Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2024 Jun 21;5(3):103012. doi: 10.1016/j.xpro.2024.103012

Protocol to sequence markers from pollen grains carried by long-range migratory butterflies using metabarcoding

Johanna Luise Gorki 1,3,4, Tomasz Suchan 2,3,4, Gerard Talavera 1,5,
PMCID: PMC11245965  PMID: 38907998

Summary

Molecular identification of pollen carried by insects informs about their history of visited plants. For migratory butterflies, it can be used to trace long-range movements enduring days of flight over thousands of kilometers. Here, we present a protocol to (1) isolate pollen grains from butterfly bodies and (2) prepare metabarcoding libraries for their identification using the internal transcribed spacer 2 fragment, a common barcode used to identify plants. This protocol would be applicable to other insect groups and metabarcoding markers.

For complete details on the use and execution of this protocol, please refer to Suchan et al.1 and Gorki et al.2

Subject areas: Plant sciences, Environmental sciences

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Steps for pollen isolation from butterfly bodies

  • Direct amplification of ITS2 genetic barcode from pollen grains

  • Instructions for library preparation and sequencing pool preparation


Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.


Molecular identification of pollen carried by insects informs about their history of visited plants. For migratory butterflies, it can be used to trace long-range movements enduring days of flight over thousands of kilometers. Here, we present a protocol to (1) isolate pollen grains from butterfly bodies and (2) prepare metabarcoding libraries for their identification using the internal transcribed spacer 2 fragment, a common barcode used to identify plants. This protocol would be applicable to other insect groups and metabarcoding markers.

Before you begin

This protocol describes the isolation of pollen from dry butterfly samples stored in sealed envelopes after collection and the preparation of libraries to amplify plant-specific molecular barcodes. The ultimate goal is to identify the diversity of pollen carried by individual butterflies. The described protocol has also been tested on butterfly specimens that have been stored in ethanol at the long-term. The Internal Transcribed Spacer 2 (ITS2) fragment was targeted for amplification to further identify the diversity of plant species but can be easily adapted for other metabarcoding markers and insect groups.

Other metabarcoding markers can be targeted by changing the primers used in the first PCR (step 14). The structure of each primer consists of the partial Illumina adapter, followed by six random nucleotides necessary for template generation on non-patterned Illumina flow cells (MiniSeq, MiSeq, NextSeq 500/550, and HiSeq 1000/2500 MiniSeq, MiSeq, NextSeq 500/550, and HiSeq 1000/2500), and the metabarcoding primer sequence itself - denoted as [forward primer] and [reverse primer] in the sequence below:

1st forward primer: ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN [forward primer].

1st reverse primer: GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC TNN NNN N [reverse primer].

The annealing temperature for the custom primers using Phire DNA polymerase that is used in our protocol can be calculated using the ThermoFisher Tm calculator:

(https://www.thermofisher.com/de/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html).

The timing for the whole protocol is calculated for the batch of 22 butterfly samples plus two controls: isolation and PCR control.

Protocol preparations

Inline graphicTiming: 0.5 h

  • 1.

    If possible, perform the steps prior to the first PCR (1 to 15) within a laminar-flow cabinet. This minimizes airborne pollen contamination and inter-sample cross-contamination.

  • 2.

    Thoroughly clean the area and equipment using 10% bleach followed by distilled water and 70% cleaning alcohol to remove bleach residues.

  • 3.

    If possible, sterilize the area and equipment by exposing them to UV light (254 nm).

Note: The plastics can be sterilized in UV crosslinker for 30 min, placed close to the UV lamp,3 water or tris buffer for 10 min.4 The UV light in the laminar-flow cabinet will not remove all DNA from work surfaces at larger distance5 but can be applied to further reduce background DNA after bleach cleaning.

  • 4.

    Prepare 10 μM primer working solutions from the stock.

Note: Take special care when working with indexed primer solutions to avoid cross-contamination. Work under the laminar-flow cabinet if possible.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Biological samples

Samples of Vanessa cardui butterflies were used in this study. The protocol is not taxon-specific and can be applied to other insect pollinators N/A

Chemicals, peptides, and recombinant proteins

Beckman Coulter Agencourt AMPure XP Beads Beckman Coulter GmbH Cat#A63881
dNTP Mix, 10 mM each Thermo Fisher Scientific Cat#R0192
Phire Plant Direct PCR master mix Thermo Fisher Scientific Cat#F106S or F106L
Phusion High-Fidelity DNA-polymerase (2 U/μL) Thermo Fisher Scientific Cat#F530S
Ethanol ≥99.5%, Ph. Eur., extra pure Carl Roth Cat#5054
Deionized ultrapure water, UV treated Millipore
Optionally: 1 M Tris buffer Sigma Cat#648314

Oligonucleotides

ITS-S2F6: ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCTNNN NNN ATG CGA TAC TTG GTG TGA AT
ITS-4R7: GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATCTNN NNN NTC CTC CGC TTA TTG ATA TGC
i7 indexing primer: CAAGCAGAAGACGGCATACGAGAT [i7] GTGACTGGAGTTCAGACGTGTGC See Table S1
i5 indexing primer: AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGC See Table S1

Other

Screw cap free-standing micro tube, sterile, 2 mL Sarstedt Cat#72.694.005
Screw caps suitable for screw cap micro tubes Sarstedt Cat#65.716.725
Borosilicate glass beads 3 mm Merck KGaA Cat#Z143928
Brand PCR strip tubes and caps Merck KGaA Cat#BR781327
TissueLyser LT QIAGEN Cat#85600
Savant SpeedVac Thermo Scientific Cat#SPD111V-230
CL-1000 UV crosslinker or similar (optional) Analytik Jena Cat#95-0174-02
Qubit or Qubit Flex fluorometer (optional) Thermo Fisher Scientific Cat#Q33238 or Q33327
2100 Bioanalyzer or 5300 Fragment Analyzer system (optional) Agilent Cat#G2991BA or M5311AA

Materials and equipment

  • For butterfly dissection: forceps, scissors, 100 mL glass beakers, a Bunsen burner, and pre-cut 5 × 5 cm paper (e.g., filter paper or paper towels) are needed.

  • Borosilicate glass beads (5 per sample) – sterilized either by autoclaving or 10% bleach wash followed by through wash in distilled water (at least 3 times), drying and sterilizing for 30 min in UV crosslinker.

  • Centrifugation steps were conducted with an Eppendorf 5420 microcentrifuge (cat. no. 5420000318) for 24 reaction vials.

  • 0.5× Phire Plant Direct Dilution buffer: 1 unit of 1× Phire Plant Direct Dilution Buffer (from Phire Plant Direct PCR MasterMix kit, see above), 1 unit of nuclease-free water.

  • Oligonucleotides should all be at NGS purification grade. The indexed primers can also be bought as kits from Illumina or other providers.

  • Each primer in 10 μM concentration: 10 μL of the 100 μM stock solution, 90 μL of Millipore water

  • 70% ethanol solution: 70 mL of 99.5% extra pure ethanol, 30 mL of Millipore water.

  • 70% alcohol cleaning solution: 70 mL of 99.5% denatured ethanol or isopropanol, 30 mL of distilled water.

  • Optionally 10 mM Tris buffer: 10 μL of 1 M Tris buffer concentrate, 990 μL of Millipore water.

Step-by-step method details

Pollen isolation from butterfly bodies

Inline graphicTiming: ∼4 h for 23 samples

This section describes the collection and isolation of pollen from butterfly bodies. Starting sample material are field-collected butterflies, immediately stored in glassine envelopes, killed by pinching the thorax and dried. If pollen isolation is intended from butterfly bodies stored in ethanol, see the note in step 3.

Inline graphicCRITICAL: These steps should be done in a sterile area, preferably under a laminar flow hood.

  • 1.

    Prepare 22 butterfly samples for each isolation batch.

  • 2.
    For each specimen, prepare two 2 mL sterile free-standing tubes:
    • a.
      Add 1.5 mL of sterile 99.5% ethanol for storage of the bodies (“storage tube”).
    • b.
      Add 500 μL of sterile 99.5% ethanol for pollen isolation (“pollen isolation tube”).
  • 3.
    For each sample, separate the wings from the body:
    • a.
      Clean the butterfly envelope from the outside by wiping with a paper towel wetted with small amount of 10% bleach.
    • b.
      Take the butterfly out of the envelope with sterilized forceps and place it on a piece of paper.
    • c.
      Separate the wings from the body using sterilized forceps and/or scissors.
      Optional: Dip the body of the butterfly in ethanol from the prepared storage tube and use it as a brush to collect pollen from inside the envelope. If the body is too fragile and prone to damage, this step can be discarded.
    • d.
      Place the body of the butterfly in the pollen isolation tube, head down.
    • e.
      Store wings in the original envelope.
    • f.
      Store pieces of the body that may have dislodged during preparation in the storage tube.
      Note: In-between samples, clean forceps and scissors by dipping them in 10% bleach, water and 70% cleaning alcohol, in this order. Remove residues of ethanol by holding forceps and scissors into a flame. Change the paper and clean the working area with 10% bleach solution and 70% cleaning alcohol.
      Note: For isolating pollen from butterflies that have been stored in ethanol at −20°C: transfer the butterfly body from the original tube to a new storage tube. Try to transfer all body pieces. The original tube functions now as the pollen isolation tube.
  • 4.

    Upon completing processing all the samples, open a tube containing 500 μL of sterile 99.5% ethanol in the working area for 20 s, to function as a contamination control (“pollen isolation control”).

  • 5.

    Vortex each pollen isolation tube containing butterfly bodies vigorously for 5 s.

  • 6.

    Centrifuge the pollen isolation tubes for 15 min at 9400 × g.

  • 7.

    Transfer body parts from the pollen isolation tube to the designated storage tube for long-term storage for DNA analyses. Try to extract all body parts and most of the debris using forceps.

Note: Clean forceps between each sample with 10% bleach, water and ethanol as described above.

Note: Storage tubes including specimen’s bodies in ethanol can be stored at −20°C and are not further needed to complete this protocol.

  • 8.

    Centrifuge pollen isolation tubes for 1 min at 9400 × g.

  • 9.

    Centrifuge pollen isolation tubes at maximum speed in a vacuum concentrator at 50°C for a minimum of 1 h or until all ethanol evaporates. The resultant pellet will include the isolated pollen grains.

Note: Uncap the tubes before using the vacuum concentrator. Once processing is complete, replace the caps with new sterile ones. If you isolate pollen from ethanol-stored butterflies, the required centrifugation time in the vacuum concentrator will increase, as the amount of ethanol to evaporate is higher.

Inline graphicPause point: Pollen pellets can be stored at −20°C until further usage.

ITS2 amplification

Inline graphicTiming: ∼1 day for 24 samples (23 samples + 1 control)

This section describes the steps to amplify the ITS2 genetic barcode from pollen grains.

Inline graphicCRITICAL: The following steps should be done in a sterile area, preferably under a laminar flow hood.

  • 10.

    Before you start: Clean the area thoroughly with 10% bleach followed by 70% cleaning alcohol. If possible, sterilize the area and equipment by exposing them to UV light for at least 10 min.

  • 11.

    For each sample: add 25 μL of 0.5× diluted Phire Plant Dilution buffer and 5 glass beads to the pollen pellet. Disrupt the pellet with a pipette tip when adding the buffer.

  • 12.

    Homogenize in a TissueLyser at 30 Hz for 3 min.

  • 13.

    Centrifuge samples for 20 s at 13500 × g (short spin for 20 s).

  • 14.

    Prepare the PCR master mix. Account for the pollen isolation control in your calculations and add a PCR control at this step. Set up 3 reactions for each sample and the control, add one reaction to your calculations to account for pipetting errors.

Reagent Amount (μL)
nuclease-free water 18.0
2× Phire Plant Direct PCR MasterMix 25.0
10 μM ITS2 forward primer ITS2-S2F 2.5
10 μM ITS2 reverse primer ITS2-4R 2.5

Note: Keep all reagents on ice.

  • 15.
    Prepare the PCR reaction.
    • a.
      Add 48 μL of the PCR Master mix to each PCR tube.
    • b.
      Add 2 μL of the disrupted pollen pellet. Pipette gently to mix the sample with the Master mix.
    • c.
      For the PCR control, add 2 μL of nuclease-free water.

Note: The disrupted pollen pellet can be viscous. Pipette the sample slowly.

Note: Working under a laminar flow hood is not necessary beyond this point anymore.

  • 16.

    Perform PCR with the following thermocycling steps.

PCR cycling conditions

Steps Temperature Time Cycles
Initial Denaturation 98°C 5 min 1
Denaturation 98°C 40 s 20 cycles
Annealing 49°C 40 s
Extension 72°C 40 s
Final extension 72°C 1 min 1
Hold 4°C Hold

Note: If you use a different set of primers, change the annealing temperature accordingly.

  • 17.

    For each sample: combine the resulting PCR product from triplicates in a single 1.5 mL tube.

  • 18.
    Clean the PCR product with AMPure XP beads:
    • a.
      Prepare a fresh solution of 70% ethanol, expect at least 600 μL per sample.
    • b.
      Add 1:1 ratio of AMPure XP beads to the sample (i.e., 150 μL of AMPure XP for 150 μL of the combined PCR triplicates).
    • c.
      Incubate the tubes for 5 min at 20°C–25°C.
    • d.
      Place the tubes on a magnet to capture beads on a side until liquid becomes clear.
    • e.
      Carefully remove and discard the supernatant by pipetting.
    • f.
      Keep the tubes on the magnet and add 300 μL of 70% ethanol.
    • g.
      Incubate the tubes at 20°C–25°C temperature for 30 s.
    • h.
      Carefully remove and discard the ethanol by pipetting.
    • i.
      Repeat steps 18 f-h.
    • j.
      Try removing residual ethanol and dry the beads at 20°C–25°C for 2 min
      Inline graphicCRITICAL: Over-drying may result in reduced yield.
    • k.
      Remove the tubes from the magnet and resuspend the beads in 10 μL of nuclease-free water or 10 mM Tris buffer.
    • l.
      Incubate tubes at 20°C–25°C for 2 min to elute PCR product off the beads.
    • m.
      Place the tubes back on the magnet and incubate until the liquid is fully clear.
    • n.
      Transfer the supernatant to a new tube.
      Note: We recommend processing a maximum of 8 samples at the same time.
      Inline graphicPause point: The PCR product can be stored at −20°C until further usage.

Library preparation

Inline graphicTiming: 2 h for 25 samples (23 samples + 2 controls)

This section describes steps to individually tag the libraries from each individual using dual-indexing approach.

  • 19.

    Prepare the PCR master mix. Set up 3 reactions for each sample and the control, add one or two reactions to your calculations to account for pipetting errors.

Reagent Amount (μL)
nuclease-free water 5.6
5× HF Buffer 2.0
dNTPs mix (10 mM each) 0.2
Phusion Polymerase 0.2
  • 20.
    Prepare the PCR reaction. Set up 3 reactions for each sample.
    • a.
      Add 8 μL of the PCR Master mix to each PCR tube.
    • b.
      Add a unique combination of 0.5 μL 10 μM i7 indexing primer (Table S1) and 0.5 μL 10 μM i5 indexing primer (Table S1) to each of the PCR tubes.
    • c.
      Add 1 μL of the purified PCR product from the previous steps.

Inline graphicCRITICAL: Each sample has an individual combination of indexing primers to identify the sample after sequencing. Keep proper track of the primer combinations used for each sample. We use the same combination of primers for each triplicate reaction.

Inline graphicCRITICAL: This step needs to be done on ice.

  • 21.

    Perform PCR with the following thermocycling steps.

PCR cycling conditions

Steps Temperature Time Cycles
Initial Denaturation 98°C 30 s 1
Denaturation 98°C 10 s 12 cycles
Combined annealing and elongation 72°C 30 s
Final extension 72°C 1 min 1
Hold 4°C Hold
  • 22.

    For each sample: combine PCR product triplicates in a single tube.

Inline graphicPause point: PCR product can be stored at −20°C until further usage.

  • 23.

    Pool the triplicates for each sample.

  • 24.

    Verify the PCR success by agarose electrophoresis using 5 μL of each sample. See Figure 1 for the expected results.

  • 25.

    Purify pools with a 1:1 ratio of AMPure XP beads as described in step 18 and elute in 10 μL of nuclease-free water or 10 mM Tris buffer.

Figure 1.

Figure 1

Example DNA profiles of metabarcoding libraries obtained from samples (S), isolation control (CI), and PCR control (C). Controls do not show visible bands in the agarose gel, although very low DNA concentrations are measured with a Qubit fluorometer instrument as indicated below each of the gel lanes.

Final sequencing pool preparation

Inline graphicTiming: 2 h for 25 samples (23 samples + 2 controls)

In this section, the libraries are polled, purified, and quality-controlled for sequencing.

  • 26.

    Pool 3 μL from each sample into a single 1.5 mL tube.

  • 27.

    Purify the pool with a 1:1 ratio of AMPure XP beads as described in step 18 and elute in 15 μL of nuclease-free water.

  • 28.

    Perform quality control and quantification of the purified pool. Preferably, estimate the average fragment length using Bioanalyzer or TapeStation (Agilent) and quantify the concentration using a Qubit instrument. Calculate the molarity using the instructions below. If you do not have access to these instruments, this service can usually be requested from sequencing facilities.

Note: You can increase the volume of each sample taken in step 22 if the concentration is too low (see expected outcomes), but that requires the use of more AMPure XP beads.

Expected outcomes

The length of the ITS2 gene in mosses, ferns, gymnosperms, and angiosperms can range from 100 bp to 700 bp.8 Hence, depending on the composition of the pollen mix, it is possible to obtain DNA fragments ranging from 250 bp to 850 bp, as the final library fragments include 150 bp of sequencing adapters. Predominant fragments should be visible in agarose gels. Control samples should not show noticeable bands. An example is given in Figure 1. After pooling and purification, no primers or primer-dimers should be visible in the TapeStation profile.

Sequencing facilities should provide guidelines on the quantity and concentration of the libraries intended to sequence. Quantify the library with Qubit and check the profile on a Bioanalyzer, TapeStation or similar instrument. An expected quality control outcome from Bioanalyzer is shown in Figure 2.

Figure 2.

Figure 2

Example of the Bioanalyzer outcome from an ITS2 metabarcoding library containing 280 samples.

A peak at 540 bp is visible, corresponding to the most abundant amplicons.

The sequencing of metabarcoding libraries is usually performed on Illumina MiSeq instrument as this is the only one that can sequence 2 × 250 and 2 × 300 bp reads in the quantity usually needed for such projects. In case a higher amount of data would be necessary, NovaSeq 6000 system can sequence reads of 2 × 250 bp and NextSeq 1000 and NextSeq 2000 sequence 2 × 300 bp reads. We used MiSeq Reagent Kit v2 500 cycles (2 × 250 bp) for sequencing the libraries. According to the guidelines, a minimum of 5 μL of a 2 or 4 nM library is needed for the sequencing instrument, depending on the version of the reagent kits (v2 and v3 kits, respectively). This corresponds to the concentration of 0.0636 and 0.1272 ng/μL, respectively, for the mean of 540 bp library size, but we recommend starting with higher concentrations as it is easier to dilute than concentrate the sample, and some amount of the library will be required for the quantification and profile check. Use the following formula to calculate the molarity:

concentrationinnM=concentrationinng/μL600g/mol×averagelibrarysize×106

Make sure to mention to the sequencing facilities that the supplied libraries are amplicon-based with low expected complexity. Because the complexity of the libraries is low, it is recommended to add 15% spike-in of PhiX Sequencing Control v3 (Illumina) for sequencing.

Bioinformatic treatment of the obtained data is beyond the scope of this paper but working pipelines can be found in the associated papers1,2 and in the repository https://github.com/GTlabIBB/Pollen2019 (Zenodo: http://doi.org/10.5281/zenodo.10802534).

Limitations

The method is also applicable for butterflies stored in long-term collections, but it should be noted that, if pollen metabarcoding was not planned beforehand, these butterflies could have been exposed to possible contamination, which cannot be discarded or tested in this case.

In terms of plant molecular identification, this protocol recovers the diversity of ITS2 sequences, but their further classification will be limited to plants previously characterized in barcode repositories. These gaps in sequence diversity may lead to misidentifications.

Troubleshooting

Problem 1

Low or no yield of PCR product after ITS2 amplification (related to steps 10–18).

Potential solution

  • Too large sample volume in the PCR: Do not increase the sample volume for one PCR reaction as the dilution buffer contains EDTA which at certain concentrations can inhibit the polymerase activity.9

  • Ethanol carry-over to the PCR: Suboptimal evaporation of ethanol for pollen isolation (step 9) or AMPure purification (step 18) can inhibit PCR. Hence, it is important to ensure ethanol evaporation through the vacuum concentrator.

  • Improper mixing of the sample in the PCR: If the diluted and disrupted pellet is too viscous and not mixed properly via pipetting up and down, the PCR components and the sample stay in two separate phases. In the case of a large pellet, consider increasing the amount of 0.5× Dilution Buffer as inhibition can happen due to excessive input, but keep the same sample volume for one PCR reaction. Another possible solution might be to dilute the buffer further and increase the sample volume for one PCR reaction or split it into even more reactions (more than three as used here) that can be pooled before AMPure purification.

  • Inhibition: Although usage of direct polymerase and avoiding DNA isolation step makes our method very cost- and time-effective, if inhibition occurs and the above steps do not work, it might be necessary to extract the DNA first. In such case the first PCR mix can be modified as direct polymerase is not necessary and the reaction volumes can be reduced.

  • Too little PCR cycles: PCR cycles optimalization using positive samples with low amounts of pollen can be also performed if samples other than described here are used as input material.

  • No template in the samples: Some samples will not give signal as not all specimens will carry or release pollen grains. Therefore, it is important to work in batches of samples and screen many individuals at once.

Problem 2

Signal in pollen isolation or PCR control (related to steps 1–18).

Potential solution

  • Sample (cross-) contamination: Although small numbers of reads might occur in the control samples and would be filtered at the bioinformatic steps, larger (cross-) contamination is problematic. If that occurs, make sure to sterilize the area thoroughly with bleach and alcohol between each sample and work under the laminar flow cabinet. The tools might be further sterilized in the UV crosslinker. Use filter tips for all the pipetting steps and prepare all the reagents in small aliquots. Make sure to work in a separated pre-PCR area with no amplified DNA present. Working in batches and controlling for the signal in blank samples might allow revealing the sources of (cross-) contamination. It is advisable to work in laboratories with closed windows and preferably avoiding the spring season.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Gerard Talavera (gerard.talavera@csic.es).

Technical contact

Johanna Luise Gorki (luisegorki@yahoo.de), Tomasz Suchan, (t.suchan@botany.pl).

Materials availability

This study did not generate new unique reagents.

Data and code availability

The accesion number for the sequencing reads generated for the corresponding paper2 is ENA: PRJEB61277.

Code for sequencing data analysis is available in the following repository: https://github.com/GTlabIBB/Pollen2019, with the permanent version record under Zenodo: https://doi.org/10.5281/zenodo.10802534.

Acknowledgments

This work was funded by the National Geographic Society (grant WW1-300R-18), the grant LINKA20399 from the CSIC iLink program, the grant 2021-SGR-01334 from the Generalitat de Catalunya, and the grant PID2020-117739GA-I00 MCIN/AEI/10.13039/501100011033 to G.T. The graphical abstract was created with BioRender.com, and the buttefly drawing was made by Blanca Martí.

Author contributions

Conceptualization, J.L.G., T.S., and G.T.; methodology, J.L.G., T.S., and G.T.; experimental investigation, J.L.G., T.S., and G.T.; writing – original draft, J.L.G.; writing – review and editing, J.L.G., T.S., and G.T.

Declaration of interests

The authors declare no competing interests.

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.xpro.2024.103012.

Supplemental information

Document S1. Table S1
mmc1.pdf (53.2KB, pdf)

References

  • 1.Suchan T., Talavera G., Sáez L., Ronikier M., Vila R. Pollen metabarcoding as a tool for tracking long-distance insect migrations. Mol. Ecol. Resour. 2019;19:149–162. doi: 10.1111/1755-0998.12948. [DOI] [PubMed] [Google Scholar]
  • 2.Gorki J.L., Sáez L., López-Mañas R., Menchetti M., Shapoval N., Andersen A., Benyamini D., Daniels S., García-Berro A., Reich M.S., et al. Pollen metabarcoding reveals the origin and multigenerational migratory pathway of a continental-scale butterfly outbreak. Curr. Biol. 2024;34:2684–2692. doi: 10.1016/j.cub.2024.05.037. [DOI] [PubMed] [Google Scholar]
  • 3.Tamariz J., Voynarovska K., Prinz M., Caragine T. The application of ultraviolet irradiation to exogenous sources of DNA in plasticware and water for the amplification of low copy number DNA. J. Forensic Sci. 2006;51:790–794. doi: 10.1111/j.1556-4029.2006.00172.x. [DOI] [PubMed] [Google Scholar]
  • 4.Champlot S., Berthelot C., Pruvost M., Bennett E.A., Grange T., Geigl E.M. An efficient multistrategy DNA decontamination procedure of PCR reagents for hypersensitive PCR applications. PLoS One. 2010;5 doi: 10.1371/journal.pone.0013042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Nilsson M., De Maeyer H., Allen M. Evaluation of different cleaning strategies for removal of contaminating DNA molecules. Genes. 2022;13:162. doi: 10.3390/genes13010162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chen S., Yao H., Han J., Liu C., Song J., Shi L., Zhu Y., Ma X., Gao T., Pang X., et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One. 2010;5 doi: 10.1371/journal.pone.0008613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.White T.J., Bruns T., Lee S., Taylor J. In: PCR Protocols: A Guide to Methods and Applications. Innis M.A., Gelfand D.H., Sninsky J.J., White T.J., editors. Academic Press; 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics; pp. 315–322. [Google Scholar]
  • 8.Yao H., Song J., Liu C., Luo K., Han J., Li Y., Pang X., Xu H., Zhu Y., Xiao P., et al. Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS One. 2010;5 doi: 10.1371/journal.pone.0013102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Schrader C., Schielke A., Ellerbroek L., Johne R. PCR inhibitors–occurrence, properties and removal. J. Appl. Microbiol. 2012;113:1014–1026. doi: 10.1111/j.1365-2672.2012.05384.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Table S1
mmc1.pdf (53.2KB, pdf)

Data Availability Statement

The accesion number for the sequencing reads generated for the corresponding paper2 is ENA: PRJEB61277.

Code for sequencing data analysis is available in the following repository: https://github.com/GTlabIBB/Pollen2019, with the permanent version record under Zenodo: https://doi.org/10.5281/zenodo.10802534.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES