Abstract
microRNAs (miRs) have been reported over the decades as important regulators in bone development and bone regeneration. They play important roles in maintaining the stem cell signature as well as regulating stem cell fate decisions. Thus, delivering miRs and miR inhibitors to the defect site is a potential treatment towards craniofacial bone defects. However, there are challenges in translation of basic research to clinics, including the efficiency, specificity, and efficacy of miR manipulation methods and the safety of miR delivery systems. In this review, we will compare miR oligonucleotides, mimics and antagomirs as therapeutic reagents to treat disease and regenerate tissues. Newer technology will be discussed as well as the efficiency and efficacy of using these technologies to express or inhibit miRs in treating and repairing oral tissues. Delivery of these molecules using extracellular vesicles and nanoparticles can achieve different results and depending on their composition will elicit specific effects. We will highlight the specificity, toxicity, stability, and effectiveness of several miR systems in regenerative medicine.
Introduction
Currently, there is a growing demand for effective remedies to deal with craniofacial bone defects that occur due to aging, traumatic injuries, disease, and birth abnormalities. To this day, autografts remain the gold standard for treating bone defects, but are met with shortcomings that include severe supply limitations and donor site morbidity [1]. Alternatively, allografts and xenografts can be used as substitutes, but are ultimately rejected by the host immune system [2]. Tissue engineering, however, can circumvent these complications by its potential to harness the repair mechanisms of the host organism for bone regeneration. Previous studies have documented successful reprogramming of multipotent progenitor cells into tissue specific lineages by the administration of bioactive molecules [3,4]. In tissue engineering, specific biomaterials and cell types are deliberately selected in order to recapitulate tissue and extracellular matrices that were lost or damaged due to trauma [5]. The interaction between cells and biomaterials is a critical factor for facilitating appropriate cell–cell communication in recapitulating tissue specific niches.
Traditionally, tissue engineering has relied on the presence of proteins such as bone morphogenic proteins, fibroblast growth factors, human recombinant bone morphogenic proteins, or parathyroid hormone to facilitate osteogenesis in synthetic bone grafts [6–14]. However, these drugs are noted to have several complications. They are generally unstable, expensive, require large amounts of administration, and have numerous side effects, including tumorigenesis, inappropriate formation of adipose tissue, ectopic bone formation, and inflammatory responses [15–21]. Thus, these proteins generally have specific targets and as such, are limited in efficiency. On the other hand, microRNAs (miRs) have demonstrated an ability to efficiently regulate multiple cell signaling pathways through downstream cascading effects [22,23]. Previous studies have revealed that miR’s can stimulate cellular proliferation, differentiation, and growth without the addition of specific proteins [24,25].
miRs are small, non-coding regulatory RNAs that bind to their specific binding sites in the 3′UTR of mRNAs and thus inhibit the expression of their target genes [26]. They have been reported to control several developmental processes, as well as diseases and regeneration processes [27].
At present, miRs have also been largely related to maintaining the stem cell signature, as well as the stem cell fate decision towards different lineages, which makes them a potential tool to correct craniofacial bone defects. As the research knowledge about the roles of miRs in craniofacial development are defined, it is possible to treat congenital craniofacial defects and injuries in facial and skull structures with new therapeutic approaches. The translation of basic knowledge to clinics requires precise miR over expression and/or inhibition methods, as well as a safe and efficient delivery system. The current challenge for over expressing or inhibiting miRs in vivo is the design of miR over expression constructs or mimics and miR inhibitors or antagomirs. Furthermore, dosage control which largely affect the efficacy and specificity of the miRs to regulate downstream targets. The delivery method as well as the scaffold are also important.
In this review, we will discuss the current knowledge of the role of miRs in maintaining stem cell signatures and regulating stem cell fate decisions. We will compare the efficiency and efficacy of current and newer miR technologies as therapeutic methods to treat disease and regenerate tissues. We will also highlight the specificity, toxicity, stability, the effectiveness of several new systems to deliver these molecules into the specific tissue. This review will also cover eight different biomaterials that have been used in conjunction with miR gene therapy approaches for promoting osteoblastic differentiation and bone regeneration.
Regulation of stem cell self-renewal and differentiation by microRNAs
Mesenchymal stem cells (MSCs) are recognized as self-renewed and multipotent with the capability to differentiate into osteoblasts, chondroblasts, adipocytes and endothelium-producing cells [28]. These cell types are required for tissue regeneration especially when treating craniofacial defects. Over the years, specific miRs have been identified that not only maintain the MSC feature, but also regulate their differentiation into desired lineages [29,30]. Other than the intrinsic regulation, MSCs have the ability to produce extracellular vesicles (EVs) including exosomes, in order to effect other cells through their paracrine activity [31–33]. A selected pattern of miRs can be shuttled in EVs produced by MSCs and delivered to other cells [34]. Thus, delivery of miRs that stimulate osteogenic lineages into the defect site with therapeutic approaches can promote osteogenic differentiation of endogenous MSCs and thus induce bone regeneration.
mirs maintain the MSC signature
It has been reported that MSC’s have their own miR expression signatures. Although different miR expression patterns are detected between intracellular and the EV environment of human embryonic stem cell derived mesenchymal stem cells (hES-MSCs), a high level of the let-7 family of miRs is predominant in both contexts. Intracellular miRs in hES-MSCs also include miR-199a-3p, miR-29a, miR-21, miR-152, miR-143, miR-221, miR-103, miR-100, miR-24 and miR-125b [35]. In addition, adult MSCs derived from different tissues share a core signature in their transcriptomes but also exhibit secondary signature expression profiles between different origins [34,36,37]. This indicates that MSCs have a characteristic gene and miR expression profile that help maintain the MSC signature.
mirs regulate osteogenic differentiation of MSCs
miRs are recognized to regulate differentiation of MSCs. The regulation of osteogenic differentiation by miRs in MSCs have been widely studied over the decades. Most of these studies are done in vitro with either primary MSCs of different origins, or potential differentiated stable cell lines. It has been reported that specific miRs target to osteogenic genes including BMP2, DKK1 and SMAD genes, as well as signaling pathways involved in the osteogenic process (Table 1). Several miRs/miR clusters have roles in regulating bone formation in vivo. miR-140, miR-17-92, miR-452, miR-199/214, miR-26b, miR-135a and miR-200c have been reported to positively regulate osteogenesis in vivo, while miR-200a, miR-29cb2 and miR-378 are negative regulators [38–48]. While the whole miR-23a-27a-24-2 cluster is negatively regulating bone formation in vivo, miR-23 and miR-27 individually promote osteogenesis [49,50].
Table 1.
miRs that regulate osteogenic differentiation of MSCs.
| miR | MSC types | Effect on osteogenic differentiation | Targeting gene/pathway | Reference |
|---|---|---|---|---|
| miR-23a | MC3T3-E1 | Suppression | Satb2/TGF-β signaling | [50,51] |
| HOS | GJA1 | [52] | ||
| miR-27a | MC3T3-E1 | Suppression | Satb2 | [51] |
| MC3T3-E1 | Prdm16/TGF-β signaling | [50] | ||
| miR-200a | hPDLSC | Suppression | ZEB2/NF-κB | [53] |
| hBMMSC | GLS | [54] | ||
| miR-200c | hBMMSC | Promotion | Klf4, Sox2/Wnt signaling | [55] |
| HEPM | IL-6, IL-8, CCl-5 | [56] | ||
| miR-889 | hBMMSC | Suppression | WNT7A/Wnt signaling | [57] |
| miR-4286 | hBMMSC | Promotion | HDAC3 | [58] |
| miR-503 | Rat MSC | Promotion | Smurf1 | [59] |
| miR-483-3p | hFOB1.19 | Promotion | DKK2/Wnt signaling | [60] |
| miR-424 | WJSC | Promotion | - | [61] |
| miR-10b | hADSC | Promotion | SMAD2/TGF-β signaling | [62] |
| miR-378 | hMSC | Suppression | WNT6, WNT10A/Wnt signaling | [48] |
| miR-375-3p | MC3T3-E1 | Suppression | LRP5, β-catenin/Wnt signaling | [63] |
| miR-100-5p | hBMMSC | Suppression | BMPR2/BMPR2-SMAD1/5/9 signaling | [64] |
| miR-29b | Primary fetal rat calvaria osteoblasts MC3T3-E1 | Suppression | COL1A1, COL5A3, COL4A2 | [65] |
| miR-29a | HUVEC | Promotion | - | [66] |
| miR-16-2 | hBMMSC | Suppression | WNT5A/Wnt signaling | [67] |
| miR-22 | hBMMSC | Suppression | YWHAZ | [68] |
microRNA delivery systems
Recent developments in the field of gene therapy have utilized a miR-based approach to treat a wide range of diseases. However, the application of gene therapy suffers from issues related to a lack of proper delivery methods to get genes and miRs into the cells. A practical and safe gene delivery system is a crucial factor required for the success of miR-based gene therapies. Currently, there are two approaches to express miRs: Oligonucleotide-based approaches and Plasmid DNA-based approaches.
Oligonucleotide-based approach
This approach uses chemically modified double-stranded RNA molecules that mimic the activities of select miRs. These miR mimics can be transfected and potentially interact with the RISC complex [69]. Like endogenous miRs, the miR mimics can function in a variety of ways, including translational repression, mRNA cleavage and deadenylation. The disadvantages of these mimics include cell toxicity, repeated applications of high concentrations of oligonucleotides, the transfection efficiency of mimic miRs is low and the formation of a functional new miR from the complementary strand has limited the use of this approach [70].
In cells, tissues, and cell lines most of the functional testing for miR activity (miR inhibition) has used chemically modified anti-miR oligonucleotides (AMOs) and locked-nucleic acids (LNAs) inhibitors that bind miRs transiently and inefficiently, do not remain in dividing cells and require repeated large doses of oligos in cells to be effective and they have severe off target effects. The sponges and decoys also suffer from a lack of stability, inefficient binding of the miR, lack of specificity and require toxic delivery systems. The biggest issue is the off-target effects of using large quantities of these miR oligo inhibitors in cells that cannot distinguish between a one nucleotide difference in miR families such as miR-23a and miR-27a. Therefore, many reports of genes and pathways affected in different types of cells by these miRs have not been rigorously validated. It is well-known that every miR targets multiple mRNAs, which can inhibit gene networks and have large biological consequences [71]. The current issues of using miR-23 mimics and LNA-23 miR inhibitors is highlighted in a current report stating that miR-23a and miR-23b target different transcripts, even though they have identical seed regions and only differ by one nucleotide outside of the seed region (Table 2) [72]. We suggest that these results are due to the nonspecific and off-target effects of the oligo-based mimics and inhibitors. Furthermore, they report using the LNA-23 miR inhibitor did not increase their target gene expression [72]. However, miR-24 has a completely different seed sequence and flanking sequences compared with miR-23 and miR-27 (Table 2). Therefore, the targets of miR-24 should have no overlap with the other miRs in this cluster.
Table 2.
Comparison of miR-23-27-24 sequences
| Sequences | ||
|---|---|---|
| miRs | Mus musculus (mmu) | Homo sapiens (hsa) |
| miR-23a-3p | AUCACAUUGCCAGGGAUUUCC | AUCACAUUGCCAGGGAUUUCC |
| miR-23b-3p | AUCACAUUGCCAGGGAUUACC | AUCACAUUGCCAGGGAUUACC |
| miR-24-1-3p | UGGCUCAGUUCAGCAGGAACAG | UGGCUCAGUUCAGCAGGAACAG |
| miR-24-2-3p | UGGCUCAGUUCAGCAGGAACAG | UGGCUCAGUUCAGCAGGAACAG |
| miR-27a-3p | UUCACAGUGGCUAAGUUCCGC | - |
| miR-27b-3p | UUCACAGUGGCUAAGUUCUGC | - |
| miR-27a-5p | - | AGAGCUUAGCUGAUUGGUGAAC |
| miR-27b-5p | - | AGGGCUUAGCUGCUUGUGAGCA |
The difference between two sequences from the same species are shown in red.
The one nucleotide difference in the seed sequence osf miR-23 and miR-27 is shown in bold.
miR-24-1 and miR-24-2 share the same 3p sequence, which terms miR-24-3p based on the database.
Plasmid DNA-based approach
Plasmid DNA-based approaches have been introduced to overcome a short-term unstable expression of mimic miRs. This approach can be accomplished by inserting the miRs precursor sequence downstream of RNA polymerase II or III in a vector system [73,74]. Currently, plasmid DNA expression of a pre-miR is an attractive approach because they are easy to prepare and transfect, have biochemical simplicity, and more stable when compared with the oligonucleotide-based approach [70]. A study comparing the transient transfection of chemically synthesized miR mimics to lentiviral or plasmid transfection of miRs demonstrated that using miR mimics results in non-specific gene expression profiles and accumulation of high molecular weight RNA species [75]. The miR mimics also caused cell death and toxicity [75]. In another study it was shown that miR mimics have side-effects and off-target effects that reduce specificity [76]. Therefore, a promising alternative is to use a plasmid DNA-based approach for expression of the pre-miR.
Our group has developed the Plasmid-based microRNA Inhibitor System (PMIS) as a method to efficiently knock down miRs both in vitro and in vivo [27,41,42,45,47,55,56,77–84].
Delivery systems are also an important factor to enhance transfection efficiency. The simplest method to deliver miRs and/or miR inhibitors is to directly transfect cells with naked plasmid DNA. Some studies have reported the successful transfection using exogenous naked pDNA injections in high concentrations [85,86]. However, the limitation is the transfection efficacy of naked pDNA due to the large size of the phosphate group and the cells being hydrophilic in nature. Therefore, current research has developed gene delivery systems to increase their transfection efficiency. Currently, classification of gene delivery systems can be divided into two groups: Viral vectors and non-viral vector carriers.
Viral transfection vector carriers
Viral-based gene therapy was first introduced by Rosenberg et al. [87] who successfully inserted an exogenous gene into tumor-infiltrating lymphocytes using retroviral-mediated gene transduction for treating melanoma patients. This led to the development of other viral transfection vector carriers including adenovirus and lentivirus-mediated gene transduction [88]. Although, viral based gene therapy has a high transduction efficiency, the major challenges of this approach are complicated side effects due to immunogenicity and toxicity.
Non-viral transfection carriers
A practical and safe gene delivery system is the key to success for plasmid DNA encoding miR-based gene therapies. Considering the safety issues with viral vectors, non-viral gene delivery systems are preferred. Advantages of a non-viral delivery system are easier preparation processes and stability of the nanoparticle [89]. Examples of non-viral vector carriers commonly used are lipofectamine and polyethylenimine (PEI).
Lipid-based nanocarriers are the most used nonviral gene delivery systems in vitro. Besides numerous in vitro studies, lipid-mediated miR delivery is also feasible for in vivo applications based on recent findings.
Numerous cationic natural and synthetic polymers have been widely studied and show great promise for both plasmid DNA and RNA gene delivery [90]. Compared with lipid vectors, one obvious advantage of polymer-based delivery systems is that they are more flexible and versatile through variation in polymer molecular weight, structure, composition, and conjugation [91]. Among the currently reported polymer-based vectors, high molecular weight branched polyethylenimine (PEI, 25KD) is still the gold standard and has been most widely used in both preclinical studies and clinical trials because of its relatively high nucleic acid transfer efficiency. However, PEI nanoparticles are extremely toxic to cells, resulting in inflammation and cell death.
Chitosan (CS) is one of the most studied natural polymeric gene carriers derived from partial deacetylation of chitin [92,93]. Chitosan-based gene carriers are especially attractive for regenerative medicine because of its high positive charge, excellent biodegradability, favorable biocompatibility, low toxicity, low cost, and low immunogenicity [92–94].
Calcium phosphates (CaP) have been used as gene carriers for decades through the way of DNA-calcium phosphate co-precipitation to introduce plasmid DNA into many cell types [95–97]. Among the gene vectors being considered to date, the CaP nanoparticle is one of the most promising materials for dental and bone tissue regeneration applications by virtue of the excellent osteoconductivity, biocompatibility, and biodegradability [98]. Similar to CaPs, nano-sized CaCO3/DNA co-precipitates were also studied for gene delivery because of their high biocompatibility and inducible biodegradability [99]. Our unpublished data indicated that the CaCO3-based approach has much higher efficiency than PEI (25KD) at the same culture conditions with 10% serum presence to deliver plasmid DNAs to many different primary cell types, including primary human stem cells and tumor cell lines with significantly lower cytotoxicity. Importantly, CaCO3-mediated miR delivery also showed great efficiency in vivo using different rodent models. Moreover, as an alternative to CaP-based biomaterials, CaCO3-based nanoparticles have shown some unique advantages, e.g. biocompatibility, biodegradation, and osteoconductivity for bone regeneration [100,101]. Therefore, the CaCO3-based approach shows great promise for bone tissue engineering and translational applications.
Mesoporous silica nanoparticles (e.g. MCM-41 and SBA-15 MSNs), are emerging as multifunctional drug delivery carriers because they are capable of absorbing/encapsulating large amounts of bioactive molecules through the hundreds of empty channels with a honeycomb-like porous structure (mesopores). MSNs have some unique features, e.g. large pore volume (~0.9 cm3/g), tunable pore size (2-10 nm), high surface area (~900 m2/g), good chemical and thermal stability, good biocompatibility, excellent surface functionality, which are all advantageous for various controlled release applications [102,103].
Heat-shrinking (HS) DNA nanoparticles are polyacridine PEG-peptide stable DNA nanoparticles that are fully transfection competent in mice [104]. These particles are modified with Lysine residues to achieve high affinity and compaction with a short 18 amino acid peptide. These polyacridine PEG-peptides are readily customizable into targeted carriers to prepare DNA nanoparticles for in vivo gene delivery [104]. Heat shrunken DNA nanoparticles were formulated by combining plasmid DNA with a high affinity DNA binding peptide modified with a single Cys, disulfide-linked, polyethylene glycol (PEG) chain. Heating the DNA to 100°C for 10 min results in partial DNA denaturation and increased DNA flexibility to increase folding. The addition of PEG-peptide to partially denatured plasmid DNA leads to rapid heat shrinking of DNA nanoparticles from 170 nm to 60 nm diameter. Heat shrunken DNA nanoparticles remain fully functional at mediating gene transfer in vivo. The PEG corona layer blocks protein mediated nanoparticle aggregation to allow DNA particles to traverse to the cell membrane. DNA nanoparticles are designed to shed PEG by disulfide bond reduction upon macropinocytosis. An advantage of this formulation is that the nanoparticle size is unchanged during long term storage, freeze-thaw, freeze drying & reconstitution, and during concentration.
Tissue engineering in craniofacial bone defects
Hydroxyapatite
Hydroxyapatite is the most prevalent nonorganic substance found in bone tissue and therefore serves as an effective biomaterial for bone regeneration [105–107]. Hydroxyapatite possesses high mechanical strength and exhibits no cytotoxicity [108], but since it is not readily absorbed by cells, it can hinder bone remodeling unless incorporated appropriately into scaffolds [109]. Since hydroxyapatite alone is brittle, it is generally added in composite with other biomaterials to reinforce its structural integrity [110]. Two studies have investigated bone healing by coculturing human mesenchymal stem cells in hydroxyapatite/tricalcium phosphate ceramic powder. Eskildsen et al. [111] found that inhibiting miR-138 resulted in the up-regulation of osteoblastic genes Runx2 and Osx, enhanced alkaline phosphatase (ALP) activity, matrix mineralization, and a notable increase in bone formation by 60%. Likewise, Chen et al. [112] concluded that the repression of miR-34a up-regulated key osteogenic markers such as ALP, osteopontin, osteonectin, with a 3.5-fold increase in bone formation. Hydroxyapatite has also been successfully implemented in polycaprolactone nanofibers, where Sadeghi et al. inhibited miR-122 in rat mesenchymal stem cells. The study found that seeding such cells into the nanofiber scaffold led to statistically significant closures of critical sized bone defects in rats [113]. An in vitro study by Castaño et al. investigated the role of miR-16 in osteogenesis by utilizing collagen-nanohydroxyapatite scaffolds that were soaked in anti-miR-16 oligomer suspensions. They found that inhibiting miR-16 in human mesenchymal stem cells resulted in overexpression of Runx2 and Ocn by values of 6.29 (±2.3)-fold and 8.19 (±1.96)-fold, respectively, and an increase in calcium deposition by Alizarin Red staining [114]. Wang et al. investigated the role of miR-26a in osteogenesis and angiogenesis [115,116]. Using a porous hydroxyapatite scaffold and adipose-derived stem cells transfected with miR-26a mimics by lipofectamine, Wang et al. [115] observed the formation of new bone tissue with hematoxylin and eosin and Masson’s trichrome staining, and cited an increase in ALP activity, collagen secretion and matrix mineralization.
β-tricalcium phosphate
β-tricalcium phosphate (β-TCP) has been widely used in several applications to regenerate bone in craniofacial defects. A major advantage of β-TCP is that it is capable of releasing large amounts of calcium and sulfate ions to catalyze new bone growth, while also maintaining its structural integrity [117,118]. However, β-TCP has limited osteoinductivity and is rather brittle alone, rendering it inapplicable to load bearing [119]. The mechanical strength and osteoconductivity of β-TCP are enhanced when it is reinforced with other bioceramics such as hydroxyapatite or polycaprolactone [120]. Recent studies have revealed that incorporating microRNAs into β-TCP scaffolds significantly improves bone regeneration. Remy et al. evinced an effective relationship between miR-200c and a β-TCP scaffold, and for the first time, utilized a hybrid process that incorporated both into one biomaterial. The research found that coating β-TCP in a collagen type I suspension with miR-200c plasmid DNA substantially regenerated calvaria bone defect in rats, and outperformed experimental controls [84]. Other studies have simply seeded transfected progenitor cells into β-TCP. For instance, Janko et al. transfected bone marrow mononuclear cells to selectively inhibit miR335 and then seeded them in β-TCP scaffolds. After eight weeks, there was a 40.9% recovery of bone tissue in the femoral defects of the Sprague-Dawley rats that had received the scaffold treatment [121]. Deng et al. inhibited miR-31 in progenitor cells and reported a 35.42 ± 6.12% and a 41.82 ± 6.54% recovery of bone volume in craniofacial defects in rats and canines, respectively [122,123]. Another study, using micro-CT scans, determined a statistically significant increase in bone volume after coculturing bone marrow stem cells overexpressing miR-26a in calvaria bone defects of mice filled with β-TCP scaffolds [124].
Hydrogels
Since hydrogels are highly water absorbent and hydrophilic, they possess material properties very similar to cartilaginous and bony tissues [125]. Hydrogels comprising of natural materials including chitosan, collagen, alginate, fibrin, elastin, heparin, and hyaluronic acid are minimally cytotoxic, highly biodegradable, and versatile for filling in bone defect irregularities [125]. Yet, they are inadequate for load bearing [125]. Conversely, synthetic polymer hydrogels are stiffer and can withstand heavier loads [125]. However, they are found to be much less biodegradable and exhibit varying degrees of cytotoxicity [125]. Hydrogel synthesis therefore has tradeoffs between biocompatibility and structural rigidity, and oftentimes the best approach is to hybridize them with ceramic materials and biodegradable polymers that can both promote biological synergy and improve mechanical durability [126]. Hydrogel scaffolds have been documented as suitable environments for microRNA delivery systems and cell growth [3]. A study conducted by Li et al. utilized a hydrogel construct of a rather sophisticated composition (a thiol-modified analog of heparin with thiol-modified hyaluronan and poly(ethylene glycol) diacrylate, and Glycosil™), which was seeded with human bone marrow mesenchymal stem cells that were transfected with miR-26a oligomers. After twelve weeks, micro-CT scans revealed a complete recovery of calvaria defects in mice [127]. Another study conducted by Quereshi et al. compared Matrigel™, a thermo-reversible hydrogel, to polycaprolactone. Human adipocyte stem cells transfected to overexpress miR-14 were seeded into both types of matrices and were given twelve weeks to grow in calvaria defects. The study found that the transfected cells in Matrigel™ outperformed polycaprolactone in terms of calcium deposition, and normalized fracture healing [128]. Lei et al. investigated neurogenesis and bone regeneration that was regulated by miR-222, and fabricated a hydrogel comprised of a Poly(lactic-co-glycolic acid) (PLGA) core and a poly(ethylene glycol)-poly(N-isopropylacrylamide) (PEG-PNIPAM) shell for localized nanoparticle delivery of miR-222 mimics and Aspirin. Human bone marrow stem cells that overexpressed miR-222 demonstrated an up-regulation of neural differentiation markers such as microtubule associated protein (MAP2), nerve growth factor (NGF) and neural/glial antigen (NG2) [129]. A 21.97% ± 3.99% recovery of bone volume was observed ten weeks after PLGA/PEG-PNIPAM hydrogels comprised of miR-222 mimics and Aspirin were fitted into mandibular defects [129]. The study also discovered an interesting dynamic that coupled stable bone growth with innervation [129]. Hydrogels therefore possess versatile material properties that can be tailored accordingly to meet diverse tissue engineering criteria.
Silk
In recent years, silk has emerged as an alternative biomaterial that can replace metal screws or substitutes such as poly-L-lactic acid, polyglycolic acid (PGA) and poly-lactic-coglycolic acid (PLGA) in fracture fixation [130]. It has also been found to be biodegradable with its resorption conducive to osteoid formation and bone healing [131–134]. In vivo studies have found that silk screws are self-tapping, and silk plates are adaptable to the natural curvature of bone, eliminating additional procedures that otherwise complicate orthopedic surgical implantations [130]. James et al. fabricated silk films using Bombyx mori. Human mesenchymal stem cells were transfected with either a nonspecific vector or miR-214 inhibition oligomers, and then seeded onto the silk films. ALP staining, xylene orange staining for calcium deposition, and von Kossa staining suggested that inhibition of miR-214 in stem cells expressed higher ALP activity levels, higher calcium depositions, and a consequential up-regulation of Runx2, Osx, ATF4, and osteocalcin [135]. The silk films were then manufactured into orthopedic screws and von Kossa stains suggested a relative increase in the optical density of the screws that housed anti-miR-214 cells [135]. However, follow up in vivo studies are required to confirm the feasibility of silk screws and plates for bone regeneration as this biomaterial, in addition to microRNA incorporation, is still a very recent biomedical innovation for craniofacial reconstruction.
Polycaprolactone
Polycaprolactone (PCL) is another material used in tissue engineering due to its biocompatibility, biodegradability and high drug permeability [136]. Tahmasebi et al. fabricated a PCL/microRNA–gelatin nanofiber scaffold for culturing human induced pluripotent stem cells (hiPSCs), which encapsulated miR-22 and miR-126 mimics and was designed to sustain a controlled release of the microRNAs over a 14-day period. The study concluded that the hiPSC’s, after two weeks of culture, exhibited statistically significant up-regulation of osteoblastic markers including ALP activity, Runx2, osteocalcin and osteonectin [137]. Hoseinzadeh et al. engineered PCL scaffolds that were hybridized with nanohydroxyapatite (nHA) to augment osteogenic differentiation of adipose-tissue derived stem cells. The stem cells were first transfected to repress miR-221 and were then seeded into the scaffold. After three weeks of coculture, the transfected cells exhibited a statistically significant overexpression of Runx2, osteocalcin, and ALP activity [138]. However, the relationship between the microRNAs discussed and PCL scaffolds has yet to be confirmed by in vivo experiments.
Poly(lactic-co-glycolic acid)
Poly(lactic-co-glycolic acid) (PLGA), due to its biodegradability and biocompatibility, is an established biomaterial that has frequent tissue engineering applications with a documented history of successful brain implants in both mice and humans [139,140]. In the case study presented by Laio et al. disc shaped PLGA scaffolds that were seeded with human adipocyte mesenchymal stem cells were implanted into mice calvaria defects. The cells were transduced by baculovirus to stably express miR-26a, miR-29b, miR-148b and miR-196a. Stable overexpression of BMP-2 was another baculovirus vector that was incorporated. Interestingly, this study evinced a synergistic relationship between stable up-regulation of a target microRNA and a target protein, namely miR-148b and BMP-2, that resulted in an impressive filling of 94% of the defect area and 89% of the defect volume twelve weeks postoperatively [141]. Qi et al. examined the osteoinduction of human adipose derived mesenchymal stem cells by miR-181-a/b-1 that were seeded into electrospun nanofibrous bilayer scaffolds comprised of PLGA on the outer layer and polyplex/microRNA/gelatin on the inner layer. Cells were either transduced into stable expression and cultured on tissue culture polystyrene (TCPS) or were seeded into PLGA/gelatin scaffolds that encapsulated miR-181a/b-1 mimics. Cells that were co-cultured in the PLGA scaffolds were reported to have a statistically significant increase in calcium secretion, ALP activity, Runx-2, collagen type I, osteocalcin and osteopontin than the TCPS control group [142]. However, the efficacy of miR-181 and PLGA in vivo remains in question.
Other polymers
There has been reported success of incorporating therapeutic microRNAs for bone regeneration in novel biomaterials. One such is poly(glycerol sebacate) (PGS), which is an electrospun and crosslinked nanofiber composed of sebacic acid, glycerol and gelatin that is cured in a vacuum under high heat for 1–2 days [143]. PGS is biocompatible and biodegradable, and random cross-linking gives it similar material properties to Vulcan rubber. Some of its limitations, however, deal with an undefined branch structure, low molecular weight, and a high tendency of premature crosslinking [144]. Deng et al. [145] investigated the osteogenic regulation of miR-31 in biomaterial scaffold comprised of PGS, and transfected rat bone marrow stem cells with lentivirus to stably express either non-specific oligomers, miR-31or anti-miR-31. The cells were then seeded into disc shaped PGS scaffolds that filled calvaria bone defects in rats. The study found that the PGS scaffolds composed of anti-miR-31 transformed cells demonstrated a 60% recovery of bone in the calvaria defect eight weeks postoperatively [145]. Poly(sebacoyl diglyceride)(PSeD) was designed as an improvement to PGS with notable advantages including a longer shelf life, a better-defined structure with more free hydroxyl groups and a higher molecular weight, all while preserving the biodegradability and biocompatibility of its predecessor [144]. In two different experiments, Xie et al. examined the delivery of lentiviral transduced rat adipose derived mesenchymal stem cells in PSeD scaffolds. Both studies reported that ~50% of bone volume was recovered in 8 mm rat calvaria defects in mesenchymal stem cells transformed with miR-135 and anti-miR-146a, respectively [146,147]. Additional studies have also engineered scaffolds that were of complex mixtures of the biomaterials discussed above. Moncal et al. fabricated polymeric scaffolds that were comprised of a sophisticated combination of PCL, PLGA, and nanohydroxyapatite, which were then filled with a collagen type I gel to encapsulate rat bone marrow stem cells that were transfected with miR-148b by silver nanoparticles. The study found that after eight weeks of implantation into rat calvaria defects, micro-CT scans detected a 78.1 ± 20.8% recovery of bone volume and a 34.7 ± 8.9% normalized bone mineral density in the collagen scaffolds that cultured miR-148b overexpressing cells [148] (Table 3).
Table 3.
Biomaterials used in the application of specific miRs for bone formation and regeneration.
| Biomaterial | miRs | Main Observation | In vivo testing? | Reference Index |
|---|---|---|---|---|
| Hydroxyapatite | anti-miR-16 | Statistically significant upregulation of osteoblastic markers | no | [114] |
| miR-26a | Notably enhanced bone growth in calvaria defect | yes | [115] | |
| anti-miR-34a | 3.5-fold increase in formation of new bone | yes | [112] | |
| anti-miR-138 | 60% increase in new bone growth | yes | [111] | |
| anti-miR-221 | Hard tissue formation detected and partial recovery of defect | yes | [113] | |
| β-Tricalcium Phosphate | miR-26a | Notably enhanced bone growth in calvaria defect | yes | [124] |
| anti-miR-31 | 35.42 ± 6.12 % and 41.82 ± 6.54% increase in bone volume, respectively | yes | [122,123] | |
| miR-200c | Statistically significant increase in new bone formation | yes | [84] | |
| anti-miR-335-5p | 40.9% recovery of femoral bone defect | yes | [121] | |
| Hydrogel | miR-26a | Complete restoration of calvaria bone defect | yes | [127] |
| miR-148b | 32.53 ± 8.3% recovery of calvaria bone defect | yes | [128] | |
| miR-222/ Aspirin | 21.97 ± 3.99% recovery of bone volume in mandibular defect | yes | [129] | |
| Silk | anti-miR-214 | Statistically significant upregulation of osteoblastic markers | no | [135] |
| Poly-caprolactone | miR-22 | Statistically significant upregulation of osteoblastic markers | no | [137] |
| miR-126 | Statistically significant upregulation of osteoblastic markers | no | [137] | |
| anti-miR-221 | Statistically significant upregulation of osteoblastic markers | no | [138] | |
| Poly (lactic-co-glycolic acid) | miR-148b/BMP-2 | 94% filling of area and 89% volume recovery in calvaria bone defect | yes | [141] |
| miR-181a/b-1 | Statistically significant upregulation of osteoblastic markers | no | [142] | |
| Poly(glycerol sebacate) | anti-miR-31 | 41.82 ± 6.54 % recovery of bone volume in calvaria bone defect | yes | [145] |
| Poly(sebacoyl diglyceride) | miR-135 | 50.53 ± 4.45% increase in bone volume of cranial bone defect | yes | [146] |
| anti-miR-146a | 49.8 ± 5.49% increase in bone volume of cranial bone defect | yes | [147] | |
| Collagen | miR-148b | 78.1 ± 20.8% area recovery of calvaria bone defect | yes | [148] |
Perspectives.
The direct delivery of miRs to cells and tissues has the advantage to provide a promising approach for bone and tissue regeneration. PMIS-miR gene therapy works both in vivo and in vitro, and is specific with no off-target effects, no toxicity and is efficient and effective.
We have shown that highly purified naked plasmid DNA encoding PMIS-miR inhibitors can safely and effectively increase the expression of PMIS transcripts in vitro and in vivo. We have used the PMIS system to generate mouse models to study the in vivo role of miRs
The PMIS transcripts expressed from the plasmid DNA can transform neighboring cells by extracellular vesicles containing the PMIS miR inhibitor transcript. Extracellular vesicle expansion of the PMIS transcripts allows for rapid PMIS expression during tissue regeneration. Experiments in dogs, rats and mice demonstrate that the PMIS is not toxic and highly effective.
Acknowledgements
We thank members of the Amendt and Hong laboratories for their expertise and helpful discussions.
Funding
This work was supported by funds from the University of Iowa Carver College of Medicine and the National Institutes of Health grants, DE026433 to L.H. and DE027569 to B.A.A.
Abbreviations
- ALP
alkaline phosphatase
- EVs
extracellular vesicles
- MSCs
mesenchymal stem cells
- PCL
Polycaprolactone
- PEG
polyethylene glycol
- PEI
polyethylenimine
- PGS
poly(glycerol sebacate)
- PLGA
Poly(lactic-co-glycolic acid)
- PMIS
Plasmid-based microRNA Inhibitor System
- PSeD
Poly(sebacoyl diglyceride)
- TCP
tricalcium phosphate
Footnotes
Competing Interests
Brad A. Amendt is the CSO of NaturemiRI, LLC.
References
- 1.Oryan A, Alidadi S, Moshiri A and Maffulli N (2014) Bone regenerative medicine: classic options, novel strategies, and future directions. J. Orthop. Surg. Res 9, 18 10.1186/1749-799x-9-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Baldwin P, Li DJ, Auston DA, Mir HS, Yoon RS and Koval KJ (2019) Autograft, allograft, and bone graft substitutes: clinical evidence and indications for use in the setting of orthopaedic trauma surgery. J. Orthop. Trauma 33, 203–213 10.1097/bot.0000000000001420 [DOI] [PubMed] [Google Scholar]
- 3.Salinas CN and Anseth KS (2009) Mesenchymal stem cells for craniofacial tissue regeneration: designing hydrogel delivery vehicles. J. Dent. Res 88, 681–692 10.1177/0022034509341553 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Arriaga MA, Ding MH, Gutierrez AS and Chew SA (2019) The application of microRNAs in biomaterial scaffold-based therapies for bone tissue engineering. Biotechnol. J 14, e1900084 10.1002/biot.201900084 [DOI] [PubMed] [Google Scholar]
- 5.Chen F-M and Liu X (2016) Advancing biomaterials of human origin for tissue engineering. Prog. Polym. Sci 53, 86–168 10.1016/j.progpolymsci.2015.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Li L, Zhou G, Wang Y, Yang G, Ding S and Zhou S (2015) Controlled dual delivery of BMP-2 and dexamethasone by nanoparticle-embedded electrospun nanofibers for the efficient repair of critical-sized rat calvarial defect. Biomaterials 37, 218–229 10.1016/j.biomaterials.2014.10.015 [DOI] [PubMed] [Google Scholar]
- 7.Miszuk JM, Xu T, Yao Q, Fang F, Childs JD, Hong Z et al. (2018) Functionalization of PCL-3D electrospun nanofibrous scaffolds for improved BMP2-induced bone formation. Appl. Mater. Today 10, 194–202 10.1016/j.apmt.2017.12.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chung YI, Ahn KM, Jeon SH, Lee SY, Lee JH and Tae G (2007) Enhanced bone regeneration with BMP-2 loaded functional nanoparticle-hydrogel complex. J. Control. Release 121, 91–99 10.1016/j.jconrel.2007.05.029 [DOI] [PubMed] [Google Scholar]
- 9.Koh JT, Zhao Z, Wang Z, Lewis IS, Krebsbach PH and Franceschi RT (2008) Combinatorial gene therapy with BMP2/7 enhances cranial bone regeneration. J. Dent. Res 87, 845–849 10.1177/154405910808700906 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kim S, Kim J, Gajendiran M, Yoon M, Hwang MP, Wang Y et al. (2018) Enhanced skull bone regeneration by sustained release of BMP-2 in interpenetrating composite hydrogels. Biomacromolecules 19, 4239–4249 10.1021/acs.biomac.8b01013 [DOI] [PubMed] [Google Scholar]
- 11.Sawyer AA, Song SJ, Susanto E, Chuan P, Lam CX, Woodruff MA et al. (2009) The stimulation of healing within a rat calvarial defect by mPCL-TCP/collagen scaffolds loaded with rhBMP-2. Biomaterials 30, 2479–2488 10.1016/j.biomaterials.2008.12.055 [DOI] [PubMed] [Google Scholar]
- 12.Yang L, Huang J, Yang S, Cui W, Wang J, Zhang Y et al. (2018) Bone regeneration induced by local delivery of a modified PTH-derived peptide from nanohydroxyapatite/chitosan coated true bone ceramics. ACS Biomater. Sci. Eng 4, 3246–3258 10.1021/acsbiomaterials.7b00780 [DOI] [PubMed] [Google Scholar]
- 13.Dang M, Koh AJ, Jin X, McCauley LK and Ma PX (2017) Local pulsatile PTH delivery regenerates bone defects via enhanced bone remodeling in a cell-free scaffold. Biomaterials 114, 1–9 10.1016/j.biomaterials.2016.10.049 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Linh NTB, Abueva CDG, Jang DW and Lee BT (2020) Collagen and bone morphogenetic protein-2 functionalized hydroxyapatite scaffolds induce osteogenic differentiation in human adipose-derived stem cells. J. Biomed. Mater. Res. B Appl. Biomater 108, 1363–1371 10.1002/jbm.b.34485 [DOI] [PubMed] [Google Scholar]
- 15.Alluri R, Song X, Bougioukli S, Pannell W, Vakhshori V, Sugiyama O et al. (2019) Regional gene therapy with 3D printed scaffolds to heal critical sized bone defects in a rat model. J. Biomed. Mater. Res. A 107, 2174–2182 10.1002/jbm.a.36727 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Mitchell AC, Briquez PS, Hubbell JA and Cochran JR (2016) Engineering growth factors for regenerative medicine applications. Acta Biomater 30, 1–12 10.1016/j.actbio.2015.11.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Weisgerber DW, Caliari SR and Harley BA (2015) Mineralized collagen scaffolds induce hMSC osteogenesis and matrix remodeling. Biomater. Sci 3, 533–542 10.1039/c4bm00397g [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Min Z, Shichang Z, Chen X, Yufang Z and Changqing Z (2015) 3D-printed dimethyloxallyl glycine delivery scaffolds to improve angiogenesis and osteogenesis. Biomater. Sci 3, 1236–1244 10.1039/c5bm00132c [DOI] [PubMed] [Google Scholar]
- 19.Balmayor ER and van Griensven M (2015) Gene therapy for bone engineering. Front. Bioeng. Biotechnol 3, 9 10.3389/fbioe.2015.00009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sawada K, Nakahara K, Haga-Tsujimura M, Iizuka T, Fujioka-Kobayashi M, Igarashi K et al. (2018) Comparison of three block bone substitutes for bone regeneration: long-term observation in the beagle dog. Odontology 106, 398–407 10.1007/s10266-018-0352-7 [DOI] [PubMed] [Google Scholar]
- 21.Santo VE, Gomes ME, Mano JF and Reis RL (2013) Controlled release strategies for bone, cartilage, and osteochondral engineering–Part I: recapitulation of native tissue healing and variables for the design of delivery systems. Tissue Eng. Part B Rev 19, 308–326 10.1089/ten.TEB.2012.0138 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.O’Brien J, Hayder H, Zayed Y and Peng C (2018) Overview of microRNA biogenesis, mechanisms of actions, and circulation. Front. Endocrinol 9, 402 10.3389/fendo.2018.00402 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.John B, Enright AJ, Aravin A, Tuschl T, Sander C and Marks DS (2004) Human microRNA targets. PLoS Biol 2, e363 10.1371/journal.pbio.0020363 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim HK, Lee YS, Sivaprasad U, Malhotra A and Dutta A (2006) Muscle-specific microRNA miR-206 promotes muscle differentiation. J. Cell Biol 174, 677–687 10.1083/jcb.200603008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Greco SJ and Rameshwar P (2007) MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells. Proc. Natl Acad. Sci. U.S.A 104, 15484–9 10.1073/pnas.0703037104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297 10.1016/s0092-8674(04)00045-5 [DOI] [PubMed] [Google Scholar]
- 27.Hong L, Sun H and Amendt BA (2021) MicroRNA function in craniofacial bone formation, regeneration and repair. Bone 144, 115789 10.1016/j.bone.2020.115789 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Caplan AI (1991) Mesenchymal stem cells. J. Orthop. Res 9, 641–650 10.1002/jor.1100090504 [DOI] [PubMed] [Google Scholar]
- 29.Yang C, Luo M, Chen Y, You M and Chen Q (2021) MicroRNAs as important regulators mediate the multiple differentiation of mesenchymal stromal cells. Front. Cell Dev. Biol 9, 619842 10.3389/fcell.2021.619842 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gangaraju VK and Lin H (2009) MicroRNAs: key regulators of stem cells. Nat. Rev. Mol. Cell Biol 10, 116–125 10.1038/nrm2621 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Nooshabadi VT, Mardpour S, Yousefi-Ahmadipour A, Allahverdi A, Izadpanah M, Daneshimehr F et al. (2018) The extracellular vesicles-derived from mesenchymal stromal cells: a new therapeutic option in regenerative medicine. J. Cell. Biochem 119, 8048–8073 10.1002/jcb.26726 [DOI] [PubMed] [Google Scholar]
- 32.Yeo RW, Lai RC, Zhang B, Tan SS, Yin Y, Teh BJ et al. (2013) Mesenchymal stem cell: an efficient mass producer of exosomes for drug delivery. Adv. Drug Deliv. Rev 65, 336–341 10.1016/j.addr.2012.07.001 [DOI] [PubMed] [Google Scholar]
- 33.Asgarpour K, Shojaei Z, Amiri F, Ai J, Mahjoubin-Tehran M, Ghasemi F et al. (2020) Exosomal microRNAs derived from mesenchymal stem cells: cell-to-cell messages. Cell Commun. Signal 18, 149 10.1186/s12964-020-00650-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Collino F, Deregibus MC, Bruno S, Sterpone L, Aghemo G, Viltono L et al. (2010) Microvesicles derived from adult human bone marrow and tissue specific mesenchymal stem cells shuttle selected pattern of miRNAs. PLoS ONE 5, e11803 10.1371/journal.pone.0011803 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS et al. (2010) Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. BMC Genomics 11, S6 10.1186/1471-2164-11-s1-s6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Tsai M-S, Hwang S-M, Chen K-D, Lee Y-S, Hsu L-W, Chang Y-J et al. (2007) Functional network analysis of the transcriptomes of mesenchymal stem cells derived from amniotic fluid, amniotic membrane, cord blood, and bone marrow. Stem Cells 25, 2511–2523 10.1634/stemcells.2007-0023 [DOI] [PubMed] [Google Scholar]
- 37.Lam AT-L, Lee AP, Jayaraman P, Tan KY, Raghothaman D, Lim HL et al. (2021) Multiomics analyses of cytokines, genes, miRNA, and regulatory networks in human mesenchymal stem cells expanded in stirred microcarrier-spinner cultures. Stem Cell Res 53, 102272 10.1016/j.scr.2021.102272 [DOI] [PubMed] [Google Scholar]
- 38.Inui M, Mokuda S, Sato T, Moe T, Takada S and Asahara H (2018) Dissecting the roles of miR-140 and its host gene. Nat. Cell Biol 20, 516–518 10.1038/s41556-018-0077-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Miyaki S, Sato T, Inoue A, Otsuki S, Ito Y, Yokoyama S et al. (2010) MicroRNA-140 plays dual roles in both cartilage development and homeostasis. Genes Dev 24, 1173–1185 10.1101/gad.1915510 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Nakamura Y, He X, Kato H, Wakitani S, Kobayashi T, Watanabe S et al. (2012) Sox9 is upstream of microRNA-140 in cartilage. Appl. Biochem. Biotechnol 166, 64–71 10.1007/s12010-011-9404-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ries RJ, Yu W, Holton N, Cao H and Amendt BA (2017) Inhibition of the miR-17-92 cluster separates stages of palatogenesis. J. Dent. Res 96, 1257–1264 10.1177/0022034517716915 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Cao H, Yu W, Li X, Wang J, Gao S, Holton NE et al. (2016) A new plasmid-based microRNA inhibitor system that inhibits microRNA families in transgenic mice and cells: a potential new therapeutic reagent. Gene Ther 23, 527–542 10.1038/gt.2016.22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sheehy NT, Cordes KR, White MP, Ivey KN and Srivastava D (2010) The neural crest-enriched microRNA miR-452 regulates epithelial-mesenchymal signaling in the first pharyngeal arch. Development (Cambridge, England) 137, 4307–4316 10.1242/dev.052647 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Khan QE, Sehic A, Khuu C, Risnes S and Osmundsen H (2013) Expression of Clu and Tgfb1 during murine tooth development: effects of in-vivo transfection with anti-miR-214. Eur. J. Oral Sci 121, 303–312 10.1111/eos.12056 [DOI] [PubMed] [Google Scholar]
- 45.Eliason S, Sharp T, Sweat M, Sweat YY and Amendt BA (2020) Ectodermal organ development is regulated by a microRNA-26b-Lef-1-Wnt signaling axis. Front. Physiol 11, 780 10.3389/fphys.2020.00780 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Kim EJ, Lee MJ, Li L, Yoon KS, Kim KS and Jung HS (2014) Failure of tooth formation mediated by miR-135a overexpression via BMP signaling. J. Dent. Res 93, 571–575 10.1177/0022034514529303 [DOI] [PubMed] [Google Scholar]
- 47.Sweat M, Sweat Y, Yu W, Su D, Leonard RJ, Eliason SL et al. (2021) The miR-200 family is required for ectodermal organ development through the regulation of the epithelial stem cell niche. Stem Cells 39, 761–775 10.1002/stem.3342 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Feng L, Zhang JF, Shi L, Yang ZM, Wu TY, Wang HX et al. (2020) MicroRNA-378 suppressed osteogenesis of MSCs and impaired bone formation via inactivating Wnt/β-catenin signaling. Mol. Ther. Nucleic Acids 21, 1017–1028 10.1016/j.omtn.2020.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Godfrey TC, Wildman BJ, Beloti MM, Kemper AG, Ferraz EP, Roy B et al. (2018) The microRNA-23a cluster regulates the developmental HoxA cluster function during osteoblast differentiation. J. Biol. Chem 293, 17646–17660 10.1074/jbc.RA118.003052 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Zeng H-C, Bae Y, Dawson BC, Chen Y, Bertin T, Munivez E et al. (2017) MicroRNA miR-23a cluster promotes osteocyte differentiation by regulating TGF-β signalling in osteoblasts. Nat. Commun 8, 15000 10.1038/ncomms15000 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Hassan MQ, Gordon JAR, Beloti MM, Croce CM, Wijnen AJ, Stein JL et al. (2010) A network connecting Runx2, SATB2, and the miR-23a~27a~24-2 cluster regulates the osteoblast differentiation program. Proc. Natl Acad. Sci. U.S.A 107, 19879–19884 10.1073/pnas.1007698107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Gindin Y, Jiang Y, Francis P, Walker R, Abaan O, Zhu Y et al. (2015) miR-23a impairs bone differentiation in osteosarcoma via down-regulation of GJA1. Front. Genet 6, 233 10.3389/fgene.2015.00233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Wang Q, Lin H, Ran J, Jiang Z, Ren Q, He W et al. (2022) miR-200a-3p represses osteogenesis of human periodontal ligament stem cells by targeting ZEB2 and activating the NF-κB pathway. Acta Odontol. Scand 80, 140–149 10.1080/00016357.2021.1964593 [DOI] [PubMed] [Google Scholar]
- 54.Lv R, Pan X, Song L, Sun Q, Guo C, Zou S et al. (2019) MicroRNA-200a-3p accelerates the progression of osteoporosis by targeting glutaminase to inhibit osteogenic differentiation of bone marrow mesenchymal stem cells. Biomed. Pharmacother 116, 108960 10.1016/j.biopha.2019.108960 [DOI] [PubMed] [Google Scholar]
- 55.Akkouch A, Eliason S, Sweat ME, Romero-Bustillos M, Zhu M, Qian F et al. (2019) Enhancement of MicroRNA-200c on osteogenic differentiation and bone regeneration by targeting Sox2-Mediated Wnt signaling and Klf4. Hum. Gene Ther 30, 1405–1418 10.1089/hum.2019.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Hong L, Sharp T, Khorsand B, Fischer C, Eliason S, Salem A et al. (2016) MicroRNA-200c represses IL-6, IL-8, and CCL-5 expression and enhances osteogenic differentiation. PLoS ONE 11, e0160915 10.1371/journal.pone.0160915 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Xu G, Ding Z and Shi HF (2019) The mechanism of miR-889 regulates osteogenesis in human bone marrow mesenchymal stem cells. J. Orthop. Surg. Res 14, 366 10.1186/s13018-019-1399-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Yu H, Wang K, Liu P, Luo P, Zhu D, Yin J et al. (2021) miR-4286 functions in osteogenesis and angiogenesis via targeting histone deacetylase 3 and alleviates alcohol-induced bone loss in mice. Cell Prolif 54, e13054 10.1111/cpr.13054 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Sun Y, Xu J, Xu L, Zhang J, Chan K, Pan X et al. (2017) MiR-503 promotes bone formation in distraction osteogenesis through suppressing Smurf1 expression. Sci. Rep 7, 409 10.1038/s41598-017-00466-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Zhou B, Peng K, Wang G, Chen W, Liu P, Chen F et al. (2020) Mir-483-3p promotes the osteogenesis of human osteoblasts by targeting Dikkopf 2 (DKK2) and the Wnt signaling pathway. Int. J. Mol. Med 46, 1571–1581 10.3892/ijmm.2020.4694 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Fallah A, Alipour M, Jamali Z, Farjadfar A, Roshangar L, Partovi Nasr M et al. (2021) Overexpression effects of miR-424 and BMP2 on the osteogenesis of wharton’s jelly-derived stem cells. BioMed. Res. Int 2021, 7031492 10.1155/2021/7031492 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Li H, Fan J, Fan L, Li T, Yang Y, Xu H et al. (2018) MiRNA-10b reciprocally stimulates osteogenesis and inhibits adipogenesis partly through the TGF-β/SMAD2 signaling pathway. Aging Dis 9, 1058–1073 10.14336/ad.2018.0214 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Sun T, Li C-T, Xiong L, Ning Z, Leung F, Peng S et al. (2017) miR-375-3p negatively regulates osteogenesis by targeting and decreasing the expression levels of LRP5 and β-catenin. PLoS ONE 12, e0171281 10.1371/journal.pone.0171281 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Yang W, Zhu W, Yang Y, Guo M, Qian H, Jiang W et al. (2021) Exosomal miR-100-5p inhibits osteogenesis of hBMSCs and angiogenesis of HUVECs by suppressing the BMPR2/Smad1/5/9 signalling pathway. Stem Cell Res. Ther 12, 390 10.1186/s13287-021-02438-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Li Z, Hassan MQ, Jafferji M, Aqeilan RI, Garzon R, Croce CM et al. (2009) Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation *. J. Biol. Chem 284, 15676–15684 10.1074/jbc.M809787200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Lu GD, Cheng P, Liu T and Wang Z (2020) BMSC-derived exosomal miR-29a promotes angiogenesis and osteogenesis. Front. Cell Dev. Biol 8, 608521 10.3389/fcell.2020.608521 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Duan L, Zhao H, Xiong Y, Tang X, Yang Y, Hu Z et al. (2018) miR-16-2* interferes with WNT5A to regulate osteogenesis of mesenchymal stem cells. Cell. Physiol. Biochem 51, 1087–1102 10.1159/000495489 [DOI] [PubMed] [Google Scholar]
- 68.Yin P, Shi Q, Xiao F, Zhao B, Yu W, Wu K et al. (2020) Inhibition of miR-22 promotes differentiation of osteoblasts and improves bone formation via the YWHAZ pathway in experimental mice. Arch. Med. Sci 16, 1419–1431 10.5114/aoms.2019.89979 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Martinez J, Patkaniowska A, Urlaub H, Lührmann R and Tuschl T (2002) Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110, 563–574 10.1016/s0092-8674(02)00908-x [DOI] [PubMed] [Google Scholar]
- 70.Zhang H, Shykind B and Sun T (2013) Approaches to manipulating microRNAs in neurogenesis. Front. Neurosci 6, 196 10.3389/fnins.2012.00196 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Ebert MS and Sharp PA (2012) Roles for microRNAs in conferring robustness to biological processes. Cell 149, 515–524 10.1016/j.cell.2012.04.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Li J, Zhao Y, Lu Y, Ritchie W, Grau G, Vadas MA et al. (2016) The poly-cistronic miR-23-27-24 complexes target endothelial cell junctions: differential functional and molecular effects of miR-23a and miR-23b. Mol. Ther. Nucleic Acids 5, e354 10.1038/mtna.2016.62 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H et al. (2004) Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 64, 3753–3756 10.1158/0008-5472.CAN-04-0637 [DOI] [PubMed] [Google Scholar]
- 74.McLaughlin J, Cheng D, Singer O, Lukacs RU, Radu CG, Verma IM et al. (2007) Sustained suppression of Bcr-Abl-driven lymphoid leukemia by microRNA mimics. Proc. Natl Acad. Sci. U.S.A 104, 20501–20506 10.1073/pnas.0710532105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Jin HY, Gonzalez-Martin A, Miletic AV, Lai M, Knight S, Sabouri-Ghomi M et al. (2015) Transfection of microRNA mimics should be used with caution. Front. Genet 6, 340 10.3389/fgene.2015.00340 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Sokilde R, Newie I, Persson H, Borg A and Rovira C (2015) Passenger strand loading in overexpression experiments using microRNA mimics. RNA Biol 12, 787–791 10.1080/15476286.2015.1020270 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Cao H, Jheon A, Li X, Sun Z, Wang J, Florez S et al. (2013) The Pitx2:miR-200c/141:noggin pathway regulates Bmp signaling and ameloblast differentiation. Development (Cambridge, England) 140, 3348–3359 10.1242/dev.089193 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Sweat Y, Ries RJ, Sweat M, Su D, Shao F, Eliason S et al. (2021) miR-17 acts as a tumor suppressor by negatively regulating the miR-17-92 cluster. Mol. Ther. Nucleic Acids 26, 1148–1158 10.1016/j.omtn.2021.10.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Eliason S, Hong L, Sweat Y, Chalkley C, Cao H, Liu Q et al. (2022) Extracellular vesicle expansion of PMIS-miR-210 expression inhibits colorectal tumour growth via apoptosis and an XIST/NME1 regulatory mechanism. Clin. Transl. Med 12, e1037 10.1002/ctm2.1037 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Zhang Z, Kim K, Li X, Moreno M, Sharp T, Goodheart MJ et al. (2014) MicroRNA-26b represses colon cancer cell proliferation by inhibiting lymphoid enhancer factor 1 expression. Mol. Cancer Ther 13, 1942–1951 10.1158/1535-7163.MCT-13-1000 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Sharp T, Wang J, Li X, Cao H, Gao S, Moreno M et al. (2014) A pituitary homeobox 2 (Pitx2):microRNA-200a-3p:beta-catenin pathway converts mesenchyme cells to amelogenin-expressing dental epithelial cells. J. Biol. Chem 289, 27327–27341 10.1074/jbc.M114.575654 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Gao S, Moreno M, Eliason S, Cao H, Li X, Yu W et al. (2015) TBX1 protein interactions and microRNA-96-5p regulation controls cell proliferation during craniofacial and dental development: implications for 22q11.2 deletion syndrome. Hum. Mol. Genet 24, 2330–2348 10.1093/hmg/ddu750 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Akkouch A, Zhu M, Romero-Bustillos M, Eliason S, Qian F, Salem AK et al. (2019) MicroRNA-200c attenuates periodontitis by modulating proinflammatory and osteoclastogenic mediators. Stem Cells Dev 28, 1026–1036 10.1089/scd.2019.0027 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Remy MT, Akkouch A, He L, Eliason S, Sweat ME, Krongbaramee T et al. (2021) Rat calvarial bone regeneration by 3D-printed β-tricalcium phosphate incorporating microRNA-200c. ACS Biomater. Sci. Eng 7, 4521–4534 10.1021/acsbiomaterials.0c01756 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Li H, Kloosterman W and Fekete DM (2010) MicroRNA-183 family members regulate sensorineural fates in the inner ear. J. Neurosci 30, 3254–3263 10.1523/JNEUROSCI.4948-09.2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Suryawanshi H, Sarangdhar MA, Vij M, Roshan R, Singh VP, Ganguli M et al. (2015) A simple alternative to stereotactic injection for brain specific knockdown of miRNA. J. Vis. Exp, 106, e53307 10.3791/53307 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Rosenberg SA, Aebersold P, Cornetta K, Kasid A, Morgan RA, Moen R et al. (1990) Gene transfer into humans—immunotherapy of patients with advanced melanoma, using tumor-infiltrating lymphocytes modified by retroviral gene transduction. N. Engl. J. Med 323, 570–578 10.1056/NEJM199008303230904 [DOI] [PubMed] [Google Scholar]
- 88.Bulcha JT, Wang Y, Ma H, Tai PW and Gao G (2021) Viral vector platforms within the gene therapy landscape. Signal Transduct. Target. Ther 6, 1–24 10.1038/s41392-021-00487-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Ramamoorth M and Narvekar A (2015) Non viral vectors in gene therapy-an overview. J. Clin. Diagn. Res 9, GE01–GE06 10.7860/JCDR/2015/10443.5394 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Son S, Namgung R, Kim J, Singha K and Kim WJ (2012) Bioreducible polymers for gene silencing and delivery. Acc. Chem. Res 45, 1100–1112 10.1021/ar200248u [DOI] [PubMed] [Google Scholar]
- 91.Peng B, Chen Y and Leong KW (2015) MicroRNA delivery for regenerative medicine. Adv. Drug Deliv. Rev 88, 108–122 10.1016/j.addr.2015.05.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Raftery R, Brien FJ and Cryan S-A (2013) Chitosan for gene delivery and orthopedic tissue engineering applications. Molecules 18, 5611–5647 10.3390/molecules18055611 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Dang JM and Leong KW (2006) Natural polymers for gene delivery and tissue engineering. Adv. Drug Deliv. Rev 58, 487–499 10.1016/j.addr.2006.03.001 [DOI] [PubMed] [Google Scholar]
- 94.Katas H and Alpar HO (2006) Development and characterisation of chitosan nanoparticles for siRNA delivery. J. Control. Release 115, 216–225 10.1016/j.jconrel.2006.07.021 [DOI] [PubMed] [Google Scholar]
- 95.Jordan M, Schallhorn A and Wurm FM (1996) Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation. Nucleic Acids Res 24, 596–601 10.1093/nar/24.4.596 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Olton D, Li J, Wilson ME, Rogers T, Close J, Huang L et al. (2007) Nanostructured calcium phosphates (NanoCaPs) for non-viral gene delivery: influence of the synthesis parameters on transfection efficiency. Biomaterials 28, 1267–1279 10.1016/j.biomaterials.2006.10.026 [DOI] [PubMed] [Google Scholar]
- 97.Lee D, Upadhye K and Kumta PN (2012) Nano-sized calcium phosphate (CaP) carriers for non-viral gene deilvery. Mater. Sci. Eng. B 177, 289–302 10.1016/j.mseb.2011.11.001 [DOI] [Google Scholar]
- 98.Levingstone TJ, Herbaj S and Dunne NJ (2019) Calcium phosphate nanoparticles for therapeutic applications in bone regeneration. Nanomaterials (Basel, Switzerland) 9, 1570 10.3390/nano9111570 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Chen S, Li F, Zhuo RX and Cheng SX (2011) Efficient non-viral gene delivery mediated by nanostructured calcium carbonate in solution-based transfection and solid-phase transfection. Mol. Biosyst 7, 2841–2847 10.1039/c1mb05147d [DOI] [PubMed] [Google Scholar]
- 100.Woldetsadik AD, Sharma SK, Khapli S, Jagannathan R and Magzoub M (2017) Hierarchically porous calcium carbonate scaffolds for bone tissue engineering. ACS Biomater. Sci. Eng 3, 2457–2469 10.1021/acsbiomaterials.7b00301 [DOI] [PubMed] [Google Scholar]
- 101.Yu H-D, Zhang Z-Y, Win KY, Chan J, Teoh SH and Han M-Y (2010) Bioinspired fabrication of 3D hierarchical porous nanomicrostructures of calcium carbonate for bone regeneration. Chem. Commun 46, 6578–6580 10.1039/c0cc01348j [DOI] [PubMed] [Google Scholar]
- 102.Slowing II, Vivero-Escoto JL, Wu C-W and Lin VSY (2008) Mesoporous silica nanoparticles as controlled release drug delivery and gene transfection carriers. Adv. Drug Deliv. Rev 60, 1278–1288 10.1016/j.addr.2008.03.012 [DOI] [PubMed] [Google Scholar]
- 103.Zhou Y, Quan G, Wu Q, Zhang X, Niu B, Wu B et al. (2018) Mesoporous silica nanoparticles for drug and gene delivery. Acta Pharm. Sin. B 8, 165–177 10.1016/j.apsb.2018.01.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Mathew B, Ramanathan R, Delvaux NA, Poliskey J and Rice KG (2020) Heat-shrinking DNA nanoparticles for in vivo gene delivery. Gene Ther 27, 196–208 10.1038/s41434-019-0117-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Sasaki N, Matsushima N, Ikawa T, Yamamura H and Fukuda A (1989) Orientation of bone mineral and its role in the anisotropic mechanical properties of bone—Transverse anisotropy. J. Biomech 22, 157–164 10.1016/0021-9290(89)90038-9 [DOI] [PubMed] [Google Scholar]
- 106.Liu XJ, Zhu QS, Sun HF, Song XJ, Wang CL, Wu YT et al. (2022) The clinical efficacy of hydroxyapatite and its composites in spinal reconstruction: a meta-analysis. Eur. Rev. Med. Pharmacol. Sci 26, 4614–4624 10.26355/eurrev_202207_29183 [DOI] [PubMed] [Google Scholar]
- 107.Chu TMG, Orton DG, Hollister SJ, Feinberg SE and Halloran JW (2002) Mechanical and in vivo performance of hydroxyapatite implants with controlled architectures. Biomaterials 23, 1283–1293 10.1016/S0142-9612(01)00243-5 [DOI] [PubMed] [Google Scholar]
- 108.Wubneh A, Tsekoura EK, Ayranci C and Uludağ H (2018) Current state of fabrication technologies and materials for bone tissue engineering. Acta Biomater 80, 1–30 10.1016/j.actbio.2018.09.031 [DOI] [PubMed] [Google Scholar]
- 109.Suh DY, Boden SD, Louis-Ugbo J, Mayr M, Murakami H, Kim HS et al. (2002) Delivery of recombinant human bone morphogenetic protein-2 using a compression-resistant matrix in posterolateral spine fusion in the rabbit and in the non-human primate. Spine 27, 353–360 10.1097/00007632-200202150-00006 [DOI] [PubMed] [Google Scholar]
- 110.Wang M (2003) Developing bioactive composite materials for tissue replacement. Biomaterials 24, 2133–2151 10.1016/S0142-9612(03)00037-1 [DOI] [PubMed] [Google Scholar]
- 111.Eskildsen T, Taipaleenmäki H, Stenvang J, Abdallah BM, Ditzel N, Nossent AY et al. (2011) MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivo. Proc. Natl Acad. Sci. U.S.A 108, 6139–6144 10.1073/pnas.1016758108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Chen L, HolmstrØm K, Qiu W, Ditzel N, Shi K, Hokland L et al. (2014) MicroRNA-34a inhibits osteoblast differentiation and in vivo bone formation of human stromal stem cells. Stem Cells 32, 902–912 10.1002/stem.1615 [DOI] [PubMed] [Google Scholar]
- 113.Sadeghi M, Bakhshandeh B, Dehghan MM, Mehrnia MR and Khojasteh A (2016) Functional synergy of anti-mir221 and nanohydroxyapatite scaffold in bone tissue engineering of rat skull. J. Mater. Sci. Mater. Med 27, 132 10.1007/s10856-016-5746-x [DOI] [PubMed] [Google Scholar]
- 114.Mencía Castaño I, Curtin CM, Duffy GP and O’Brien FJ (2019) Harnessing an inhibitory role of miR-16 in osteogenesis by human mesenchymal stem cells for advanced scaffold-based bone tissue engineering. Tissue Eng. A 25, 24–33 10.1089/ten.TEA.2017.0460 [DOI] [PubMed] [Google Scholar]
- 115.Wang Z, Zhang D, Hu Z, Cheng J, Zhuo C, Fang X et al. (2015) MicroRNA-26a-modified adipose-derived stem cells incorporated with a porous hydroxyapatite scaffold improve the repair of bone defects. Mol. Med. Rep 12, 3345–3350 10.3892/mmr.2015.3795 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 116.Luzi E, Marini F, Sala SC, Tognarini I, Galli G and Brandi ML (2008) Osteogenic differentiation of human adipose tissue-derived stem cells is modulated by the miR-26a targeting of the SMAD1 transcription factor. J. Bone Miner. Res 23, 287–295 10.1359/jbmr.071011 [DOI] [PubMed] [Google Scholar]
- 117.Wang J, Chen W, Li Y, Fan S, Weng J and Zhang X (1998) Biological evaluation of biphasic calcium phosphate ceramic vertebral laminae. Biomaterials 19, 1387–1392 10.1016/s0142-9612(98)00014-3 [DOI] [PubMed] [Google Scholar]
- 118.Chang YL, Stanford CM and Keller JC (2000) Calcium and phosphate supplementation promotes bone cell mineralization: implications for hydroxyapatite (HA)-enhanced bone formation. J. Biomed. Mater. Res 52, 270–278 10.1002/1097-4636(200011)52:2<270::aid-jbm5>3.0.co;2-1 [DOI] [PubMed] [Google Scholar]
- 119.Orii H, Sotome S, Chen J, Wang J and Shinomiya K (2005) Beta-tricalcium phosphate (beta-TCP) graft combined with bone marrow stromal cells (MSCs) for posterolateral spine fusion. J. Med. Dent. Sci 52, 51–57 10.11480/JMDS.520107 [DOI] [PubMed] [Google Scholar]
- 120.Liu B and Lun DX (2012) Current application of β-tricalcium phosphate composites in orthopaedics. Orthop. Surg 4, 139–144 10.1111/j.1757-7861.2012.00189.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Janko M, Dietz K, Rachor J, Sahm J, Schroder K, Schaible A et al. (2018) Improvement of bone healing by neutralization of microRNA-335-5p, but not by neutralization of microRNA-92A in bone marrow mononuclear cells transplanted into a large femur defect of the rat. Tissue Eng. A 25, 55–68 10.1089/ten.tea.2017.0479 [DOI] [PubMed] [Google Scholar]
- 122.Deng Y, Zhou H, Zou D, Xie Q, Bi X, Gu P et al. (2013) The role of miR-31-modified adipose tissue-derived stem cells in repairing rat critical-sized calvarial defects. Biomaterials 34, 6717–6728 10.1016/j.biomaterials.2013.05.042 [DOI] [PubMed] [Google Scholar]
- 123.Deng Y, Zhou H, Gu P and Fan X (2014) Repair of canine medial orbital bone defects with miR-31–modified bone marrow mesenchymal stem cells. Invest. Ophthalmol. Vis. Sci 55, 6016–6023 10.1167/iovs.14-14977 [DOI] [PubMed] [Google Scholar]
- 124.Liu Z, Chang H, Hou Y, Wang Y, Zhou Z, Wang M et al. (2018) Lentivirus-mediated microRNA-26a overexpression in bone mesenchymal stem cells facilitates bone regeneration in bone defects of calvaria in mice. Mol. Med. Rep 18, 5317–5326 10.3892/mmr.2018.9596 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 125.Liu M, Zeng X, Ma C, Yi H, Ali Z, Mou X et al. (2017) Injectable hydrogels for cartilage and bone tissue engineering. Bone Res 5, 17014 10.1038/boneres.2017.14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 126.Maisani M, Pezzoli D, Chassande O and Mantovani D (2017) Cellularizing hydrogel-based scaffolds to repair bone tissue: how to create a physiologically relevant micro-environment? J. Tissue Eng 8, 2041731417712073 10.1177/2041731417712073 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 127.Li Y, Fan L, Liu S, Liu W, Zhang H, Zhou T et al. (2013) The promotion of bone regeneration through positive regulation of angiogenic–osteogenic coupling using microRNA-26a. Biomaterials 34, 5048–5058 10.1016/j.biomaterials.2013.03.052 [DOI] [PubMed] [Google Scholar]
- 128.Qureshi AT, Doyle A, Chen C, Coulon D, Dasa V, Del Piero F et al. (2015) Photoactivated miR-148b-nanoparticle conjugates improve closure of critical size mouse calvarial defects. Acta Biomater 12, 166–173 10.1016/j.actbio.2014.10.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 129.Lei L, Liu Z, Yuan P, Jin R, Wang X, Jiang T et al. (2019) Injectable colloidal hydrogel with mesoporous silica nanoparticles for sustained co-release of microRNA-222 and aspirin to achieve innervated bone regeneration in rat mandibular defects. J. Mater. Chem. B 7, 2722–2735 10.1039/C9TB00025A [DOI] [PubMed] [Google Scholar]
- 130.Perrone GS, Leisk GG, Lo TJ, Moreau JE, Haas DS, Papenburg BJ et al. (2014) The use of silk-based devices for fracture fixation. Nat. Commun 5, 3385 10.1038/ncomms4385 [DOI] [PubMed] [Google Scholar]
- 131.Koolen PGL, Haas D, Kim K, Fox S, Ibrahim AMS, Kim P et al. (2016) Increased osteoid formation in BMP-2–loaded silk-based screws. Plast. Reconstr. Surg 137, 808e–8817e 10.1097/PRS.0000000000002080 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 132.Li C, Hotz B, Ling S, Guo J, Haas DS, Marelli B et al. (2016) Regenerated silk materials for functionalized silk orthopedic devices by mimicking natural processing. Biomaterials 110, 24–33 10.1016/j.biomaterials.2016.09.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 133.Altman GH, Diaz F, Jakuba C, Calabro T, Horan RL, Chen J et al. (2003) Silk-based biomaterials. Biomaterials 24, 401–416 10.1016/S0142-9612(02)00353-8 [DOI] [PubMed] [Google Scholar]
- 134.Sofia S, McCarthy MB, Gronowicz G and Kaplan DL (2001) Functionalized silk-based biomaterials for bone formation. J. Biomed. Mater. Res 54, 139–148 10.1002/1097-4636(200101)54:1<139::AID-JBM17>3.0.CO;2-7 [DOI] [PubMed] [Google Scholar]
- 135.James EN, Van Doren E, Li C and Kaplan DL (2018) Silk biomaterials-mediated miRNA functionalized orthopedic devices. Tissue Eng. A 25, 12–23 10.1089/ten.tea.2017.0455 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 136.Ulery BD, Nair LS and Laurencin CT (2011) Biomedical applications of biodegradable polymers. J. Polym. Sci. B Polym. Phys 49, 832–864 10.1002/polb.22259 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 137.Tahmasebi A, Enderami SE, Saburi E, Islami M, Yaslianifard S, Mahabadi JA et al. (2020) Micro-RNA-incorporated electrospun nanofibers improve osteogenic differentiation of human-induced pluripotent stem cells. J. Biomed. Mater. Res. A 108, 377–386 10.1002/jbm.a.36824 [DOI] [PubMed] [Google Scholar]
- 138.Hoseinzadeh S, Atashi A, Soleimani M, Alizadeh E and Zarghami N (2016) MiR-221-inhibited adipose tissue-derived mesenchymal stem cells bioengineered in a nano-hydroxy apatite scaffold. In Vitro Cell. Dev. Biol. Anim 52, 479–487 10.1007/s11626-015-9992-x [DOI] [PubMed] [Google Scholar]
- 139.Kou JH, Emmett C, Shen P, Aswani S, Iwamoto T, Vaghefi F et al. (1997) Bioerosion and biocompatibility of poly(d,l-lactic-co-glycolic acid) implants in brain. J. Control. Release 43, 123–130 10.1016/S0168-3659(96)01477-0 [DOI] [Google Scholar]
- 140.Menei P, Daniel V, Montero-Menei C, Brouillard M, Pouplard-Barthelaix A and Benoit JP (1993) Biodegradation and brain tissue reaction to poly (D,L-lactide-co-glycolide) microspheres. Biomaterials 14, 470–478 10.1016/0142-9612(93)90151-Q [DOI] [PubMed] [Google Scholar]
- 141.Liao Y-H, Chang Y-H, Sung L-Y, Li K-C, Yeh C-L, Yen T-C et al. (2014) Osteogenic differentiation of adipose-derived stem cells and calvarial defect repair using baculovirus-mediated co-expression of BMP-2 and miR-148b. Biomaterials 35, 4901–4910 10.1016/j.biomaterials.2014.02.055 [DOI] [PubMed] [Google Scholar]
- 142.Qi P, Niu Y and Wang B (2021) MicroRNA-181a/b-1-encapsulated PEG/PLGA nanofibrous scaffold promotes osteogenesis of human mesenchymal stem cells. J. Cell. Mol. Med 25, 5744–5752 10.1111/jcmm.16595 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 143.Shirazaki P, Varshosaz J and Kharazi A (2017) Electrospun gelatin/poly(Glycerol Sebacate) membrane with controlled release of antibiotics for wound dressing. Adv. Biomed. Res 6, 105 10.4103/abr.abr_197_16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 144.You Z and Wang Y (2011) Bioelastomers in Tissue Engineering. In Biomaterials for Tissue Engineering Applications: A Review of the Past and Future Trends (Burdick JA and Mauck RL, eds), pp. 75–118, Springer Vienna, Vienna [Google Scholar]
- 145.Deng Y, Bi X, Zhou H, You Z, Wang Y, Gu P et al. (2014) Repair of critical-sized bone defects with anti-miR-31-expressing bone marrow stromal stem cells and poly(glycerol sebacate) scaffolds. Eur. Cell. Mater 27, 13–24; discussion 24-15 10.22203/ecm.v027a02 [DOI] [PubMed] [Google Scholar]
- 146.Xie Q, Wang Z, Zhou H, Yu Z, Huang Y, Sun H et al. (2016) The role of miR-135-modified adipose-derived mesenchymal stem cells in bone regeneration. Biomaterials 75, 279–294 10.1016/j.biomaterials.2015.10.042 [DOI] [PubMed] [Google Scholar]
- 147.Xie Q, Wei W, Ruan J, Ding Y, Zhuang A, Bi X et al. (2017) Effects of miR-146a on the osteogenesis of adipose-derived mesenchymal stem cells and bone regeneration. Sci. Rep 7, 42840 10.1038/srep42840 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 148.Moncal KK, Aydin RST, Abu-Laban M, Heo DN, Rizk E, Tucker SM et al. (2019) Collagen-infilled 3D printed scaffolds loaded with miR-148b-transfected bone marrow stem cells improve calvarial bone regeneration in rats. Mater. Sci. Eng C. 105, 110128 10.1016/j.msec.2019.110128 [DOI] [PMC free article] [PubMed] [Google Scholar]
