenesis: A randomized controlled trial. Hum. Reprod. 2024;39:393–402. doi: 10.1093/humrep/dead251. [DOI] [PubMed] [Google Scholar]
- 41.Bowolaksono A., Fauzi M., Sundari A.M., Pustimbara A., Lestari R., Abinawanto, Dwiranti A., Fadhillah The effects of luteinizing hormone as a suppression factor for apoptosis in bovine luteal cells in vitro. Reprod. Domest. Anim. 2021;56:744–753. doi: 10.1111/rda.13913. [DOI] [PubMed] [Google Scholar]
- 42.Yoshimura Y., Tada S., Oda T., Nakamura Y., Maruyama K., Ichikawa F., Ebihara T., Hirota Y., Sawada T., Kawakami S. Direct inhibitory ovarian effects of prolactin in the process of ovulation. Nihon Sanka Fujinka Gakkai Zasshi. 1989;41:83–89. [PubMed] [Google Scholar]
- 43.Kumazawa T., Nakajima A., Ishiguro T., Jiuxin Z., Tanaharu T., Nishitani H., Inoue Y., Harada S., Hayasaka I., Tagawa Y. Collaborative work on evaluation of ovarian toxicity 15) Two- or four-week repeated-dose studies and fertility study of bromocriptine in female rats. J. Toxicol. Sci. 2009;34:SP157–SP165. doi: 10.2131/jts.34.S157. [DOI] [PubMed] [Google Scholar]
- 44.Saei Ghare Naz M., Rostami Dovom M., Ramezani Tehrani F. The Menstrual Disturbances in Endocrine Disorders: A Narrative Review. Int. J. Endocrinol. Metab. 2020;18:e106694. doi: 10.5812/ijem.106694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Baldwin S.N., Jepps T.A., Greenwood I.A. Cycling matters: Sex hormone regulation of vascular potassium channels. Channels. 2023;17:2217637. doi: 10.1080/19336950.2023.2217637. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zhao H.Q., Huang Y.Z., Shu S., Wang G.W., Fu C.Q., Huang R., Zhang J., Su H.W., He Y., Lei C.Z., et al. Transcriptomics and metabolomics of blood, urine and ovarian follicular fluid of yak at induced estrus stage. BMC Genom. 2024;25:201. doi: 10.1186/s12864-024-10079-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Szukiewicz D. Current Insights in Prolactin Signaling and Ovulatory Function. Int. J. Mol. Sci. 2024;25:1976. doi: 10.3390/ijms25041976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Shimizu T. Molecular and cellular mechanisms for the regulation of ovarian follicular function in cows. J. Reprod. Dev. 2016;62:323–329. doi: 10.1262/jrd.2016-044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Takiguchi S., Nakamura Y., Yamagata Y., Takayama H., Harada A., Sugino N., Kato H. Role of transient hyperprolactinemia in the late follicular phase of the gonadotropin-stimulated cycle. Reprod. Med. Biol. 2002;1:69–74. doi: 10.1046/j.1445-5781.2002.00012.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Duan H.W., Xiao L.F., Hu J.J., Zhang Y., Zhao X.X., Ge W.B., Jiang Y.T., Song L.L., Yang S.S., Luo W.Z. Expression of oestrogen receptor, androgen receptor and progesterone nuclear receptor in sheep uterus during the oestrous cycle. Reprod. Domest. Anim. 2019;54:1305–1312. doi: 10.1111/rda.13489. [DOI] [PubMed] [Google Scholar]
- 51.Fernandez J., Bruno-Galarraga M.M., Cueto M.I., Bonadeo N., Notaro U., Soto A.T., de la Sota R.L., Salvetti N.R., Bianchi C.P., Cristina C., et al. Changes on corpus luteum structure and progesterone synthesis pathway after hCG or GnRH treatment during the early luteal phase in sheep. Anim. Reprod. Sci. 2024;265:107474. doi: 10.1016/j.anireprosci.2024.107474. [DOI] [PubMed] [Google Scholar]
- 52.Ginther O.J., Santos V.G., Mir R.A., Beg M.A. Role of LH in the progesterone increase during the bromocriptine-induced prolactin decrease in heifers. Theriogenology. 2012;78:1969–1976. doi: 10.1016/j.theriogenology.2012.08.003. [DOI] [PubMed] [Google Scholar]
- 53.Aisaka K., Yoshida K., Mori H. Analysis of clinical backgrounds and pathogenesis of luteal-phase defect. Horm. Res. 1992;37((Suppl. S1)):41–47. doi: 10.1159/000182347. [DOI] [PubMed] [Google Scholar]
- 54.Liu Y.F., Wang P., Zhou Z.Y., He X.Y., Tao L., Jiang Y.T., Lan R., Hong Q.H., Chu M.X. Expression Profile Analysis to Identify Circular RNA Expression Signatures in the Prolificacy Trait of Yunshang Black Goat Pituitary in the Estrus Cycle. Front. Genet. 2022;12:801357. doi: 10.3389/fgene.2021.801357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Yang R., Duan C., Zhang S., Liu Y., Zhang Y. Prolactin Regulates Ovine Ovarian Granulosa Cell Apoptosis by Affecting the Expression of MAPK12 Gene. Int. J. Mol. Sci. 2023;24:10269. doi: 10.3390/ijms241210269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Picazo R.A., Ruiz J.P.G., Moreno J.S., de Bulnes A.G., Muñoz J., Silván G., Lorenzo P.L., Illera J.C. Cellular localization and changes in expression of prolactin receptor isoforms in sheep ovary throughout the estrous cycle. Reproduction. 2004;128:545–553. doi: 10.1530/rep.1.00343. [DOI] [PubMed] [Google Scholar]
- 57.Thompson I.M., Ozawa M., Bubolz J.W., Yang Q., Dahl G.E. Bovine luteal prolactin receptor expression: Potential involvement in regulation of progesterone during the estrous cycle and pregnancy. J. Anim. Sci. 2011;89:1338–1346. doi: 10.2527/jas.2010-3559. [DOI] [PubMed] [Google Scholar]
- 58.Patel B., Elguero S., Thakore S., Dahoud W., Bedaiwy M., Mesiano S. Role of nuclear progesterone receptor isoforms in uterine pathophysiology. Hum. Reprod. Update. 2015;21:155–173. doi: 10.1093/humupd/dmu056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Yang B.X., An Y., Yang Y.Y., Zhao Y.F., Yu K., Weng Y., Du C.G., Li H.J., Yu B.Y. The ERβ-cAMP signaling pathway regulates estradiol-induced ovine oocyte meiotic arrest. Theriogenology. 2024;214:81–88. doi: 10.1016/j.theriogenology.2023.10.009. [DOI] [PubMed] [Google Scholar]
- 60.Porter M.B., Brumsted J.R., Sites C.K. Effect of prolactin on follicle-stimulating hormone receptor binding and progesterone production in cultured porcine granulosa cells. Fertil. Steril. 2000;73:99–105. doi: 10.1016/S0015-0282(99)00463-X. [DOI] [PubMed] [Google Scholar]
- 61.Andersen C.Y. Inhibin-B secretion and FSH isoform distribution may play an integral part of follicular selection in the natural menstrual cycle. Mol. Hum. Reprod. 2017;23:16–24. doi: 10.1093/molehr/gaw070. [DOI] [PubMed] [Google Scholar]
- 62.Jolly P.D., Tisdall D.J., Heath D.A., Lun S., McNatty K.P. Apoptosis in bovine granulosa cells in relation to steroid synthesis, cyclic adenosine 3’,5’-monophosphate response to follicle-stimulating hormone and luteinizing hormone, and follicular atresia. Biol. Reprod. 1994;51:934–944. doi: 10.1095/biolreprod51.5.934. [DOI] [PubMed] [Google Scholar]
- 63.Miller W.L., Auchus R.J. The Molecular Biology, Biochemistry, and Physiology of Human Steroidogenesis and Its Disorders. Endocr. Rev. 2011;32:81–151. doi: 10.1210/er.2010-0013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Guo Y.X., Duan C.H., Hao Q.H., Liu Y.Q., Li T., Zhang Y.J. Effect of short-term nutritional supplementation on hormone concentrations in ovarian follicular fluid and steroid regulating gene mRNA abundances in granulosa cells of ewes. Anim. Reprod. Sci. 2019;211:106208. doi: 10.1016/j.anireprosci.2019.106208. [DOI] [PubMed] [Google Scholar]
- 65.Gregory S.J., Townsend J., McNeilly A.S., Tortonese D.J. Effects of prolactin on the luteinizing hormone response to gonadotropin-releasing hormone in primary pituitary cell cultures during the ovine annual reproductive cycle. Biol. Reprod. 2004;70:1299–1305. doi: 10.1095/biolreprod.103.022806. [DOI] [PubMed] [Google Scholar]
- 66.ul Ain N., Khan R.A., Mirza T., Fayyaz T.B. The Effects of Ficus caricaon Male and Female Reproductive Capabilities in Rats. Evid.-Based Complement. Altern. Med. 2022;2022:1799431. doi: 10.1155/2022/1799431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Jeppesen J.V., Kristensen S.G., Nielsen M.E., Humaidan P., Dal Canto M., Fadini R., Schmidt K.T., Ernst E., Andersen C.Y. LH-Receptor Gene Expression in Human Granulosa and Cumulus Cells from Antral and Preovulatory Follicles. J. Clin. Endocrinol. Metab. 2012;97:E1524–E1531. doi: 10.1210/jc.2012-1427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Slot K.A., Voorendt M., de Boer-Brouwer M., van Vugt H.H., Teerds K.J. Estrous cycle dependent changes in expression and distribution of Fas, Fas ligand, Bcl-2, Bax, and pro- and active caspase-3 in the rat ovary. J. Endocrinol. 2006;188:179–192. doi: 10.1677/joe.1.06165. [DOI] [PubMed] [Google Scholar]
- 69.Kaur S., Kurokawa M. Regulation of Oocyte Apoptosis: A View from Gene Knockout Mice. Int. J. Mol. Sci. 2023;24:1345. doi: 10.3390/ijms24021345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Vaskivuo T.E., Ottander U., Oduwole O., Isomaa V., Vihko P., Olofsson J.I., Tapanainen J.S. Role of apoptosis, apoptosis-related factors and 17β-hydroxysteroid dehydrogenases in human corpus luteum regression. Mol. Cell. Endocrinol. 2002;194:191–200. doi: 10.1016/S0303-7207(02)00087-4. [DOI] [PubMed] [Google Scholar]
- 71.Chesnokov M.S., Mamedova A.R., Zhivotovsky B., Kopeina G.S. A matter of new life and cell death: Programmed cell death in the mammalian ovary. J. Biomed. Sci. 2024;31:31. doi: 10.1186/s12929-024-01017-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Li H.L., Pei X.M., Yu H., Wang W., Mao D.G. Autophagic and apoptotic proteins in goat corpus luteum and the effect of Adiponectin/AdipoRon on luteal cell autophagy and apoptosis. Theriogenology. 2024;214:245–256. doi: 10.1016/j.theriogenology.2023.11.001. [DOI] [PubMed] [Google Scholar]
- 73.Rossetto L., Gallelli M.F., Aba M.A., Miragaya M.H., Bianchi C.P. Effect of early administration of progesterone on the function of the corpus luteum of llamas. Anim. Reprod. Sci. 2023;252:107233. doi: 10.1016/j.anireprosci.2023.107233. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data are contained within the article.






